>emb|AL928738.8| Mouse DNA sequence from clone RP23-76M15 on chromosome 4, complete
              sequence
          Length = 188568

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 80     tgacttctccctgaaagcca 99
              ||||||||||||||||||||
Sbjct: 135879 tgacttctccctgaaagcca 135898

>ref|XM_630605.1| Dictyostelium discoideum hypothetical protein (DDB0189000), partial
           mRNA
          Length = 2163

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 155 tagtagtagtttaggttca 173
           |||||||||||||||||||
Sbjct: 720 tagtagtagtttaggttca 738

>emb|BX933428.1| Gallus gallus finished cDNA, clone ChEST63n8
          Length = 1349

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 83   cttctccctgaaagccatc 101
            |||||||||||||||||||
Sbjct: 1051 cttctccctgaaagccatc 1033

>emb|CR956393.14| Pig DNA sequence from clone CH242-163M14 on chromosome 17, complete
             sequence
          Length = 195684

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 164   tttaggttcatgggaagca 182
             |||||||||||||||||||
Sbjct: 32232 tttaggttcatgggaagca 32250

>emb|AL807804.16| Mouse DNA sequence from clone RP23-134H12 on chromosome 4, complete
             sequence
          Length = 206748

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 160   gtagtttaggttcatggga 178
             |||||||||||||||||||
Sbjct: 33765 gtagtttaggttcatggga 33783


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 993,582
Number of Sequences: 3902068
Number of extensions: 993582
Number of successful extensions: 60567
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 60559
Number of HSP's gapped (non-prelim): 8
length of query: 198
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 176
effective length of database: 17,147,199,772
effective search space: 3017907159872
effective search space used: 3017907159872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)