ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal21b08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK059369.1| Oryza sativa (japonica cultivar-group) cDNA clon... 379 e-102
2dbj|AK104449.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
3dbj|AK068619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
4gb|BT016239.1| Zea mays clone Contig72 mRNA sequence 230 4e-57
5dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 123 7e-25
6gb|AC137619.3| Oryza sativa (japonica cultivar-group) chromosome... 123 7e-25
7gb|AY105893.1| Zea mays PCO126260 mRNA sequence 88 4e-14
8ref|NM_102941.1| Arabidopsis thaliana N-acetyltransferase AT1G32... 60 9e-06
9ref|NM_202221.1| Arabidopsis thaliana N-acetyltransferase AT1G32... 60 9e-06
10gb|AY281105.1| Arabidopsis thaliana nuclear shuttle interacting ... 60 9e-06
11gb|BT024481.1| Arabidopsis thaliana At1g32070 mRNA, complete cds 60 9e-06
12emb|BX817946.1|CNS0AEC8 Arabidopsis thaliana Full-length cDNA Co... 60 9e-06
13emb|BX813875.1|CNS0AEHT Arabidopsis thaliana Full-length cDNA Co... 60 9e-06
14emb|BX818104.1|CNS0ACHM Arabidopsis thaliana Full-length cDNA Co... 60 9e-06
15gb|AY086183.1| Arabidopsis thaliana clone 22071 mRNA, complete s... 60 9e-06
16dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 56 1e-04
17dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 52 0.002
18gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 52 0.002
19gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 50 0.009
20gb|AC158556.9| Mus musculus chromosome 15, clone RP23-140F20, co... 46 0.14
21emb|AL050309.4|HSJ148M19 Human DNA sequence from clone RP1-148M1... 46 0.14
22gb|AC121589.3| Mus musculus BAC clone RP23-281G14 from chromosom... 44 0.54
23emb|AL445430.15| Human DNA sequence from clone RP11-716O23 on ch... 44 0.54
24gb|BC051414.1| Mus musculus U1 small nuclear ribonucleoprotein p... 44 0.54
25gb|BC043938.1| Mus musculus U1 small nuclear ribonucleoprotein p... 44 0.54
26dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.54
27emb|AM180252.1| Lawsonia intracellularis PHE/MN1-00 44 0.54
28gb|AC151602.4| Mus musculus BAC clone RP23-218K15 from chromosom... 44 0.54
29gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.54
30emb|BX000509.2|CNS08CDZ Oryza sativa chromosome 12, . BAC OJ1085... 44 0.54
31gb|AC125670.4| Rattus norvegicus BAC CH230-113E22 (Children's H... 42 2.1
32emb|AL158053.14| Human DNA sequence from clone RP11-156J23 on ch... 42 2.1
33gb|AC018525.8| Homo sapiens chromosome 8, clone RP11-3J13, compl... 42 2.1
34gb|AC103853.2| Homo sapiens chromosome 8, clone RP11-642D21, com... 42 2.1
35gb|AC074309.4|AC074309 Arabidopsis thaliana chromosome 1 BAC T12... 42 2.1
36gb|AC018891.9| Homo sapiens BAC clone RP11-498M11 from 2, comple... 42 2.1
37gb|AC010533.6|AC010533 Homo sapiens chromosome 16 clone RP11-229... 42 2.1
38gb|AC084464.1|AC084464 Caenorhabditis briggsae cosmid CB038P16, ... 42 2.1
39gb|AC084423.1|AC084423 Caenorhabditis briggsae cosmid CB020D11, ... 42 2.1
40gb|AC010140.3|AC010140 Homo sapiens BAC clone RP11-218E11 from Y... 42 2.1
41gb|AF191069.1|AF191069 Homo sapiens chromosome 21 clone P704-682... 42 2.1
42gb|AF096876.1|AF096876 Homo sapiens chromosome 21q22.1 PAC K0920... 42 2.1
43dbj|BS000177.1| Pan troglodytes chromosome 22 clone:PTB-118H03, ... 42 2.1
44gb|AY739307.1| Oryza sativa (japonica cultivar-group) adenosine ... 42 2.1
45gb|AC154870.4| Monodelphis domestica, clone XX-218A9, complete s... 42 2.1
46dbj|AP001707.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 42 2.1
47dbj|AP005354.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 2.1
48gb|AC131083.8| Mus musculus chromosome 1, clone RP23-444L13, com... 40 8.4
49ref|XM_638641.1| Dictyostelium discoideum putative Nek family pr... 40 8.4
50gb|AF074021.1| Arabidopsis thaliana BAC F4H6, chromosome IV, com... 40 8.4
51ref|XM_960812.1| Encephalitozoon cuniculi GB-M1 eukaryotic trans... 40 8.4
52gb|AF391985.1| Uncultured thermal soil bacterium clone YNPFFP2 1... 40 8.4
53gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 40 8.4
54gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 8.4
55gb|AC104866.10| Mus musculus chromosome 17, clone RP23-268C14, c... 40 8.4
56emb|AL732366.7| Human DNA sequence from clone RP11-393H10 on chr... 40 8.4
57emb|AL928688.3| Human DNA sequence from clone RP11-77N10 on chro... 40 8.4
58emb|AL603844.7| Human DNA sequence from clone RP11-541I21 on chr... 40 8.4
59gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 8.4
60gb|AC101786.7| Mus musculus chromosome 1, clone RP24-146K19, com... 40 8.4
61emb|BX572606.1| Rhodopseudomonas palustris CGA009 complete genom... 40 8.4
62emb|AL391737.2|CNS06C8G chromosome I of strain GB-M1 of Encephal... 40 8.4
63emb|AL161500.2|ATCHRIV12 Arabidopsis thaliana DNA chromosome 4, ... 40 8.4
64emb|AJ248283.1|CNSPAX01 Pyrococcus abyssi complete genome; segme... 40 8.4
65emb|AJ006823.1|ECU6823 Encephalitozoon cuniculi ef2 gene 40 8.4
66gb|AC006484.2| Homo sapiens chromosome 5, clone hRPK.448_K_10, c... 40 8.4
67emb|CR533571.9| Zebrafish DNA sequence from clone CH211-209O12 i... 40 8.4
68gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 8.4
69gb|AC105363.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.4
70gb|AC095054.3| Homo sapiens BAC clone RP11-354C17 from 4, comple... 40 8.4
71gb|AC106825.2| Homo sapiens chromosome 5 clone RP11-83M24, compl... 40 8.4
72gb|AC027627.6| Homo sapiens BAC clone RP11-376O6 from 4, complet... 40 8.4
73dbj|AK145694.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 40 8.4
74emb|BX248234.13| Zebrafish DNA sequence from clone DKEY-13E15 in... 40 8.4
75gb|AC022601.6| Homo sapiens chromosome 18, clone RP11-138H11, co... 40 8.4
76gb|AC008454.6| Homo sapiens chromosome 5 clone CTC-345M13, compl... 40 8.4
77dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
78dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
79gb|AC136940.2| Homo sapiens chromosome 5 clone RP11-1252I4, comp... 40 8.4
80gb|AC106795.3| Homo sapiens chromosome 5 clone RP11-423H2, compl... 40 8.4
81dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
82gb|AC138965.2| Homo sapiens chromosome 5 clone RP11-91H12, compl... 40 8.4
83gb|AC116305.2| Dictyostelium discoideum chromosome 2 map 1005175... 40 8.4
84gb|AC037425.7|AC037425 Oryza sativa chromosome 10 BAC OSJNBa0055... 40 8.4
85gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.4
86gb|AY648195.1| Helicobacter pylori isolate S831 adhesin (babA) g... 40 8.4
87dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 8.4
88dbj|AP005187.5| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
89dbj|AK122009.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.4
90dbj|AK070517.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.4
91emb|AL935036.4| Human DNA sequence from clone RP11-257E20 on chr... 40 8.4
92gb|AF076243.1|AF076243 Arabidopsis thaliana BAC T26N6 from chrom... 40 8.4
93gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.4
94emb|AL713991.13| Mouse DNA sequence from clone RP23-132C16 on ch... 40 8.4
95gb|AC116708.19| Mus musculus chromosome 1, clone RP23-70F22, com... 40 8.4 
>dbj|AK059369.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-E11, full
           insert sequence
          Length = 1198

 Score =  379 bits (191), Expect = e-102
 Identities = 326/371 (87%)
 Strand = Plus / Minus

                                                                       
Query: 249 ctaaactctggggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccat 308
           ||||| |||||||||||||||||||||||||||||| || |||||||||||||| |||| 
Sbjct: 950 ctaaaatctggggtaccagaacatgcccttgatgccttgagggtcagcttcgaatcccaa 891

                                                                       
Query: 309 gttcttgtagaagtccaccactttactatctgcaaatagcgtgatgttgctgatgtccct 368
           |||||||||||| || || |||||  |||||||||| ||||| || ||||||||||| ||
Sbjct: 890 gttcttgtagaaatctacaactttgttatctgcaaacagcgtaatattgctgatgtctct 831

                                                                       
Query: 369 ctggagcaaagtacggatcactttctccatgagtgttttaccaagaccttgaccctgata 428
           |||||||||||| ||||| ||||||||||| |  | ||||||||||||||||||||||||
Sbjct: 830 ctggagcaaagttcggattactttctccattaacgctttaccaagaccttgaccctgata 771

                                                                       
Query: 429 ggaaggatcaacgaggacgtcccagattgtagcattgaacgcatggtctgaagttgcccg 488
            ||||| |||||||| || ||||| || |||||||| || ||||||||||||||||| ||
Sbjct: 770 tgaagggtcaacgagaacatcccaaatggtagcattaaaggcatggtctgaagttgctcg 711

                                                                       
Query: 489 cgccataccaatcagttgcttcttctcttctccctctgtttctgaagacctgattattga 548
           |||||||||||| ||||||||| ||||||||||||||| || ||||| | |  | | |||
Sbjct: 710 cgccataccaattagttgcttcctctcttctccctctgcttttgaaggcatagtaactga 651

                                                                       
Query: 549 atgtagtgtagcgaccaagtagctgtttcttaaggatgctgctattttcgttagaggtct 608
           |||||||||||| |||| ||| |||||||||||||||||||||||||| ||||| |||||
Sbjct: 650 atgtagtgtagcaaccaggtaactgtttcttaaggatgctgctattttggttaggggtct 591

                      
Query: 609 acgtggccatc 619
            ||||||||||
Sbjct: 590 gcgtggccatc 580
to top
>dbj|AK104449.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-A12, full
           insert sequence
          Length = 1122

 Score =  307 bits (155), Expect = 2e-80
 Identities = 248/279 (88%)
 Strand = Plus / Minus

                                                                       
Query: 249 ctaaactctggggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccat 308
           ||||| |||||||||||||||||||||||||||||| || |||||||||||||| |||| 
Sbjct: 960 ctaaaatctggggtaccagaacatgcccttgatgccttgagggtcagcttcgaatcccaa 901

                                                                       
Query: 309 gttcttgtagaagtccaccactttactatctgcaaatagcgtgatgttgctgatgtccct 368
           |||||||||||| || || |||||  |||||||||| ||||| || ||||||||||| ||
Sbjct: 900 gttcttgtagaaatctacaactttgttatctgcaaacagcgtaatattgctgatgtctct 841

                                                                       
Query: 369 ctggagcaaagtacggatcactttctccatgagtgttttaccaagaccttgaccctgata 428
           |||||||||||| ||||| ||||||||||| |  | ||||||||||||||||||||||||
Sbjct: 840 ctggagcaaagttcggattactttctccattaacgctttaccaagaccttgaccctgata 781

                                                                       
Query: 429 ggaaggatcaacgaggacgtcccagattgtagcattgaacgcatggtctgaagttgcccg 488
            ||||| |||||||| || ||||| || |||||||| || ||||||||||||||||| ||
Sbjct: 780 tgaagggtcaacgagaacatcccaaatggtagcattaaaggcatggtctgaagttgctcg 721

                                                  
Query: 489 cgccataccaatcagttgcttcttctcttctccctctgt 527
           |||||||||||| ||||||||| ||||||||||||||||
Sbjct: 720 cgccataccaattagttgcttcctctcttctccctctgt 682



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 68/74 (91%)
 Strand = Plus / Minus

                                                                       
Query: 546 tgaatgtagtgtagcgaccaagtagctgtttcttaaggatgctgctattttcgttagagg 605
           ||||||||||||||| |||| ||| |||||||||||||||||||||||||| ||||| ||
Sbjct: 649 tgaatgtagtgtagcaaccaggtaactgtttcttaaggatgctgctattttggttagggg 590

                         
Query: 606 tctacgtggccatc 619
           ||| ||||||||||
Sbjct: 589 tctgcgtggccatc 576
to top
>dbj|AK068619.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013157F02, full
            insert sequence
          Length = 1267

 Score =  307 bits (155), Expect = 2e-80
 Identities = 248/279 (88%)
 Strand = Plus / Minus

                                                                        
Query: 249  ctaaactctggggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccat 308
            ||||| |||||||||||||||||||||||||||||| || |||||||||||||| |||| 
Sbjct: 1007 ctaaaatctggggtaccagaacatgcccttgatgccttgagggtcagcttcgaatcccaa 948

                                                                        
Query: 309  gttcttgtagaagtccaccactttactatctgcaaatagcgtgatgttgctgatgtccct 368
            |||||||||||| || || |||||  |||||||||| ||||| || ||||||||||| ||
Sbjct: 947  gttcttgtagaaatctacaactttgttatctgcaaacagcgtaatattgctgatgtctct 888

                                                                        
Query: 369  ctggagcaaagtacggatcactttctccatgagtgttttaccaagaccttgaccctgata 428
            |||||||||||| ||||| ||||||||||| |  | ||||||||||||||||||||||||
Sbjct: 887  ctggagcaaagttcggattactttctccattaacgctttaccaagaccttgaccctgata 828

                                                                        
Query: 429  ggaaggatcaacgaggacgtcccagattgtagcattgaacgcatggtctgaagttgcccg 488
             ||||| |||||||| || ||||| || |||||||| || ||||||||||||||||| ||
Sbjct: 827  tgaagggtcaacgagaacatcccaaatggtagcattaaaggcatggtctgaagttgctcg 768

                                                   
Query: 489  cgccataccaatcagttgcttcttctcttctccctctgt 527
            |||||||||||| ||||||||| ||||||||||||||||
Sbjct: 767  cgccataccaattagttgcttcctctcttctccctctgt 729



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 68/74 (91%)
 Strand = Plus / Minus

                                                                       
Query: 546 tgaatgtagtgtagcgaccaagtagctgtttcttaaggatgctgctattttcgttagagg 605
           ||||||||||||||| |||| ||| |||||||||||||||||||||||||| ||||| ||
Sbjct: 653 tgaatgtagtgtagcaaccaggtaactgtttcttaaggatgctgctattttggttagggg 594

                         
Query: 606 tctacgtggccatc 619
           ||| ||||||||||
Sbjct: 593 tctgcgtggccatc 580
to top
>gb|BT016239.1| Zea mays clone Contig72 mRNA sequence
          Length = 1395

 Score =  230 bits (116), Expect = 4e-57
 Identities = 239/280 (85%)
 Strand = Plus / Minus

                                                                        
Query: 248  gctaaactctggggtaccagaacatgcccttgatgccctgggggtcagcttcgaacccca 307
            |||||| |||||||||||||||||||||||||||||| || || ||| ||||||||||||
Sbjct: 1045 gctaaaatctggggtaccagaacatgcccttgatgccttgaggatcaacttcgaacccca 986

                                                                        
Query: 308  tgttcttgtagaagtccaccactttactatctgcaaatagcgtgatgttgctgatgtccc 367
             |||||||||||| || |  |||||  |||| ||||| || || |||||| ||||||| |
Sbjct: 985  ggttcttgtagaaatctataactttgttatccgcaaacagtgtaatgttgttgatgtctc 926

                                                                        
Query: 368  tctggagcaaagtacggatcactttctccatgagtgttttaccaagaccttgaccctgat 427
             |||||||||||||||  |   |||||||||||||| |||||||||||| |||||||| |
Sbjct: 925  gctggagcaaagtacgatttcttttctccatgagtgctttaccaagaccctgaccctggt 866

                                                                        
Query: 428  aggaaggatcaacgaggacgtcccagattgtagcattgaacgcatggtctgaagttgccc 487
            | ||||||||||| ||||| ||||| || || |||||||| ||||||||||| ||||| |
Sbjct: 865  atgaaggatcaacaaggacatcccaaatcgttgcattgaaggcatggtctgaggttgctc 806

                                                    
Query: 488  gcgccataccaatcagttgcttcttctcttctccctctgt 527
            | ||||| ||||| || || ||||||||||||||||||||
Sbjct: 805  gtgccatcccaatgagctgtttcttctcttctccctctgt 766



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 83/96 (86%)
 Strand = Plus / Minus

                                                                       
Query: 524 ctgtttctgaagacctgattattgaatgtagtgtagcgaccaagtagctgtttcttaagg 583
           ||||||||||||| || |||||||||| ||||||||| ||||||||||| |||||||| |
Sbjct: 622 ctgtttctgaagatctaattattgaatatagtgtagcaaccaagtagctatttcttaatg 563

                                               
Query: 584 atgctgctattttcgttagaggtctacgtggccatc 619
           | |||||||| || |  ||||| || ||||||||||
Sbjct: 562 aggctgctatctttgaaagaggcctgcgtggccatc 527
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  123 bits (62), Expect = 7e-25
 Identities = 95/106 (89%)
 Strand = Plus / Minus

                                                                            
Query: 422      cctgataggaaggatcaacgaggacgtcccagattgtagcattgaacgcatggtctgaag 481
                ||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||||||
Sbjct: 23501497 cctgatatgaagggtcaacgagaacatcccaaatggtagcattaaaggcatggtctgaag 23501438

                                                              
Query: 482      ttgcccgcgccataccaatcagttgcttcttctcttctccctctgt 527
                |||| |||||||||||||| ||||||||| ||||||||||||||||
Sbjct: 23501437 ttgctcgcgccataccaattagttgcttcctctcttctccctctgt 23501392



 Score =  103 bits (52), Expect = 7e-19
 Identities = 67/72 (93%)
 Strand = Plus / Minus

                                                                            
Query: 249      ctaaactctggggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccat 308
                ||||| |||||||||||||||||||||||||||||| || |||||||||||||| |||| 
Sbjct: 23502626 ctaaaatctggggtaccagaacatgcccttgatgccttgagggtcagcttcgaatcccaa 23502567

                            
Query: 309      gttcttgtagaa 320
                ||||||||||||
Sbjct: 23502566 gttcttgtagaa 23502555



 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                            
Query: 335      tatctgcaaatagcgtgatgttgctgatgtccctctggagcaaagtacggatcactttct 394
                |||||||||| ||||| || ||||||||||| |||||||||||||| ||||| |||||||
Sbjct: 23501663 tatctgcaaacagcgtaatattgctgatgtctctctggagcaaagttcggattactttct 23501604

                                                
Query: 395      ccatgagtgttttaccaagaccttgaccctga 426
                |||| |  | ||||||||||||||||||||||
Sbjct: 23501603 ccattaacgctttaccaagaccttgaccctga 23501572



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 68/74 (91%)
 Strand = Plus / Minus

                                                                            
Query: 546      tgaatgtagtgtagcgaccaagtagctgtttcttaaggatgctgctattttcgttagagg 605
                ||||||||||||||| |||| ||| |||||||||||||||||||||||||| ||||| ||
Sbjct: 23501226 tgaatgtagtgtagcaaccaggtaactgtttcttaaggatgctgctattttggttagggg 23501167

                              
Query: 606      tctacgtggccatc 619
                ||| ||||||||||
Sbjct: 23501166 tctgcgtggccatc 23501153
to top
>gb|AC137619.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0095J22, complete sequence
          Length = 151730

 Score =  123 bits (62), Expect = 7e-25
 Identities = 95/106 (89%)
 Strand = Plus / Minus

                                                                         
Query: 422   cctgataggaaggatcaacgaggacgtcccagattgtagcattgaacgcatggtctgaag 481
             ||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||||||
Sbjct: 37221 cctgatatgaagggtcaacgagaacatcccaaatggtagcattaaaggcatggtctgaag 37162

                                                           
Query: 482   ttgcccgcgccataccaatcagttgcttcttctcttctccctctgt 527
             |||| |||||||||||||| ||||||||| ||||||||||||||||
Sbjct: 37161 ttgctcgcgccataccaattagttgcttcctctcttctccctctgt 37116



 Score =  103 bits (52), Expect = 7e-19
 Identities = 67/72 (93%)
 Strand = Plus / Minus

                                                                         
Query: 249   ctaaactctggggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccat 308
             ||||| |||||||||||||||||||||||||||||| || |||||||||||||| |||| 
Sbjct: 38350 ctaaaatctggggtaccagaacatgcccttgatgccttgagggtcagcttcgaatcccaa 38291

                         
Query: 309   gttcttgtagaa 320
             ||||||||||||
Sbjct: 38290 gttcttgtagaa 38279



 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                         
Query: 335   tatctgcaaatagcgtgatgttgctgatgtccctctggagcaaagtacggatcactttct 394
             |||||||||| ||||| || ||||||||||| |||||||||||||| ||||| |||||||
Sbjct: 37387 tatctgcaaacagcgtaatattgctgatgtctctctggagcaaagttcggattactttct 37328

                                             
Query: 395   ccatgagtgttttaccaagaccttgaccctga 426
             |||| |  | ||||||||||||||||||||||
Sbjct: 37327 ccattaacgctttaccaagaccttgaccctga 37296



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 68/74 (91%)
 Strand = Plus / Minus

                                                                         
Query: 546   tgaatgtagtgtagcgaccaagtagctgtttcttaaggatgctgctattttcgttagagg 605
             ||||||||||||||| |||| ||| |||||||||||||||||||||||||| ||||| ||
Sbjct: 36950 tgaatgtagtgtagcaaccaggtaactgtttcttaaggatgctgctattttggttagggg 36891

                           
Query: 606   tctacgtggccatc 619
             ||| ||||||||||
Sbjct: 36890 tctgcgtggccatc 36877
to top
>gb|AY105893.1| Zea mays PCO126260 mRNA sequence
          Length = 841

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 83/96 (86%)
 Strand = Plus / Minus

                                                                       
Query: 524 ctgtttctgaagacctgattattgaatgtagtgtagcgaccaagtagctgtttcttaagg 583
           ||||||||||||| || |||||||||| ||||||||| ||||||||||| |||||||| |
Sbjct: 659 ctgtttctgaagatctaattattgaatatagtgtagcaaccaagtagctatttcttaatg 600

                                               
Query: 584 atgctgctattttcgttagaggtctacgtggccatc 619
           | |||||||| || |  ||||| || ||||||||||
Sbjct: 599 aggctgctatctttgaaagaggcctgcgtggccatc 564



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ttcttctcttctccctctgt 527
           ||||||||||||||||||||
Sbjct: 822 ttcttctcttctccctctgt 803
to top
>ref|NM_102941.1| Arabidopsis thaliana N-acetyltransferase AT1G32070 transcript
           variant AT1G32070.1 mRNA, complete cds
          Length = 916

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccatgttcttgtag 318
           |||||||| |||||||| |||||||| |  || ||||| || ||||||| |||||  |||
Sbjct: 783 gggtaccaaaacatgcctttgatgccttctggatcagcctcaaaccccaagttctgatag 724

                                     
Query: 319 aagtccaccactttactatctgcaaa 344
           || ||||| |||| ||||||||||||
Sbjct: 723 aaatccacaacttgactatctgcaaa 698



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 405 tttaccaagaccttgaccctgataggaaggatcaacgaggacgtcccagattgtagcatt 464
           |||||| || ||||||||||||||   ||||||||| || || ||||| |||||||||||
Sbjct: 637 tttacctagcccttgaccctgatattcaggatcaacaagaacatcccaaattgtagcatt 578

                                               
Query: 465 gaacgcatggtctgaagttgcccgcgccataccaat 500
            || ||||| || || || || || |||||||||||
Sbjct: 577 aaaggcatgatccgacgtcgcacgtgccataccaat 542
to top
>ref|NM_202221.1| Arabidopsis thaliana N-acetyltransferase AT1G32070 transcript
           variant AT1G32070.2 mRNA, complete cds
          Length = 993

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccatgttcttgtag 318
           |||||||| |||||||| |||||||| |  || ||||| || ||||||| |||||  |||
Sbjct: 819 gggtaccaaaacatgcctttgatgccttctggatcagcctcaaaccccaagttctgatag 760

                                     
Query: 319 aagtccaccactttactatctgcaaa 344
           || ||||| |||| ||||||||||||
Sbjct: 759 aaatccacaacttgactatctgcaaa 734



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 405 tttaccaagaccttgaccctgataggaaggatcaacgaggacgtcccagattgtagcatt 464
           |||||| || ||||||||||||||   ||||||||| || || ||||| |||||||||||
Sbjct: 673 tttacctagcccttgaccctgatattcaggatcaacaagaacatcccaaattgtagcatt 614

                                               
Query: 465 gaacgcatggtctgaagttgcccgcgccataccaat 500
            || ||||| || || || || || |||||||||||
Sbjct: 613 aaaggcatgatccgacgtcgcacgtgccataccaat 578
to top
>gb|AY281105.1| Arabidopsis thaliana nuclear shuttle interacting protein (NSI)
           mRNA, complete cds
          Length = 947

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccatgttcttgtag 318
           |||||||| |||||||| |||||||| |  || ||||| || ||||||| |||||  |||
Sbjct: 819 gggtaccaaaacatgcctttgatgccttctggatcagcctcaaaccccaagttctgatag 760

                                     
Query: 319 aagtccaccactttactatctgcaaa 344
           || ||||| |||| ||||||||||||
Sbjct: 759 aaatccacaacttgactatctgcaaa 734



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 405 tttaccaagaccttgaccctgataggaaggatcaacgaggacgtcccagattgtagcatt 464
           |||||| || ||||||||||||||   ||||||||| || || ||||| |||||||||||
Sbjct: 673 tttacctagcccttgaccctgatattcaggatcaacaagaacatcccaaattgtagcatt 614

                                               
Query: 465 gaacgcatggtctgaagttgcccgcgccataccaat 500
            || ||||| || || || || || |||||||||||
Sbjct: 613 aaaggcatgatccgacgtcgcacgtgccataccaat 578
to top
>gb|BT024481.1| Arabidopsis thaliana At1g32070 mRNA, complete cds
          Length = 774

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccatgttcttgtag 318
           |||||||| |||||||| |||||||| |  || ||||| || ||||||| |||||  |||
Sbjct: 767 gggtaccaaaacatgcctttgatgccttctggatcagcctcaaaccccaagttctgatag 708

                                     
Query: 319 aagtccaccactttactatctgcaaa 344
           || ||||| |||| ||||||||||||
Sbjct: 707 aaatccacaacttgactatctgcaaa 682



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 405 tttaccaagaccttgaccctgataggaaggatcaacgaggacgtcccagattgtagcatt 464
           |||||| || ||||||||||||||   ||||||||| || || ||||| |||||||||||
Sbjct: 621 tttacctagcccttgaccctgatattcaggatcaacaagaacatcccaaattgtagcatt 562

                                               
Query: 465 gaacgcatggtctgaagttgcccgcgccataccaat 500
            || ||||| || || || || || |||||||||||
Sbjct: 561 aaaggcatgatccgacgtcgcacgtgccataccaat 526
to top
>emb|BX817946.1|CNS0AEC8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL52ZE01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccatgttcttgtag 318
           |||||||| |||||||| |||||||| |  || ||||| || ||||||| |||||  |||
Sbjct: 795 gggtaccaaaacatgcctttgatgccttctggatcagcctcaaaccccaagttctgatag 736

                                     
Query: 319 aagtccaccactttactatctgcaaa 344
           || ||||| |||| ||||||||||||
Sbjct: 735 aaatccacaacttgactatctgcaaa 710



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 405 tttaccaagaccttgaccctgataggaaggatcaacgaggacgtcccagattgtagcatt 464
           |||||| || ||||||||||||||   ||||||||| || || ||||| |||||||||||
Sbjct: 649 tttacctagcccttgaccctgatattcaggatcaacaagaacatcccaaattgtagcatt 590

                                               
Query: 465 gaacgcatggtctgaagttgcccgcgccataccaat 500
            || ||||| || || || || || |||||||||||
Sbjct: 589 aaaggcatgatccgacgtcgcacgtgccataccaat 554
to top
>emb|BX813875.1|CNS0AEHT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB44ZH06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 931

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccatgttcttgtag 318
           |||||||| |||||||| |||||||| |  || ||||| || ||||||| |||||  |||
Sbjct: 757 gggtaccaaaacatgcctttgatgccttctggatcagcctcaaaccccaagttctgatag 698

                                     
Query: 319 aagtccaccactttactatctgcaaa 344
           || ||||| |||| ||||||||||||
Sbjct: 697 aaatccacaacttgactatctgcaaa 672



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 405 tttaccaagaccttgaccctgataggaaggatcaacgaggacgtcccagattgtagcatt 464
           |||||| || ||||||||||||||   ||||||||| || || ||||| |||||||||||
Sbjct: 611 tttacctagcccttgaccctgatattcaggatcaacaagaacatcccaaattgtagcatt 552

                                               
Query: 465 gaacgcatggtctgaagttgcccgcgccataccaat 500
            || ||||| || || || || || |||||||||||
Sbjct: 551 aaaggcatgatccgacgtcgcacgtgccataccaat 516
to top
>emb|BX818104.1|CNS0ACHM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL61ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 942

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccatgttcttgtag 318
           |||||||| |||||||| |||||||| |  || ||||| || ||||||| |||||  |||
Sbjct: 766 gggtaccaaaacatgcctttgatgccttctggatcagcctcaaaccccaagttctgatag 707

                                     
Query: 319 aagtccaccactttactatctgcaaa 344
           || ||||| |||| ||||||||||||
Sbjct: 706 aaatccacaacttgactatctgcaaa 681



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 405 tttaccaagaccttgaccctgataggaaggatcaacgaggacgtcccagattgtagcatt 464
           |||||| || ||||||||||||||   ||||||||| || || ||||| |||||||||||
Sbjct: 620 tttacctagcccttgaccctgatattcaggatcaacaagaacatcccaaattgtagcatt 561

                                               
Query: 465 gaacgcatggtctgaagttgcccgcgccataccaat 500
            || ||||| || || || || || |||||||||||
Sbjct: 560 aaaggcatgatccgacgtcgcacgtgccataccaat 525
to top
>gb|AY086183.1| Arabidopsis thaliana clone 22071 mRNA, complete sequence
          Length = 916

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gggtaccagaacatgcccttgatgccctgggggtcagcttcgaaccccatgttcttgtag 318
           |||||||| |||||||| |||||||| |  || ||||| || ||||||| |||||  |||
Sbjct: 783 gggtaccaaaacatgcctttgatgccttctggatcagcctcaaaccccaagttctgatag 724

                                     
Query: 319 aagtccaccactttactatctgcaaa 344
           || ||||| |||| ||||||||||||
Sbjct: 723 aaatccacaacttgactatctgcaaa 698



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 405 tttaccaagaccttgaccctgataggaaggatcaacgaggacgtcccagattgtagcatt 464
           |||||| || ||||||||||||||   ||||||||| || || ||||| |||||||||||
Sbjct: 637 tttacctagcccttgaccctgatattcaggatcaacaagaacatcccaaattgtagcatt 578

                                               
Query: 465 gaacgcatggtctgaagttgcccgcgccataccaat 500
            || ||||| || || || || || |||||||||||
Sbjct: 577 aaaggcatgatccgacgtcgcacgtgccataccaat 542
to top
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                               
Query: 262     taccagaacatgcccttgatgccctgggggtc 293
               ||||||||||||||||||||||||| ||||||
Sbjct: 2513377 taccagaacatgcccttgatgccctcggggtc 2513408
to top
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 256    ctggggtaccagaacatgcccttgatgccctgggggtc 293
              ||||| ||||| ||||||||||||||||||| ||||||
Sbjct: 855272 ctgggataccaaaacatgcccttgatgccctcggggtc 855235
to top
>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 256    ctggggtaccagaacatgcccttgatgccctgggggtc 293
              ||||| ||||| ||||||||||||||||||| ||||||
Sbjct: 765596 ctgggataccaaaacatgcccttgatgccctcggggtc 765633
to top
>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 258     ggggtaccagaacatgcccttgatgccct 286
               |||||||||||||||||||||||| ||||
Sbjct: 2191267 ggggtaccagaacatgcccttgatcccct 2191239
to top
>gb|AC158556.9| Mus musculus chromosome 15, clone RP23-140F20, complete sequence
          Length = 203053

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 508    ttcttctcttctccctctgtttc 530
              |||||||||||||||||||||||
Sbjct: 173710 ttcttctcttctccctctgtttc 173688
to top
>emb|AL050309.4|HSJ148M19 Human DNA sequence from clone RP1-148M19 on chromosome Xp11.22-11.3
             Contains the 5' end of the KLF8 gene for Kruppel-like
             factor 8 and a ribosomal protein L23a (RPL23A) pseudogene,
             complete sequence
          Length = 177483

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 500   tcagttgcttcttctcttctccc 522
             |||||||||||||||||||||||
Sbjct: 60683 tcagttgcttcttctcttctccc 60661
to top
>gb|AC121589.3| Mus musculus BAC clone RP23-281G14 from chromosome 3, complete sequence
          Length = 215395

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 509    tcttctcttctccctctgtttc 530
              ||||||||||||||||||||||
Sbjct: 102199 tcttctcttctccctctgtttc 102178
to top
>emb|AL445430.15| Human DNA sequence from clone RP11-716O23 on chromosome 6 Contains one
             or two novel genes, a repressor of protein-kinase
             (interferon-inducible double stranded RNA dependent
             inhibitor) (P58 repressor) (PRKRIR) pseudogene and a CpG
             island, complete sequence
          Length = 127862

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 396   catgagtgttttaccaagacct 417
             ||||||||||||||||||||||
Sbjct: 94165 catgagtgttttaccaagacct 94186
to top
>gb|BC051414.1| Mus musculus U1 small nuclear ribonucleoprotein polypeptide A, mRNA
           (cDNA clone IMAGE:6493532), partial cds
          Length = 2866

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 512 tctcttctccctctgtttctga 533
           ||||||||||||||||||||||
Sbjct: 574 tctcttctccctctgtttctga 595
to top
>gb|BC043938.1| Mus musculus U1 small nuclear ribonucleoprotein polypeptide A, mRNA
           (cDNA clone IMAGE:4503753)
          Length = 2953

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 512 tctcttctccctctgtttctga 533
           ||||||||||||||||||||||
Sbjct: 575 tctcttctccctctgtttctga 596
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 491     ccataccaatcagttgcttctt 512
               ||||||||||||||||||||||
Sbjct: 1191766 ccataccaatcagttgcttctt 1191745
to top
>emb|AM180252.1| Lawsonia intracellularis PHE/MN1-00
          Length = 1457619

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 166    ctgttatacaaagctcagctcctggc 191
              ||||||||||||| ||||||||||||
Sbjct: 356762 ctgttatacaaagttcagctcctggc 356787
to top
>gb|AC151602.4| Mus musculus BAC clone RP23-218K15 from chromosome 7, complete sequence
          Length = 249504

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 512    tctcttctccctctgtttctga 533
              ||||||||||||||||||||||
Sbjct: 206764 tctcttctccctctgtttctga 206785
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 491     ccataccaatcagttgcttctt 512
               ||||||||||||||||||||||
Sbjct: 1191766 ccataccaatcagttgcttctt 1191745
to top
>emb|BX000509.2|CNS08CDZ Oryza sativa chromosome 12, . BAC OJ1085_G07 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 121556

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 491    ccataccaatcagttgcttctt 512
              ||||||||||||||||||||||
Sbjct: 101016 ccataccaatcagttgcttctt 101037
to top
>gb|AC125670.4| Rattus norvegicus  BAC CH230-113E22 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 103836

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 507    cttcttctcttctccctctgtttct 531
              ||||||||||||||||||| |||||
Sbjct: 100480 cttcttctcttctccctctctttct 100456
to top
>emb|AL158053.14| Human DNA sequence from clone RP11-156J23 on chromosome Xq21.2-21.33
             Contains a discs, large homolog 7 (Drosophila) (DLG7)
             pseudogene, complete sequence
          Length = 177722

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 500   tcagttgcttcttctcttctc 520
             |||||||||||||||||||||
Sbjct: 12204 tcagttgcttcttctcttctc 12184
to top
>gb|AC018525.8| Homo sapiens chromosome 8, clone RP11-3J13, complete sequence
          Length = 150052

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 508   ttcttctcttctccctctgtt 528
             |||||||||||||||||||||
Sbjct: 81891 ttcttctcttctccctctgtt 81911
to top
>gb|AC103853.2| Homo sapiens chromosome 8, clone RP11-642D21, complete sequence
          Length = 178736

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 508    ttcttctcttctccctctgtt 528
              |||||||||||||||||||||
Sbjct: 165457 ttcttctcttctccctctgtt 165437
to top
>gb|AC074309.4|AC074309 Arabidopsis thaliana chromosome 1 BAC T12O21 genomic sequence,
            complete sequence
          Length = 75298

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 57/69 (82%)
 Strand = Plus / Minus

                                                                        
Query: 432  aggatcaacgaggacgtcccagattgtagcattgaacgcatggtctgaagttgcccgcgc 491
            ||||||||| || || ||||| ||||||||||| || ||||| || || || || || ||
Sbjct: 5622 aggatcaacaagaacatcccaaattgtagcattaaaggcatgatccgacgtcgcacgtgc 5563

                     
Query: 492  cataccaat 500
            |||||||||
Sbjct: 5562 cataccaat 5554
to top
>gb|AC018891.9| Homo sapiens BAC clone RP11-498M11 from 2, complete sequence
          Length = 174074

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 83     ctactactactagtagcagtt 103
              |||||||||||||||||||||
Sbjct: 154346 ctactactactagtagcagtt 154326
to top
>gb|AC010533.6|AC010533 Homo sapiens chromosome 16 clone RP11-229O3, complete sequence
          Length = 153588

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 74    tttacttttctactactacta 94
             |||||||||||||||||||||
Sbjct: 12574 tttacttttctactactacta 12554
to top
>gb|AC084464.1|AC084464 Caenorhabditis briggsae cosmid CB038P16, complete sequence
          Length = 99890

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 496   ccaatcagttgcttcttctct 516
             |||||||||||||||||||||
Sbjct: 99707 ccaatcagttgcttcttctct 99727
to top
>gb|AC084423.1|AC084423 Caenorhabditis briggsae cosmid CB020D11, complete sequence
          Length = 85565

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 496 ccaatcagttgcttcttctct 516
           |||||||||||||||||||||
Sbjct: 17  ccaatcagttgcttcttctct 37
to top
>gb|AC010140.3|AC010140 Homo sapiens BAC clone RP11-218E11 from Y, complete sequence
          Length = 148342

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 500   tcagttgcttcttctcttctc 520
             |||||||||||||||||||||
Sbjct: 31743 tcagttgcttcttctcttctc 31723
to top
>gb|AF191069.1|AF191069 Homo sapiens chromosome 21 clone P704-682K20 map 21q22.1, complete
              sequence
          Length = 108965

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 500    tcagttgcttcttctcttctc 520
              |||||||||||||||||||||
Sbjct: 102280 tcagttgcttcttctcttctc 102300
to top
>gb|AF096876.1|AF096876 Homo sapiens chromosome 21q22.1 PAC K09209, complete sequence
          Length = 109864

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 500   tcagttgcttcttctcttctc 520
             |||||||||||||||||||||
Sbjct: 80405 tcagttgcttcttctcttctc 80425
to top
>dbj|BS000177.1| Pan troglodytes chromosome 22 clone:PTB-118H03, map 22, complete
              sequences
          Length = 267172

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 500    tcagttgcttcttctcttctc 520
              |||||||||||||||||||||
Sbjct: 171739 tcagttgcttcttctcttctc 171759
to top
>gb|AY739307.1| Oryza sativa (japonica cultivar-group) adenosine 5'-phosphosulfate
           reductase-like (APRL4) mRNA, complete cds
          Length = 1166

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 504 ttgcttcttctcttctccctctgtttctg 532
           ||||||||||||| || ||||||||||||
Sbjct: 868 ttgcttcttctctacttcctctgtttctg 840
to top
>gb|AC154870.4| Monodelphis domestica, clone XX-218A9, complete sequence
          Length = 133508

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 76    tacttttctactactactagtagcagtta 104
             |||||| |||||||||||| |||||||||
Sbjct: 69017 tactttactactactactactagcagtta 68989
to top
>dbj|AP001707.1| Homo sapiens genomic DNA, chromosome 21q, section 51/105
          Length = 340000

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 500    tcagttgcttcttctcttctc 520
              |||||||||||||||||||||
Sbjct: 128873 tcagttgcttcttctcttctc 128893
to top
>dbj|AP005354.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1159C3, complete
             sequence
          Length = 133276

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 508   ttcttctcttctccctctgtt 528
             |||||||||||||||||||||
Sbjct: 34148 ttcttctcttctccctctgtt 34168
to top
>gb|AC131083.8| Mus musculus chromosome 1, clone RP23-444L13, complete sequence
          Length = 182591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 504   ttgcttcttctcttctccct 523
             ||||||||||||||||||||
Sbjct: 40913 ttgcttcttctcttctccct 40894
to top
>ref|XM_638641.1| Dictyostelium discoideum putative Nek family protein kinase
            (DDB0220003), partial mRNA
          Length = 3372

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 83   ctactactactagtagcagt 102
            ||||||||||||||||||||
Sbjct: 1133 ctactactactagtagcagt 1152
to top
>gb|AF074021.1| Arabidopsis thaliana BAC F4H6, chromosome IV, complete sequence
          Length = 103632

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 503   gttgcttcttctcttctccc 522
             ||||||||||||||||||||
Sbjct: 18406 gttgcttcttctcttctccc 18387
to top
>ref|XM_960812.1| Encephalitozoon cuniculi GB-M1 eukaryotic translation initiation
            factor 2 (ECU01_0700) partial mRNA
          Length = 1320

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 424  tgataggaaggatcaacgag 443
            ||||||||||||||||||||
Sbjct: 1121 tgataggaaggatcaacgag 1140
to top
>gb|AF391985.1| Uncultured thermal soil bacterium clone YNPFFP2 16S ribosomal RNA
            gene, partial sequence
          Length = 1440

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 270  catgcccttgatgccctggg 289
            ||||||||||||||||||||
Sbjct: 1169 catgcccttgatgccctggg 1188
to top
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 270     catgcccttgatgccctggg 289
               ||||||||||||||||||||
Sbjct: 2922928 catgcccttgatgccctggg 2922909
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 83      ctactactactagtagcagt 102
               ||||||||||||||||||||
Sbjct: 1104968 ctactactactagtagcagt 1104949
to top
>gb|AC104866.10| Mus musculus chromosome 17, clone RP23-268C14, complete sequence
          Length = 176240

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 73     ctttacttttctactactactagt 96
              |||| |||||||||||||||||||
Sbjct: 103008 cttttcttttctactactactagt 102985
to top
>emb|AL732366.7| Human DNA sequence from clone RP11-393H10 on chromosome X Contains a
             novel gene (FLJ14503), the EIF1A gene for eukaryotic
             translation initiation factor 1A (EIF4C, EIF1AX, eIF-1A,
             eIF-4C), the 3' end of the RPS6KA3 gene for ribosomal
             protein S6 kinase, 90kDa, polypeptide 3 (RSK, HU-2, HU-3,
             RSK2, MRX19, ISPK-1, MAPKAPK1B), a novel gene and three
             CpG islands, complete sequence
          Length = 187275

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 296   cttcgaaccccatgttcttg 315
             ||||||||||||||||||||
Sbjct: 28634 cttcgaaccccatgttcttg 28653
to top
>emb|AL928688.3| Human DNA sequence from clone RP11-77N10 on chromosome 10, complete
              sequence
          Length = 165910

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 507    cttcttctcttctccctctg 526
              ||||||||||||||||||||
Sbjct: 157069 cttcttctcttctccctctg 157050
to top
>emb|AL603844.7| Human DNA sequence from clone RP11-541I21 on chromosome 1, complete
             sequence
          Length = 220185

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 501   cagttgcttcttctcttctc 520
             ||||||||||||||||||||
Sbjct: 20763 cagttgcttcttctcttctc 20744
to top
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 270     catgcccttgatgccctggg 289
               ||||||||||||||||||||
Sbjct: 4479881 catgcccttgatgccctggg 4479862
to top
>gb|AC101786.7| Mus musculus chromosome 1, clone RP24-146K19, complete sequence
          Length = 116889

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 504    ttgcttcttctcttctccct 523
              ||||||||||||||||||||
Sbjct: 100611 ttgcttcttctcttctccct 100592
to top
>emb|BX572606.1| Rhodopseudomonas palustris CGA009 complete genome; segment 14/16
          Length = 349841

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 270    catgcccttgatgccctggg 289
              ||||||||||||||||||||
Sbjct: 283178 catgcccttgatgccctggg 283159
to top
>emb|AL391737.2|CNS06C8G chromosome I of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 209982

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 424   tgataggaaggatcaacgag 443
             ||||||||||||||||||||
Sbjct: 87583 tgataggaaggatcaacgag 87602
to top
>emb|AL161500.2|ATCHRIV12 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 12
          Length = 199759

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 503    gttgcttcttctcttctccc 522
              ||||||||||||||||||||
Sbjct: 179835 gttgcttcttctcttctccc 179816
to top
>emb|AJ248283.1|CNSPAX01 Pyrococcus abyssi complete genome; segment 1/6
          Length = 307150

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 184    ctcctggcaatattcttctg 203
              ||||||||||||||||||||
Sbjct: 272729 ctcctggcaatattcttctg 272710
to top
>emb|AJ006823.1|ECU6823 Encephalitozoon cuniculi ef2 gene
          Length = 1320

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 424  tgataggaaggatcaacgag 443
            ||||||||||||||||||||
Sbjct: 1121 tgataggaaggatcaacgag 1140
to top
>gb|AC006484.2| Homo sapiens chromosome 5, clone hRPK.448_K_10, complete sequence
          Length = 156814

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 507    cttcttctcttctccctctg 526
              ||||||||||||||||||||
Sbjct: 150342 cttcttctcttctccctctg 150361
to top
>emb|CR533571.9| Zebrafish DNA sequence from clone CH211-209O12 in linkage group 16,
             complete sequence
          Length = 218847

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 83    ctactactactagtagcagt 102
             ||||||||||||||||||||
Sbjct: 28047 ctactactactagtagcagt 28066
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 270     catgcccttgatgccctggg 289
               ||||||||||||||||||||
Sbjct: 4532676 catgcccttgatgccctggg 4532657
to top
>gb|AC105363.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1705B08,
            complete sequence
          Length = 100986

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 83   ctactactactagtagcagt 102
            ||||||||||||||||||||
Sbjct: 8672 ctactactactagtagcagt 8653
to top
>gb|AC095054.3| Homo sapiens BAC clone RP11-354C17 from 4, complete sequence
          Length = 52664

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 503   gttgcttcttctcttctccc 522
             ||||||||||||||||||||
Sbjct: 35848 gttgcttcttctcttctccc 35829
to top
>gb|AC106825.2| Homo sapiens chromosome 5 clone RP11-83M24, complete sequence
          Length = 99304

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 500   tcagttgcttcttctcttctccct 523
             |||| |||||||||||||||||||
Sbjct: 26825 tcagctgcttcttctcttctccct 26802
to top
>gb|AC027627.6| Homo sapiens BAC clone RP11-376O6 from 4, complete sequence
          Length = 191665

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 501   cagttgcttcttctcttctc 520
             ||||||||||||||||||||
Sbjct: 25761 cagttgcttcttctcttctc 25742
to top
>dbj|AK145694.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
            library, clone:I1C0030J08 product:unclassifiable, full
            insert sequence
          Length = 1266

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 505  tgcttcttctcttctccctc 524
            ||||||||||||||||||||
Sbjct: 1066 tgcttcttctcttctccctc 1085
to top
>emb|BX248234.13| Zebrafish DNA sequence from clone DKEY-13E15 in linkage group 16,
             complete sequence
          Length = 220538

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    ctactactactagtagcagt 102
             ||||||||||||||||||||
Sbjct: 51461 ctactactactagtagcagt 51442
to top
>gb|AC022601.6| Homo sapiens chromosome 18, clone RP11-138H11, complete sequence
          Length = 158885

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ttcttctcttctccctctgt 527
              ||||||||||||||||||||
Sbjct: 117650 ttcttctcttctccctctgt 117631
to top
>gb|AC008454.6| Homo sapiens chromosome 5 clone CTC-345M13, complete sequence
          Length = 135513

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 500    tcagttgcttcttctcttctccct 523
              |||| |||||||||||||||||||
Sbjct: 111300 tcagctgcttcttctcttctccct 111277
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 83       ctactactactagtagcagt 102
                ||||||||||||||||||||
Sbjct: 17372696 ctactactactagtagcagt 17372715
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 504    ttgcttcttctcttctccct 523
              ||||||||||||||||||||
Sbjct: 190461 ttgcttcttctcttctccct 190480
to top
>gb|AC136940.2| Homo sapiens chromosome 5 clone RP11-1252I4, complete sequence
          Length = 184055

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 500    tcagttgcttcttctcttctccct 523
              |||| |||||||||||||||||||
Sbjct: 129691 tcagctgcttcttctcttctccct 129714
to top
>gb|AC106795.3| Homo sapiens chromosome 5 clone RP11-423H2, complete sequence
          Length = 177116

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 500   tcagttgcttcttctcttctccct 523
             |||| |||||||||||||||||||
Sbjct: 69661 tcagctgcttcttctcttctccct 69684
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 83      ctactactactagtagcagt 102
               ||||||||||||||||||||
Sbjct: 1104966 ctactactactagtagcagt 1104947
to top
>gb|AC138965.2| Homo sapiens chromosome 5 clone RP11-91H12, complete sequence
          Length = 170380

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 500    tcagttgcttcttctcttctccct 523
              |||| |||||||||||||||||||
Sbjct: 127352 tcagctgcttcttctcttctccct 127375
to top
>gb|AC116305.2| Dictyostelium discoideum chromosome 2 map 1005175-1418323 strain AX4,
              complete sequence
          Length = 413138

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 83     ctactactactagtagcagt 102
              ||||||||||||||||||||
Sbjct: 363095 ctactactactagtagcagt 363114
to top
>gb|AC037425.7|AC037425 Oryza sativa chromosome 10 BAC OSJNBa0055P24 genomic sequence,
            complete sequence
          Length = 134058

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 83   ctactactactagtagcagt 102
            ||||||||||||||||||||
Sbjct: 1691 ctactactactagtagcagt 1710
to top
>gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1263H11,
              complete sequence
          Length = 126827

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 83     ctactactactagtagcagt 102
              ||||||||||||||||||||
Sbjct: 125183 ctactactactagtagcagt 125164
to top
>gb|AY648195.1| Helicobacter pylori isolate S831 adhesin (babA) gene, partial cds
          Length = 771

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  ctactactactagtagcagt 102
           ||||||||||||||||||||
Sbjct: 467 ctactactactagtagcagt 448
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 270     catgcccttgatgccctggg 289
               ||||||||||||||||||||
Sbjct: 1426761 catgcccttgatgccctggg 1426780
to top
>dbj|AP005187.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0446F04
          Length = 175390

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 504   ttgcttcttctcttctccct 523
             ||||||||||||||||||||
Sbjct: 25325 ttgcttcttctcttctccct 25344
to top
>dbj|AK122009.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033111F13, full
           insert sequence
          Length = 3648

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 504 ttgcttcttctcttctccct 523
           ||||||||||||||||||||
Sbjct: 410 ttgcttcttctcttctccct 429
to top
>dbj|AK070517.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023056A13, full
           insert sequence
          Length = 1131

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  ctactactactagtagcagt 102
           ||||||||||||||||||||
Sbjct: 830 ctactactactagtagcagt 849
to top
>emb|AL935036.4| Human DNA sequence from clone RP11-257E20 on chromosome 10, complete
             sequence
          Length = 166004

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 507   cttcttctcttctccctctg 526
             ||||||||||||||||||||
Sbjct: 87506 cttcttctcttctccctctg 87487
to top
>gb|AF076243.1|AF076243 Arabidopsis thaliana BAC T26N6 from chromosome IV at 19.3 cM, complete
             sequence
          Length = 99384

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 503   gttgcttcttctcttctccc 522
             ||||||||||||||||||||
Sbjct: 79489 gttgcttcttctcttctccc 79470
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 83       ctactactactagtagcagt 102
                ||||||||||||||||||||
Sbjct: 17381736 ctactactactagtagcagt 17381755
to top
>emb|AL713991.13| Mouse DNA sequence from clone RP23-132C16 on chromosome 1, complete
              sequence
          Length = 210040

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 509    tcttctcttctccctctgtt 528
              ||||||||||||||||||||
Sbjct: 167642 tcttctcttctccctctgtt 167661
to top
>gb|AC116708.19| Mus musculus chromosome 1, clone RP23-70F22, complete sequence
          Length = 214263

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 505   tgcttcttctcttctccctc 524
             ||||||||||||||||||||
Sbjct: 29467 tgcttcttctcttctccctc 29448


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,113,743
Number of Sequences: 3902068
Number of extensions: 5113743
Number of successful extensions: 96161
Number of sequences better than 10.0: 95
Number of HSP's better than 10.0 without gapping: 95
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95437
Number of HSP's gapped (non-prelim): 722
length of query: 619
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 596
effective length of database: 17,143,297,704
effective search space: 10217405431584
effective search space used: 10217405431584
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top