ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal20f20
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 60 6e-06
2dbj|AK105676.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 6e-06
3gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 60 6e-06
4emb|AL954871.5|CNS08CDA Oryza sativa chromosome 12, . BAC OSJNBb... 60 6e-06
5emb|AL845342.2|CNS08CB4 Oryza sativa chromosome 12, . BAC OSJNBa... 60 6e-06
6gb|AC120888.2| Oryza sativa (japonica cultivar-group) chromosome... 56 9e-05
7gb|AC108870.2| Oryza sativa (japonica cultivar-group) chromosome... 56 9e-05
8dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
9dbj|AK065526.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
10gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 56 9e-05
11gb|AF228729.3| Homo sapiens chromosome 8 clone RP11-101A8 map q2... 42 1.3
12gb|AF188027.5| Homo sapiens chromosome 8 clone RP11-101A8 map q2... 42 1.3
13gb|AC119419.9| Medicago truncatula clone mth2-6b12, complete seq... 42 1.3
14gb|AF334030.1| Helicoverpa zea single nucleocapsid nucleopolyhed... 42 1.3
15gb|AC087792.7| Homo sapiens chromosome 8, clone RP1-16A9, comple... 42 1.3
16gb|AF271059.1|AF271059 Heliocoverpa armigera nucleopolyhedroviru... 42 1.3
17gb|AF303045.2| Helicoverpa armigera nuclear polyhedrosis virus, ... 42 1.3
18dbj|AP004494.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 1.3
19gb|U11242.1|NPVU11242 Helicoverpa zea nuclear polyhedrosis virus... 42 1.3
20gb|AC007890.6| Drosophila melanogaster clone BACR02G21, complete... 40 5.1
21gb|AC009394.5| Drosophila melanogaster clone BACR03J17, complete... 40 5.1
22gb|AC133601.3| Mus musculus BAC clone RP24-179O1 from chromosome... 40 5.1
23emb|CT025843.1| Medicago truncatula chromosome 5 clone mth2-17e2... 40 5.1
24gb|AE014305.1| Homo sapiens chromosome 13q34 schizophrenia regio... 40 5.1
25emb|CR954193.3| Medicago truncatula chromosome 5 clone mth2-27a1... 40 5.1
26emb|AL354763.17| Human DNA sequence from clone RP11-357L1 on chr... 40 5.1
27emb|AL138709.19| Human DNA sequence from clone RP11-460G11 on ch... 40 5.1
28emb|AL034419.22|HS1108D11 Human DNA sequence from clone RP5-1108... 40 5.1
29emb|AL031733.3|HS455J7 Human DNA sequence from clone RP3-455J7 o... 40 5.1
30gb|DQ397638.1| Cenarchaeum symbiosum clone C16E09, complete sequ... 40 5.1
31gb|DQ397615.1| Cenarchaeum symbiosum clone C20B09, complete sequ... 40 5.1
32gb|AC092377.3| Homo sapiens chromosome 16 clone RP11-680G10, com... 40 5.1
33gb|AC013724.8| Homo sapiens BAC clone RP11-319E12 from 4, comple... 40 5.1
34gb|AC092506.3| Homo sapiens chromosome 1 clone RP11-364B6, compl... 40 5.1
35tpg|BK001429.1| TPA: TPA_exp: Homo sapiens NOELIN3 (OLFM3) gene,... 40 5.1
36gb|AC009080.8| Homo sapiens chromosome 16 clone RP11-341K23, com... 40 5.1
37gb|AE003721.3| Drosophila melanogaster chromosome 3R, section 59... 40 5.1
38emb|AL356280.21| Human DNA sequence from clone RP11-82O2 on chro... 40 5.1
39emb|AL954730.15| Mouse DNA sequence from clone RP23-461C4 on chr... 40 5.1
40gb|AC151409.2| Mus musculus BAC clone RP24-541K8 from 18, comple... 40 5.1
41emb|AL683877.10| Mouse DNA sequence from clone RP23-120P2 on chr... 40 5.1
42emb|AL731839.13| Mouse DNA sequence from clone RP23-76O22 on chr... 40 5.1 
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Minus

                                                              
Query: 50       tttcttacagattgaatgaacaaat-gtaactgtacaaggaaacac 94
                |||||||||||||||||||||||||  |||||||||||| ||||||
Sbjct: 22609689 tttcttacagattgaatgaacaaatcttaactgtacaagcaaacac 22609644
to top
>dbj|AK105676.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-201-A12, full
            insert sequence
          Length = 1733

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Minus

                                                          
Query: 50   tttcttacagattgaatgaacaaat-gtaactgtacaaggaaacac 94
            |||||||||||||||||||||||||  |||||||||||| ||||||
Sbjct: 1571 tttcttacagattgaatgaacaaatcttaactgtacaagcaaacac 1526
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Minus

                                                              
Query: 50       tttcttacagattgaatgaacaaat-gtaactgtacaaggaaacac 94
                |||||||||||||||||||||||||  |||||||||||| ||||||
Sbjct: 22537881 tttcttacagattgaatgaacaaatcttaactgtacaagcaaacac 22537836
to top
>emb|AL954871.5|CNS08CDA Oryza sativa chromosome 12, . BAC OSJNBb0085B24 of library OSJNBb from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 131441

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Minus

                                                            
Query: 50     tttcttacagattgaatgaacaaat-gtaactgtacaaggaaacac 94
              |||||||||||||||||||||||||  |||||||||||| ||||||
Sbjct: 112268 tttcttacagattgaatgaacaaatcttaactgtacaagcaaacac 112223
to top
>emb|AL845342.2|CNS08CB4 Oryza sativa chromosome 12, . BAC OSJNBa0027H05 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 138368

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Minus

                                                           
Query: 50    tttcttacagattgaatgaacaaat-gtaactgtacaaggaaacac 94
             |||||||||||||||||||||||||  |||||||||||| ||||||
Sbjct: 54810 tttcttacagattgaatgaacaaatcttaactgtacaagcaaacac 54765
to top
>gb|AC120888.2| Oryza sativa (japonica cultivar-group) chromosome 11 PAC clone P0485F09,
              complete sequence
          Length = 161276

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                  
Query: 50     tttcttacagattgaatgaacaaatgtaactgtaca 85
              |||||||||||||||||||| ||||||| |||||||
Sbjct: 158937 tttcttacagattgaatgaagaaatgtagctgtaca 158972
to top
>gb|AC108870.2| Oryza sativa (japonica cultivar-group) chromosome 11 PAC clone
             P0682E05, complete sequence
          Length = 162223

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                 
Query: 50    tttcttacagattgaatgaacaaatgtaactgtaca 85
             |||||||||||||||||||| ||||||| |||||||
Sbjct: 42093 tttcttacagattgaatgaagaaatgtagctgtaca 42128
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                    
Query: 50       tttcttacagattgaatgaacaaatgtaactgtaca 85
                |||||||||||||||||||| ||||||| |||||||
Sbjct: 25552046 tttcttacagattgaatgaagaaatgtagctgtaca 25552081
to top
>dbj|AK065526.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013031H05, full
            insert sequence
          Length = 1982

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 50   tttcttacagattgaatgaacaaatgtaactgtaca 85
            |||||||||||||||||||| ||||||| |||||||
Sbjct: 1831 tttcttacagattgaatgaagaaatgtagctgtaca 1796
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                    
Query: 50       tttcttacagattgaatgaacaaatgtaactgtaca 85
                |||||||||||||||||||| ||||||| |||||||
Sbjct: 25870716 tttcttacagattgaatgaagaaatgtagctgtaca 25870751
to top
>gb|AF228729.3| Homo sapiens chromosome 8 clone RP11-101A8 map q21.11, complete
             sequence
          Length = 101448

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 266   aggaaaggatgaatattgggt 286
             |||||||||||||||||||||
Sbjct: 57169 aggaaaggatgaatattgggt 57189
to top
>gb|AF188027.5| Homo sapiens chromosome 8 clone RP11-101A8 map q21.11, complete
             sequence
          Length = 146199

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 266   aggaaaggatgaatattgggt 286
             |||||||||||||||||||||
Sbjct: 86620 aggaaaggatgaatattgggt 86640
to top
>gb|AC119419.9| Medicago truncatula clone mth2-6b12, complete sequence
          Length = 106395

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    agattgaatgaacaaatgtaa 78
             |||||||||||||||||||||
Sbjct: 12428 agattgaatgaacaaatgtaa 12408
to top
>gb|AF334030.1| Helicoverpa zea single nucleocapsid nucleopolyhedrovirus, complete
             genome
          Length = 130869

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 5     acggtatgaacaaactctttg 25
             |||||||||||||||||||||
Sbjct: 62872 acggtatgaacaaactctttg 62892
to top
>gb|AC087792.7| Homo sapiens chromosome 8, clone RP1-16A9, complete sequence
          Length = 101448

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 266   aggaaaggatgaatattgggt 286
             |||||||||||||||||||||
Sbjct: 44280 aggaaaggatgaatattgggt 44260
to top
>gb|AF271059.1|AF271059 Heliocoverpa armigera nucleopolyhedrovirus G4, complete genome
          Length = 131403

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 5     acggtatgaacaaactctttg 25
             |||||||||||||||||||||
Sbjct: 62979 acggtatgaacaaactctttg 62999
to top
>gb|AF303045.2| Helicoverpa armigera nuclear polyhedrosis virus, complete genome
          Length = 130759

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 5     acggtatgaacaaactctttg 25
             |||||||||||||||||||||
Sbjct: 62381 acggtatgaacaaactctttg 62401
to top
>dbj|AP004494.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT09I17, TM0026,
             complete sequence
          Length = 103129

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 332   gatgagcagatggaggaatttgagg 356
             |||||| ||||||||||||||||||
Sbjct: 12389 gatgagaagatggaggaatttgagg 12413
to top
>gb|U11242.1|NPVU11242 Helicoverpa zea nuclear polyhedrosis virus DNA-directed DNA
            polymerase gene, complete cds
          Length = 6200

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 5    acggtatgaacaaactctttg 25
            |||||||||||||||||||||
Sbjct: 3910 acggtatgaacaaactctttg 3930
to top
>gb|AC007890.6| Drosophila melanogaster clone BACR02G21, complete sequence
          Length = 171563

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 258   atagaaataggaaaggatgaatat 281
             |||||||||||||| |||||||||
Sbjct: 18732 atagaaataggaaaagatgaatat 18709
to top
>gb|AC009394.5| Drosophila melanogaster clone BACR03J17, complete sequence
          Length = 199043

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 258    atagaaataggaaaggatgaatat 281
              |||||||||||||| |||||||||
Sbjct: 171565 atagaaataggaaaagatgaatat 171542
to top
>gb|AC133601.3| Mus musculus BAC clone RP24-179O1 from chromosome 18, complete sequence
          Length = 180978

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 218   gatggaagctagagcctagatgtc 241
             ||||||||||||||||||| ||||
Sbjct: 80602 gatggaagctagagcctagttgtc 80579
to top
>emb|CT025843.1| Medicago truncatula chromosome 5 clone mth2-17e22, COMPLETE SEQUENCE
          Length = 116514

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 244  cagattgtacatggatagaa 263
            ||||||||||||||||||||
Sbjct: 7181 cagattgtacatggatagaa 7162
to top
>gb|AE014305.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 2 of
              11 of the complete sequence
          Length = 613322

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     aaatttcttacagattgaat 66
              ||||||||||||||||||||
Sbjct: 421948 aaatttcttacagattgaat 421967
to top
>emb|CR954193.3| Medicago truncatula chromosome 5 clone mth2-27a1, COMPLETE SEQUENCE
          Length = 127717

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 244    cagattgtacatggatagaa 263
              ||||||||||||||||||||
Sbjct: 118187 cagattgtacatggatagaa 118168
to top
>emb|AL354763.17| Human DNA sequence from clone RP11-357L1 on chromosome 13 Contains an
              ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G
              variant 1 (ATP6V1G1) pseudogene, complete sequence
          Length = 192963

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     aaatttcttacagattgaat 66
              ||||||||||||||||||||
Sbjct: 148488 aaatttcttacagattgaat 148507
to top
>emb|AL138709.19| Human DNA sequence from clone RP11-460G11 on chromosome 13 Contains
             part of a novel gene, complete sequence
          Length = 96874

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 250   gtacatggatagaaatagga 269
             ||||||||||||||||||||
Sbjct: 54301 gtacatggatagaaatagga 54282
to top
>emb|AL034419.22|HS1108D11 Human DNA sequence from clone RP5-1108D11 on chromosome 20q12-13.11
             Contains the 3' end of the JPH2 gene for junctophilin 2
             (JP2, JP-2), the 3' end of the C20orf100 gene for a novel
             HMG (high mobility group) box protein similar to KIAA0737,
             KIAA0808 and TNRC9 (CAGF9) and two CpG islands, complete
             sequence
          Length = 152209

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    cctaccggacaaaatttctt 55
             ||||||||||||||||||||
Sbjct: 33189 cctaccggacaaaatttctt 33208
to top
>emb|AL031733.3|HS455J7 Human DNA sequence from clone RP3-455J7 on chromosome 1q24 Contains the
             5' end of the CD3Z gene for CD3Z antigen zeta polypeptide
             (TiT3 complex), an aldo-keto reductase family 1 member D1
             (delta 4-3-ketosteroid-5-beta-reductase) (AKR1D1)
             pseudogene, the CREG gene for cellular repressor of
             E1A-stimulated genes, a ribosomal protein S18 (RPS18)
             pseudogene, a novel gene, the 5' end of the gene for a
             novel protein and a CpG island, complete sequence
          Length = 215861

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 266   aggaaaggatgaatattggg 285
             ||||||||||||||||||||
Sbjct: 21686 aggaaaggatgaatattggg 21667
to top
>gb|DQ397638.1| Cenarchaeum symbiosum clone C16E09, complete sequence
          Length = 40387

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 239  gtctccagattgtacatgga 258
            ||||||||||||||||||||
Sbjct: 6448 gtctccagattgtacatgga 6467
to top
>gb|DQ397615.1| Cenarchaeum symbiosum clone C20B09, complete sequence
          Length = 39122

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 239   gtctccagattgtacatgga 258
             ||||||||||||||||||||
Sbjct: 12563 gtctccagattgtacatgga 12544
to top
>gb|AC092377.3| Homo sapiens chromosome 16 clone RP11-680G10, complete sequence
          Length = 207283

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 204    ggggacaagatgttgatgga 223
              ||||||||||||||||||||
Sbjct: 102294 ggggacaagatgttgatgga 102275
to top
>gb|AC013724.8| Homo sapiens BAC clone RP11-319E12 from 4, complete sequence
          Length = 166521

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 342    tggaggaatttgaggattgg 361
              ||||||||||||||||||||
Sbjct: 108158 tggaggaatttgaggattgg 108139
to top
>gb|AC092506.3| Homo sapiens chromosome 1 clone RP11-364B6, complete sequence
          Length = 198279

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 42     ggacaaaatttcttacagat 61
              ||||||||||||||||||||
Sbjct: 157790 ggacaaaatttcttacagat 157771
to top
>tpg|BK001429.1| TPA: TPA_exp: Homo sapiens NOELIN3 (OLFM3) gene, complete cds;
             alternatively spliced
          Length = 195421

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 72    aatgtaactgtacaaggaaacacctccc 99
             ||||||||||| |||| |||||||||||
Sbjct: 92686 aatgtaactgtgcaagaaaacacctccc 92659
to top
>gb|AC009080.8| Homo sapiens chromosome 16 clone RP11-341K23, complete sequence
          Length = 178099

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    aaatttcttacagattgaat 66
             ||||||||||||||||||||
Sbjct: 81484 aaatttcttacagattgaat 81503
to top
>gb|AE003721.3| Drosophila melanogaster chromosome 3R, section 59 of 118 of the complete
              sequence
          Length = 224889

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 258    atagaaataggaaaggatgaatat 281
              |||||||||||||| |||||||||
Sbjct: 192059 atagaaataggaaaagatgaatat 192036
to top
>emb|AL356280.21| Human DNA sequence from clone RP11-82O2 on chromosome 1 Contains the 5'
             end of the OLFM3 gene for olfactomedin 3 and a DNAJ family
             pseudogene, complete sequence
          Length = 173251

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 72    aatgtaactgtacaaggaaacacctccc 99
             ||||||||||| |||| |||||||||||
Sbjct: 58836 aatgtaactgtgcaagaaaacacctccc 58863
to top
>emb|AL954730.15| Mouse DNA sequence from clone RP23-461C4 on chromosome 11, complete
              sequence
          Length = 193721

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 62     tgaatgaacaaatgtaactg 81
              ||||||||||||||||||||
Sbjct: 178622 tgaatgaacaaatgtaactg 178641
to top
>gb|AC151409.2| Mus musculus BAC clone RP24-541K8 from 18, complete sequence
          Length = 179265

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 218    gatggaagctagagcctagatgtc 241
              ||||||||||||||||||| ||||
Sbjct: 152238 gatggaagctagagcctagttgtc 152215
to top
>emb|AL683877.10| Mouse DNA sequence from clone RP23-120P2 on chromosome 4, complete
              sequence
          Length = 184168

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 255    tggatagaaataggaaagga 274
              ||||||||||||||||||||
Sbjct: 115345 tggatagaaataggaaagga 115326
to top
>emb|AL731839.13| Mouse DNA sequence from clone RP23-76O22 on chromosome X, complete
             sequence
          Length = 228355

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   ttctttgatgaacctataac 187
             ||||||||||||||||||||
Sbjct: 38631 ttctttgatgaacctataac 38650


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,023,322
Number of Sequences: 3902068
Number of extensions: 3023322
Number of successful extensions: 57012
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56886
Number of HSP's gapped (non-prelim): 121
length of query: 384
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 362
effective length of database: 17,147,199,772
effective search space: 6207286317464
effective search space used: 6207286317464
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top