ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal20m07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_475153.1| Oryza sativa (japonica cultivar-group), predic... 50 0.003
2gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.003
3gb|AC108874.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.003
4dbj|AB110178.1| Oryza sativa (japonica cultivar-group) mRNA for ... 50 0.003
5dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.003
6dbj|AK058906.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.003
7gb|AY231744.1| Drosophila yakuba clone yak-em_Nacalpha mRNA sequ... 46 0.043
8gb|AY522625.1| Oreochromis mossambicus nascent polypeptide-assoc... 44 0.17
9emb|CR712159.2|CNS0GCGB Tetraodon nigroviridis full-length cDNA 44 0.17
10emb|CR722249.2|CNS0GK8F Tetraodon nigroviridis full-length cDNA 44 0.17
11emb|CR722169.2|CNS0GK67 Tetraodon nigroviridis full-length cDNA 44 0.17
12emb|CR717966.2|CNS0GGXG Tetraodon nigroviridis full-length cDNA 44 0.17
13emb|CR717497.2|CNS0GGKF Tetraodon nigroviridis full-length cDNA 44 0.17
14emb|CR716901.2|CNS0GG3Y Tetraodon nigroviridis full-length cDNA 44 0.17
15emb|CR716022.2|CNS0GFFM Tetraodon nigroviridis full-length cDNA 44 0.17
16emb|CR715618.2|CNS0GF4E Tetraodon nigroviridis full-length cDNA 44 0.17
17emb|CR715460.2|CNS0GF00 Tetraodon nigroviridis full-length cDNA 44 0.17
18emb|CR714862.2|CNS0GEJE Tetraodon nigroviridis full-length cDNA 44 0.17
19emb|CR714224.2|CNS0GE1O Tetraodon nigroviridis full-length cDNA 44 0.17
20emb|CR712921.2|CNS0GD1H Tetraodon nigroviridis full-length cDNA 44 0.17
21emb|CR712868.2|CNS0GD00 Tetraodon nigroviridis full-length cDNA 44 0.17
22emb|CR710910.2|CNS0GBHM Tetraodon nigroviridis full-length cDNA 44 0.17
23emb|CR710585.2|CNS0GB8L Tetraodon nigroviridis full-length cDNA 44 0.17
24emb|CR709573.2|CNS0GAGH Tetraodon nigroviridis full-length cDNA 44 0.17
25emb|CR706444.2|CNS0G81K Tetraodon nigroviridis full-length cDNA 44 0.17
26emb|CR704473.2|CNS0G6IT Tetraodon nigroviridis full-length cDNA 44 0.17
27emb|CR702894.2|CNS0G5AY Tetraodon nigroviridis full-length cDNA 44 0.17
28emb|CR702653.2|CNS0G549 Tetraodon nigroviridis full-length cDNA 44 0.17
29emb|CR702124.2|CNS0G4PK Tetraodon nigroviridis full-length cDNA 44 0.17
30emb|CR701979.2|CNS0G4LJ Tetraodon nigroviridis full-length cDNA 44 0.17
31emb|CR701629.2|CNS0G4BT Tetraodon nigroviridis full-length cDNA 44 0.17
32emb|CR699096.2|CNS0G2DG Tetraodon nigroviridis full-length cDNA 44 0.17
33emb|CR698619.2|CNS0G207 Tetraodon nigroviridis full-length cDNA 44 0.17
34emb|CR698352.2|CNS0G1SS Tetraodon nigroviridis full-length cDNA 44 0.17
35emb|CR697288.2|CNS0G0Z8 Tetraodon nigroviridis full-length cDNA 44 0.17
36emb|CR696825.2|CNS0G0MD Tetraodon nigroviridis full-length cDNA 44 0.17
37emb|CR696554.2|CNS0G0EU Tetraodon nigroviridis full-length cDNA 44 0.17
38emb|CR696276.2|CNS0G074 Tetraodon nigroviridis full-length cDNA 44 0.17
39emb|CR695626.2|CNS0FZP2 Tetraodon nigroviridis full-length cDNA 44 0.17
40emb|CR695732.2|CNS0FZS0 Tetraodon nigroviridis full-length cDNA 44 0.17
41emb|CR694436.2|CNS0FYS0 Tetraodon nigroviridis full-length cDNA 44 0.17
42emb|CR688523.2|CNS0FU7R Tetraodon nigroviridis full-length cDNA 44 0.17
43emb|CR688181.2|CNS0FTY9 Tetraodon nigroviridis full-length cDNA 44 0.17
44emb|CR688138.2|CNS0FTX2 Tetraodon nigroviridis full-length cDNA 44 0.17
45emb|CR687296.2|CNS0FT9O Tetraodon nigroviridis full-length cDNA 44 0.17
46emb|CR682385.2|CNS0FPH9 Tetraodon nigroviridis full-length cDNA 44 0.17
47emb|CR675609.2|CNS0FK9R Tetraodon nigroviridis full-length cDNA 44 0.17
48emb|CR664046.2|CNS0FBCK Tetraodon nigroviridis full-length cDNA 44 0.17
49emb|CR663607.2|CNS0FB0D Tetraodon nigroviridis full-length cDNA 44 0.17
50emb|CR661227.2|CNS0F969 Tetraodon nigroviridis full-length cDNA 44 0.17
51emb|CR660613.2|CNS0F8P7 Tetraodon nigroviridis full-length cDNA 44 0.17
52emb|CR660539.2|CNS0F8N5 Tetraodon nigroviridis full-length cDNA 44 0.17
53emb|CR655127.2|CNS0F4GT Tetraodon nigroviridis full-length cDNA 44 0.17
54emb|CR653087.2|CNS0F2W5 Tetraodon nigroviridis full-length cDNA 44 0.17
55emb|CR652468.2|CNS0F2EY Tetraodon nigroviridis full-length cDNA 44 0.17
56emb|CR651752.2|CNS0F1V2 Tetraodon nigroviridis full-length cDNA 44 0.17
57emb|CR651630.2|CNS0F1RO Tetraodon nigroviridis full-length cDNA 44 0.17
58emb|CR650255.2|CNS0F0PH Tetraodon nigroviridis full-length cDNA 44 0.17
59emb|CR647893.2|CNS0EYVV Tetraodon nigroviridis full-length cDNA 44 0.17
60emb|CR647713.2|CNS0EYQV Tetraodon nigroviridis full-length cDNA 44 0.17
61emb|CR639196.2|CNS0ES6A Tetraodon nigroviridis full-length cDNA 44 0.17
62emb|CR637873.2|CNS0ER5J Tetraodon nigroviridis full-length cDNA 44 0.17
63emb|CR636835.2|CNS0EQCP Tetraodon nigroviridis full-length cDNA 44 0.17
64emb|CR634963.2|CNS0EOWP Tetraodon nigroviridis full-length cDNA 44 0.17
65emb|CR632932.2|CNS0ENCA Tetraodon nigroviridis full-length cDNA 44 0.17
66emb|CR632678.2|CNS0EN58 Tetraodon nigroviridis full-length cDNA 44 0.17
67emb|CR632573.2|CNS0EN2B Tetraodon nigroviridis full-length cDNA 44 0.17
68emb|CR632323.2|CNS0EMVD Tetraodon nigroviridis full-length cDNA 44 0.17
69emb|CR632317.2|CNS0EMV7 Tetraodon nigroviridis full-length cDNA 44 0.17
70emb|CR631332.2|CNS0EM3T Tetraodon nigroviridis full-length cDNA 44 0.17
71emb|CR631747.2|CNS0EMFD Tetraodon nigroviridis full-length cDNA 44 0.17
72gb|AY168640.1| Oreochromis niloticus nascent polypeptide-associa... 44 0.17
73ref|XM_609695.2| PREDICTED: Bos taurus similar to Nascent polype... 42 0.67
74gb|AC083797.16| Homo sapiens 3 BAC RP11-114A6 (Roswell Park Canc... 42 0.67
75gb|AC154213.3| Mus musculus BAC clone RP24-120I12 from chromosom... 42 0.67
76gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 42 0.67
77emb|AL845306.9| Zebrafish DNA sequence from clone DKEY-217M5 in ... 42 0.67
78gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete... 40 2.6
79ref|XM_883486.1| Leishmania major strain Friedlin nascent polype... 40 2.6
80emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4,... 40 2.6
81ref|XM_847221.1| PREDICTED: Canis familiaris similar to nascent ... 40 2.6
82gb|AC122252.4| Mus musculus BAC clone RP23-170E7 from chromosome... 40 2.6
83emb|CR688321.2|CNS0FU25 Tetraodon nigroviridis full-length cDNA 40 2.6
84emb|CR686631.2|CNS0FSR7 Tetraodon nigroviridis full-length cDNA 40 2.6
85gb|AC069564.34| Mus musculus strain C57BL/6J chromosome 17 clone... 40 2.6
86ref|NM_165950.1| Drosophila melanogaster Nascent polypeptide ass... 40 2.6
87ref|NM_134312.2| Drosophila melanogaster Nascent polypeptide ass... 40 2.6
88ref|NM_057868.3| Drosophila melanogaster Nascent polypeptide ass... 40 2.6
89gb|AY075332.1| Drosophila melanogaster GH11940 full length cDNA 40 2.6
90dbj|AK040727.1| Mus musculus adult male aorta and vein cDNA, RIK... 40 2.6
91gb|AE003821.4| Drosophila melanogaster chromosome 2R, section 29... 40 2.6
92gb|AF017783.2|AF017783 Drosophila melanogaster alpha NAC, diacyl... 40 2.6
93gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, r... 40 2.6
94dbj|AP001690.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 2.6
95emb|CT025550.11| Mouse DNA sequence from clone RP23-478C2 on chr... 40 2.6
96emb|Y08969.1|DMNACPRAL D.melanogaster mRNA for NAC protein alpha... 40 2.6
97dbj|AP000954.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 2.6 
>ref|XM_475153.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 158 tccatgatggcgctgacgatgtcgccatccgcagccttgag 198
           |||||||||||  |||||||||||||||  |||||||||||
Sbjct: 605 tccatgatggctgtgacgatgtcgccattggcagccttgag 565
to top
>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0025P09,
              complete sequence
          Length = 167318

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                       
Query: 158    tccatgatggcgctgacgatgtcgccatccgcagccttgag 198
              |||||||||||  |||||||||||||||  |||||||||||
Sbjct: 129674 tccatgatggctgtgacgatgtcgccattggcagccttgag 129634
to top
>gb|AC108874.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
           OJ1005_E12, complete sequence
          Length = 121293

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 158 tccatgatggcgctgacgatgtcgccatccgcagccttgag 198
           |||||||||||  |||||||||||||||  |||||||||||
Sbjct: 469 tccatgatggctgtgacgatgtcgccattggcagccttgag 429
to top
>dbj|AB110178.1| Oryza sativa (japonica cultivar-group) mRNA for nascent polypeptide
           associated complex alpha chain, complete cds, clone:
           13YPG044
          Length = 878

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 158 tccatgatggcgctgacgatgtcgccatccgcagccttgag 198
           |||||||||||  |||||||||||||||  |||||||||||
Sbjct: 622 tccatgatggctgtgacgatgtcgccattggcagccttgag 582
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                         
Query: 158      tccatgatggcgctgacgatgtcgccatccgcagccttgag 198
                |||||||||||  |||||||||||||||  |||||||||||
Sbjct: 17869720 tccatgatggctgtgacgatgtcgccattggcagccttgag 17869680
to top
>dbj|AK058906.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-D09, full
           insert sequence
          Length = 930

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 158 tccatgatggcgctgacgatgtcgccatccgcagccttgag 198
           |||||||||||  |||||||||||||||  |||||||||||
Sbjct: 684 tccatgatggctgtgacgatgtcgccattggcagccttgag 644
to top
>gb|AY231744.1| Drosophila yakuba clone yak-em_Nacalpha mRNA sequence
          Length = 198

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 150 tagtcaactccatgatggcgctgacgatgtc 180
           |||||| ||||||||||||| ||||||||||
Sbjct: 193 tagtcagctccatgatggcgttgacgatgtc 163
to top
>gb|AY522625.1| Oreochromis mossambicus nascent polypeptide-associated complex
           alpha polypeptide-like mRNA, partial sequence
          Length = 461

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           |||||||||||||||||  |||||||||||
Sbjct: 348 gtcaactccatgatggcattgacgatgtcg 319
to top
>emb|CR712159.2|CNS0GCGB Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR722249.2|CNS0GK8F Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 645 gtcaattccatgatggcgttgacgatgtcg 616
to top
>emb|CR722169.2|CNS0GK67 Tetraodon nigroviridis full-length cDNA
          Length = 1366

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  gtcaactccatgatggcgctgacgatgtcg 181
            ||||| |||||||||||| |||||||||||
Sbjct: 1263 gtcaattccatgatggcgttgacgatgtcg 1234
to top
>emb|CR717966.2|CNS0GGXG Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR717497.2|CNS0GGKF Tetraodon nigroviridis full-length cDNA
          Length = 456

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 347 gtcaattccatgatggcgttgacgatgtcg 318
to top
>emb|CR716901.2|CNS0GG3Y Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR716022.2|CNS0GFFM Tetraodon nigroviridis full-length cDNA
          Length = 520

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 411 gtcaattccatgatggcgttgacgatgtcg 382
to top
>emb|CR715618.2|CNS0GF4E Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 349 gtcaattccatgatggcgttgacgatgtcg 320
to top
>emb|CR715460.2|CNS0GF00 Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR714862.2|CNS0GEJE Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617
to top
>emb|CR714224.2|CNS0GE1O Tetraodon nigroviridis full-length cDNA
          Length = 757

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR712921.2|CNS0GD1H Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR712868.2|CNS0GD00 Tetraodon nigroviridis full-length cDNA
          Length = 751

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR710910.2|CNS0GBHM Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR710585.2|CNS0GB8L Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR709573.2|CNS0GAGH Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 411 gtcaattccatgatggcgttgacgatgtcg 382
to top
>emb|CR706444.2|CNS0G81K Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR704473.2|CNS0G6IT Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 354 gtcaattccatgatggcgttgacgatgtcg 325
to top
>emb|CR702894.2|CNS0G5AY Tetraodon nigroviridis full-length cDNA
          Length = 1294

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  gtcaactccatgatggcgctgacgatgtcg 181
            ||||| |||||||||||| |||||||||||
Sbjct: 1184 gtcaattccatgatggcgttgacgatgtcg 1155
to top
>emb|CR702653.2|CNS0G549 Tetraodon nigroviridis full-length cDNA
          Length = 1355

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  gtcaactccatgatggcgctgacgatgtcg 181
            ||||| |||||||||||| |||||||||||
Sbjct: 1261 gtcaattccatgatggcgttgacgatgtcg 1232
to top
>emb|CR702124.2|CNS0G4PK Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 354 gtcaattccatgatggcgttgacgatgtcg 325
to top
>emb|CR701979.2|CNS0G4LJ Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR701629.2|CNS0G4BT Tetraodon nigroviridis full-length cDNA
          Length = 1355

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  gtcaactccatgatggcgctgacgatgtcg 181
            ||||| |||||||||||| |||||||||||
Sbjct: 1258 gtcaattccatgatggcgttgacgatgtcg 1229
to top
>emb|CR699096.2|CNS0G2DG Tetraodon nigroviridis full-length cDNA
          Length = 1361

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  gtcaactccatgatggcgctgacgatgtcg 181
            ||||| |||||||||||| |||||||||||
Sbjct: 1264 gtcaattccatgatggcgttgacgatgtcg 1235
to top
>emb|CR698619.2|CNS0G207 Tetraodon nigroviridis full-length cDNA
          Length = 655

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 551 gtcaattccatgatggcgttgacgatgtcg 522
to top
>emb|CR698352.2|CNS0G1SS Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617
to top
>emb|CR697288.2|CNS0G0Z8 Tetraodon nigroviridis full-length cDNA
          Length = 1362

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  gtcaactccatgatggcgctgacgatgtcg 181
            ||||| |||||||||||| |||||||||||
Sbjct: 1260 gtcaattccatgatggcgttgacgatgtcg 1231
to top
>emb|CR696825.2|CNS0G0MD Tetraodon nigroviridis full-length cDNA
          Length = 1370

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  gtcaactccatgatggcgctgacgatgtcg 181
            ||||| |||||||||||| |||||||||||
Sbjct: 1261 gtcaattccatgatggcgttgacgatgtcg 1232
to top
>emb|CR696554.2|CNS0G0EU Tetraodon nigroviridis full-length cDNA
          Length = 545

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 436 gtcaattccatgatggcgttgacgatgtcg 407
to top
>emb|CR696276.2|CNS0G074 Tetraodon nigroviridis full-length cDNA
          Length = 435

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 326 gtcaattccatgatggcgttgacgatgtcg 297
to top
>emb|CR695626.2|CNS0FZP2 Tetraodon nigroviridis full-length cDNA
          Length = 1055

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617
to top
>emb|CR695732.2|CNS0FZS0 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR694436.2|CNS0FYS0 Tetraodon nigroviridis full-length cDNA
          Length = 1018

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 644 gtcaattccatgatggcgttgacgatgtcg 615
to top
>emb|CR688523.2|CNS0FU7R Tetraodon nigroviridis full-length cDNA
          Length = 420

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 311 gtcaattccatgatggcgttgacgatgtcg 282
to top
>emb|CR688181.2|CNS0FTY9 Tetraodon nigroviridis full-length cDNA
          Length = 981

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 648 gtcaattccatgatggcgttgacgatgtcg 619
to top
>emb|CR688138.2|CNS0FTX2 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR687296.2|CNS0FT9O Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR682385.2|CNS0FPH9 Tetraodon nigroviridis full-length cDNA
          Length = 1363

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  gtcaactccatgatggcgctgacgatgtcg 181
            ||||| |||||||||||| |||||||||||
Sbjct: 1260 gtcaattccatgatggcgttgacgatgtcg 1231
to top
>emb|CR675609.2|CNS0FK9R Tetraodon nigroviridis full-length cDNA
          Length = 707

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 606 gtcaattccatgatggcgttgacgatgtcg 577
to top
>emb|CR664046.2|CNS0FBCK Tetraodon nigroviridis full-length cDNA
          Length = 1047

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 938 gtcaattccatgatggcgttgacgatgtcg 909
to top
>emb|CR663607.2|CNS0FB0D Tetraodon nigroviridis full-length cDNA
          Length = 1200

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  gtcaactccatgatggcgctgacgatgtcg 181
            ||||| |||||||||||| |||||||||||
Sbjct: 1089 gtcaattccatgatggcgttgacgatgtcg 1060
to top
>emb|CR661227.2|CNS0F969 Tetraodon nigroviridis full-length cDNA
          Length = 1044

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 935 gtcaattccatgatggcgttgacgatgtcg 906
to top
>emb|CR660613.2|CNS0F8P7 Tetraodon nigroviridis full-length cDNA
          Length = 1051

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 645 gtcaattccatgatggcgttgacgatgtcg 616
to top
>emb|CR660539.2|CNS0F8N5 Tetraodon nigroviridis full-length cDNA
          Length = 948

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 839 gtcaattccatgatggcgttgacgatgtcg 810
to top
>emb|CR655127.2|CNS0F4GT Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR653087.2|CNS0F2W5 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR652468.2|CNS0F2EY Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR651752.2|CNS0F1V2 Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR651630.2|CNS0F1RO Tetraodon nigroviridis full-length cDNA
          Length = 1056

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 648 gtcaattccatgatggcgttgacgatgtcg 619
to top
>emb|CR650255.2|CNS0F0PH Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR647893.2|CNS0EYVV Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR647713.2|CNS0EYQV Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR639196.2|CNS0ES6A Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR637873.2|CNS0ER5J Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR636835.2|CNS0EQCP Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR634963.2|CNS0EOWP Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR632932.2|CNS0ENCA Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR632678.2|CNS0EN58 Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR632573.2|CNS0EN2B Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR632323.2|CNS0EMVD Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR632317.2|CNS0EMV7 Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR631332.2|CNS0EM3T Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR631747.2|CNS0EMFD Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>gb|AY168640.1| Oreochromis niloticus nascent polypeptide-associated complex alpha
           polypeptide (naca) mRNA, complete cds
          Length = 808

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 152 gtcaactccatgatggcgctgacgatgtcg 181
           |||||||||||||||||  |||||||||||
Sbjct: 677 gtcaactccatgatggcattgacgatgtcg 648
to top
>ref|XM_609695.2| PREDICTED: Bos taurus similar to Nascent polypeptide-associated
            complex alpha subunit, muscle-specific form (Alpha-NAC,
            muscle-specific form) (LOC531208), mRNA
          Length = 8513

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 152  gtcaactccatgatggcgctgacgatgtc 180
            |||| ||||||||||||| ||||||||||
Sbjct: 8264 gtcagctccatgatggcgttgacgatgtc 8236
to top
>gb|AC083797.16| Homo sapiens 3 BAC RP11-114A6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 157113

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 124    cacaactccaccttccagaac 144
              |||||||||||||||||||||
Sbjct: 104829 cacaactccaccttccagaac 104849
to top
>gb|AC154213.3| Mus musculus BAC clone RP24-120I12 from chromosome 14, complete sequence
          Length = 183773

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 71     ttcaagatgacatgaccaaaa 91
              |||||||||||||||||||||
Sbjct: 118835 ttcaagatgacatgaccaaaa 118855
to top
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 162    tgatggcgctgacgatgtcgccatc 186
              ||||||||||| |||||||||||||
Sbjct: 675148 tgatggcgctggcgatgtcgccatc 675172
to top
>emb|AL845306.9| Zebrafish DNA sequence from clone DKEY-217M5 in linkage group 20,
             complete sequence
          Length = 186675

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 67    aacattcaagatgacatgaccaaaa 91
             ||||||||| |||||||||||||||
Sbjct: 73698 aacattcaacatgacatgaccaaaa 73674
to top
>gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete sequence
          Length = 182105

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 157   ctccatgatggcgctgacgatgtc 180
             ||||||||||||| ||||||||||
Sbjct: 23136 ctccatgatggcgttgacgatgtc 23159
to top
>ref|XM_883486.1| Leishmania major strain Friedlin nascent polypeptide associated
           complex subunit (L4830.08) partial mRNA
          Length = 735

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 152 gtcaactccatgatggcgctgacgatgtcgcc 183
           |||| ||||||||||| | |||||||||||||
Sbjct: 728 gtcagctccatgatggtgttgacgatgtcgcc 697
to top
>emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end
          Length = 247462

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 152   gtcaactccatgatggcgctgacgatgtcgcc 183
             |||| ||||||||||| | |||||||||||||
Sbjct: 79339 gtcagctccatgatggtgttgacgatgtcgcc 79370
to top
>ref|XM_847221.1| PREDICTED: Canis familiaris similar to nascent
           polypeptide-associated complex alpha polypeptide
           (LOC609875), mRNA
          Length = 360

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 ctccatgatggcgctgacgatgtc 180
           ||||||||||||| ||||||||||
Sbjct: 348 ctccatgatggcgttgacgatgtc 325
to top
>gb|AC122252.4| Mus musculus BAC clone RP23-170E7 from chromosome 17, complete sequence
          Length = 219695

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    caacaggcacagagcctcca 53
             ||||||||||||||||||||
Sbjct: 18699 caacaggcacagagcctcca 18718
to top
>emb|CR688321.2|CNS0FU25 Tetraodon nigroviridis full-length cDNA
          Length = 1371

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 158  tccatgatggcgctgacgatgtcg 181
            |||||||||||| |||||||||||
Sbjct: 1257 tccatgatggcgttgacgatgtcg 1234
to top
>emb|CR686631.2|CNS0FSR7 Tetraodon nigroviridis full-length cDNA
          Length = 1357

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 158  tccatgatggcgctgacgatgtcg 181
            |||||||||||| |||||||||||
Sbjct: 1260 tccatgatggcgttgacgatgtcg 1237
to top
>gb|AC069564.34| Mus musculus strain C57BL/6J chromosome 17 clone rp23-435n13, complete
              sequence
          Length = 185784

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     caacaggcacagagcctcca 53
              ||||||||||||||||||||
Sbjct: 101170 caacaggcacagagcctcca 101151
to top
>ref|NM_165950.1| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RC, transcript variant C
           (Nacalpha), mRNA
          Length = 874

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 ctccatgatggcgctgacgatgtc 180
           ||||||||||||| ||||||||||
Sbjct: 695 ctccatgatggcgttgacgatgtc 672
to top
>ref|NM_134312.2| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RA, transcript variant A
           (Nacalpha), mRNA
          Length = 870

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 ctccatgatggcgctgacgatgtc 180
           ||||||||||||| ||||||||||
Sbjct: 686 ctccatgatggcgttgacgatgtc 663
to top
>ref|NM_057868.3| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RB, transcript variant B
           (Nacalpha), mRNA
          Length = 897

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 ctccatgatggcgctgacgatgtc 180
           ||||||||||||| ||||||||||
Sbjct: 713 ctccatgatggcgttgacgatgtc 690
to top
>gb|AY075332.1| Drosophila melanogaster GH11940 full length cDNA
          Length = 890

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 ctccatgatggcgctgacgatgtc 180
           ||||||||||||| ||||||||||
Sbjct: 684 ctccatgatggcgttgacgatgtc 661
to top
>dbj|AK040727.1| Mus musculus adult male aorta and vein cDNA, RIKEN full-length
          enriched library, clone:A530020O13 product:HT034
          homolog [Homo sapiens], full insert sequence
          Length = 3196

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 34 caacaggcacagagcctcca 53
          ||||||||||||||||||||
Sbjct: 23 caacaggcacagagcctcca 4
to top
>gb|AE003821.4| Drosophila melanogaster chromosome 2R, section 29 of 73 of the complete
              sequence
          Length = 294168

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 157    ctccatgatggcgctgacgatgtc 180
              ||||||||||||| ||||||||||
Sbjct: 238219 ctccatgatggcgttgacgatgtc 238242
to top
>gb|AF017783.2|AF017783 Drosophila melanogaster alpha NAC, diacylglycerol kinase epsilon
           and ubiquinol-cytochrome C reductase complex genes,
           complete cds; and unknown gene
          Length = 4728

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 ctccatgatggcgctgacgatgtc 180
           ||||||||||||| ||||||||||
Sbjct: 779 ctccatgatggcgttgacgatgtc 756
to top
>gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, region 49C1-49D3, P1 clones
             DS04499, DS06146, and DS00455, complete sequence
          Length = 145055

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 157   ctccatgatggcgctgacgatgtc 180
             ||||||||||||| ||||||||||
Sbjct: 59899 ctccatgatggcgttgacgatgtc 59922
to top
>dbj|AP001690.1| Homo sapiens genomic DNA, chromosome 21q, section 34/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 62     actacaacattcaagatgac 81
              ||||||||||||||||||||
Sbjct: 149761 actacaacattcaagatgac 149780
to top
>emb|CT025550.11| Mouse DNA sequence from clone RP23-478C2 on chromosome 17, complete
            sequence
          Length = 187385

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   caacaggcacagagcctcca 53
            ||||||||||||||||||||
Sbjct: 1811 caacaggcacagagcctcca 1792
to top
>emb|Y08969.1|DMNACPRAL D.melanogaster mRNA for NAC protein alpha subunit
          Length = 829

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 ctccatgatggcgctgacgatgtc 180
           ||||||||||||| ||||||||||
Sbjct: 646 ctccatgatggcgttgacgatgtc 623
to top
>dbj|AP000954.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2 clone:B705D10,
            LL56-APP region, complete sequence
          Length = 25256

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 62   actacaacattcaagatgac 81
            ||||||||||||||||||||
Sbjct: 9663 actacaacattcaagatgac 9682


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,604,743
Number of Sequences: 3902068
Number of extensions: 1604743
Number of successful extensions: 113330
Number of sequences better than 10.0: 97
Number of HSP's better than 10.0 without gapping: 97
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 113149
Number of HSP's gapped (non-prelim): 181
length of query: 209
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 187
effective length of database: 17,147,199,772
effective search space: 3206526357364
effective search space used: 3206526357364
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top