ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal19h13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF053311.1|AF053311 Zantedeschia aethiopica glutathione perox... 226 7e-56
2dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 204 2e-49
3dbj|AP003489.2| Oryza sativa (japonica cultivar-group) genomic D... 204 2e-49
4emb|AJ000508.1|PSPGLUPER Pisum sativum mRNA for phospholipid glu... 174 2e-40
5ref|NM_119337.2| Arabidopsis thaliana ATGPX7 (GLUTATHIONE PEROXI... 145 2e-31
6ref|NM_128065.2| Arabidopsis thaliana ATGPX1 (GLUTATHIONE PEROXI... 133 8e-28
7emb|X89866.1|ATGLUTPER A.thaliana mRNA for glutathione peroxidase 133 8e-28
8gb|AY063024.1| Arabidopsis thaliana putative glutathione peroxid... 133 8e-28
9gb|AY035153.1| Arabidopsis thaliana putative glutathione peroxid... 133 8e-28
10emb|AJ000469.1|ATCHLGPX1 Arabidopsis thaliana chloroplast mRNA f... 133 8e-28
11gb|AY347849.1| Malus x domestica clone 23-3 phospholipid glutath... 109 1e-20
12gb|AC143339.12| Medicago truncatula clone mth2-20g20, complete s... 100 1e-17
13gb|AF411209.1| Brassica napus glutathione peroxidase mRNA, compl... 76 2e-10
14emb|AL161579.2|ATCHRIV75 Arabidopsis thaliana DNA chromosome 4, ... 72 2e-09
15emb|AL049607.1|ATF11C18 Arabidopsis thaliana DNA chromosome 4, B... 72 2e-09
16emb|AJ487466.1|CAR487466 Cicer arietinum mRNA for putative phosp... 70 9e-09
17gb|AY493200.1| Brassica oleracea var. botrytis GPx (GPx) mRNA, c... 68 4e-08
18emb|Y14707.1|HAGPXHA2 Heliantus annuus mRNA for glutathione pero... 66 1e-07
19ref|NM_129896.2| Arabidopsis thaliana ATGPX3 (GLUTATHIONE PEROXI... 52 0.002
20gb|AY096479.1| Arabidopsis thaliana putative glutathione peroxid... 52 0.002
21gb|AY065372.1| Arabidopsis thaliana putative glutathione peroxid... 52 0.002
22dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 52 0.002
23gb|AY087030.1| Arabidopsis thaliana clone 30737 mRNA, complete s... 52 0.002
24dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 52 0.002
25dbj|D63425.1| Spinacia oleracea mRNA for phopholipid hydroperoxi... 52 0.002
26ref|XM_533828.2| PREDICTED: Canis familiaris glutathione peroxid... 50 0.009
27gb|AF242650.1|AF242650 Hevea brasiliensis glutathione peroxidase... 50 0.009
28gb|AC135562.3| Oryza sativa (japonica cultivar-group) chromosome... 48 0.034
29gb|BC071064.1| Xenopus laevis MGC78876 protein, mRNA (cDNA clone... 48 0.034
30ref|XM_709201.1| Candida albicans SC5314 putative glutathione pe... 48 0.034
31ref|XM_708924.1| Candida albicans SC5314 putative glutathione pe... 48 0.034
32emb|X66377.1|CSCSAPRO C.sinensis mRNA csa for salt-associated pr... 48 0.034
33gb|DQ004739.1| Phaseolus lunatus glutathione peroxidase (GP1) mR... 48 0.034
34emb|BX934548.2| Gallus gallus finished cDNA, clone ChEST607g18 48 0.034
35dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.034
36dbj|AK101586.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.034
37dbj|AK101583.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.034
38gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 48 0.034
39gb|CP000110.1| Synechococcus sp. CC9605, complete genome 46 0.14
40ref|XM_386326.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 46 0.14
41ref|XM_503454.1| Yarrowia lipolytica CLIB122, YALI0E02310g predi... 46 0.14
42gb|AC130797.5| Chlamydomonas reinhardtii clone cr-1j6b, complete... 46 0.14
43gb|AF014927.1|AF014927 Chlamydomonas reinhardtii glutathione per... 46 0.14
44emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 46 0.14
45gb|AF047660.2| Caenorhabditis elegans cosmid T09A12, complete se... 44 0.54
46gb|AC183773.2| Pan troglodytes BAC clone CH251-2N7 from chromoso... 44 0.54
47gb|AC092648.3| Homo sapiens BAC clone RP11-421N10 from 7, comple... 44 0.54
48gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 44 0.54
49emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 44 0.54
50emb|AJ238697.1|HVU238697 Hordeum vulgare mRNA for GPX12Hv, culti... 44 0.54
51gb|L10325.1|BOVSELGP Cow glutathione peroxidase (GPx) plasma iso... 44 0.54
52ref|NM_001028197.1| Caenorhabditis elegans T09A12.2b (T09A12.2) ... 44 0.54
53ref|NM_001028196.1| Caenorhabditis elegans T09A12.2a (T09A12.2) ... 44 0.54
54ref|NM_174077.2| Bos taurus glutathione peroxidase 3 (plasma) (G... 44 0.54
55dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 44 0.54
56dbj|AK105165.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.54
57dbj|AK058456.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.54
58dbj|AB096704.1| Hordeum vulgare BarPHGPX mRNA for phospholipid h... 44 0.54
59emb|AJ938182.1| Staphylococcus aureus RF122 complete genome 44 0.54
60ref|NM_117229.2| Arabidopsis thaliana ATGPX6 (GLUTATHIONE PEROXI... 42 2.1
61ref|XM_520933.1| PREDICTED: Pan troglodytes similar to Glutathio... 42 2.1
62ref|NM_001003213.1| Canis familiaris glutathione peroxidase 5 (e... 42 2.1
63ref|XM_527081.1| PREDICTED: Pan troglodytes similar to Plasma gl... 42 2.1
64ref|XM_517021.1| PREDICTED: Pan troglodytes similar to Glutathio... 42 2.1
65ref|NM_010343.1| Mus musculus glutathione peroxidase 5 (Gpx5), mRNA 42 2.1
66gb|AC107634.8| Mus musculus chromosome 5, clone RP23-19G21, comp... 42 2.1
67gb|BT018110.1| Zea mays clone EL01N0553E06.c mRNA sequence 42 2.1
68gb|AC161260.2| Mus musculus BAC clone RP23-448A11 from chromosom... 42 2.1
69gb|AC108399.11| Mus musculus chromosome 19, clone RP24-375O7, co... 42 2.1
70gb|AC137124.17| Mus musculus chromosome 3, clone RP24-229P11, co... 42 2.1
71ref|XM_864340.1| PREDICTED: Bos taurus similar to glutathione pe... 42 2.1
72ref|XM_425211.1| PREDICTED: Gallus gallus similar to glutathione... 42 2.1
73gb|BC013526.1| Mus musculus glutathione peroxidase 6, mRNA (cDNA... 42 2.1
74gb|AY966403.1| Callithrix jacchus cytosolic glutathione peroxida... 42 2.1
75ref|NM_008160.2| Mus musculus glutathione peroxidase 1 (Gpx1), mRNA 42 2.1
76gb|BC070258.1| Homo sapiens cDNA clone MGC:88245 IMAGE:6452792, ... 42 2.1
77gb|BC103589.1| Mus musculus glutathione peroxidase 5, mRNA (cDNA... 42 2.1
78gb|BC103588.1| Mus musculus glutathione peroxidase 5, mRNA (cDNA... 42 2.1
79gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 2.1
80emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 42 2.1
81gb|BC086649.1| Mus musculus glutathione peroxidase 1, mRNA (cDNA... 42 2.1
82gb|BC062227.1| Rattus norvegicus glutathione peroxidase 3, mRNA ... 42 2.1
83gb|BC061950.1| Mus musculus glutathione peroxidase 3, mRNA (cDNA... 42 2.1
84gb|BC050378.1| Homo sapiens glutathione peroxidase 3 (plasma), m... 42 2.1
85gb|BC007865.2| Homo sapiens glutathione peroxidase 1, transcript... 42 2.1
86gb|BC049235.1| Mus musculus glutathione peroxidase 3, mRNA (cDNA... 42 2.1
87gb|BC037134.1| Mus musculus glutathione peroxidase 3, mRNA (cDNA... 42 2.1
88gb|BC037027.1| Mus musculus glutathione peroxidase 3, mRNA (cDNA... 42 2.1
89gb|BC035841.1| Homo sapiens glutathione peroxidase 3 (plasma), m... 42 2.1
90gb|BC025956.1| Homo sapiens cDNA clone IMAGE:5440952 42 2.1
91gb|BC013601.1| Homo sapiens glutathione peroxidase 3 (plasma), m... 42 2.1
92gb|BC000742.2| Homo sapiens glutathione peroxidase 1, transcript... 42 2.1
93gb|BC003339.1| Mus musculus glutathione peroxidase 3, mRNA (cDNA... 42 2.1
94gb|BC013218.1| Homo sapiens glutathione peroxidase 3 (plasma), m... 42 2.1
95gb|AC124460.5| Mus musculus BAC clone RP24-142P7 from chromosome... 42 2.1
96ref|XM_849924.1| PREDICTED: Canis familiaris similar to Plasma g... 42 2.1
97ref|XM_546297.2| PREDICTED: Canis familiaris similar to Plasma g... 42 2.1
98ref|XM_862342.1| PREDICTED: Canis familiaris similar to Plasma g... 42 2.1
99gb|BC100749.1| Mus musculus glutathione peroxidase 5, mRNA (cDNA... 42 2.1
100ref|NM_000581.2| Homo sapiens glutathione peroxidase 1 (GPX1), t... 42 2.1
101ref|NM_201397.1| Homo sapiens glutathione peroxidase 1 (GPX1), t... 42 2.1
102ref|NM_008161.1| Mus musculus glutathione peroxidase 3 (Gpx3), mRNA 42 2.1
103gb|AY327818.1| Homo sapiens glutathione peroxidase 1 (GPX1) gene... 42 2.1
104gb|AC157907.2| Mus musculus chromosome 19, clone RP23-79H21, com... 42 2.1
105gb|AY310878.1| Homo sapiens glutathione peroxidase 3 (plasma) (G... 42 2.1
106emb|Y00483.1|HSGSHPXG Human gene for gluthathione peroxidase 42 2.1
107emb|Y00433.1|HSGSHPX Human mRNA for glutathione peroxidase (EC 1... 42 2.1
108emb|X58295.1|HSGPXP Human GPx-3 mRNA for plasma glutathione pero... 42 2.1
109emb|X53780.1|MMARMEP2 Mouse mRNA for 24kDa major androgen regula... 42 2.1
110emb|X13710.1|HSPEROXP H.sapiens unspliced mRNA for glutathione p... 42 2.1
111emb|X13709.1|HSPEROXR Human gpx1 mRNA for gluthatione peroxidase 42 2.1
112emb|X03920.1|MMGSHPX M.musculus GSHPx gene 42 2.1
113emb|AJ270955.1|OSA270955 Oryza sativa mRNA for putative phosphol... 42 2.1
114emb|CR857195.1| Pongo pygmaeus mRNA; cDNA DKFZp469D1932 (from cl... 42 2.1
115emb|BX001068.7| Mouse DNA sequence from clone RP23-54E4 on chrom... 42 2.1
116emb|CR615956.1| full-length cDNA clone CS0DI066YD12 of Placenta ... 42 2.1
117emb|CR615751.1| full-length cDNA clone CS0DI025YC23 of Placenta ... 42 2.1
118emb|X84742.1|MMGPXG M.musculus GPX3 gene 42 2.1
119gb|AC009385.8| Drosophila melanogaster 3L BAC RP98-23M20 (Roswel... 42 2.1
120emb|CR626765.1| full-length cDNA clone CS0DI022YB17 of Placenta ... 42 2.1
121emb|CR626479.1| full-length cDNA clone CS0CAP001YI17 of Thymus o... 42 2.1
122emb|CR624695.1| full-length cDNA clone CS0DI081YG14 of Placenta ... 42 2.1
123emb|CR624624.1| full-length cDNA clone CS0DI068YD13 of Placenta ... 42 2.1
124emb|CR625755.1| full-length cDNA clone CS0DI056YJ21 of Placenta ... 42 2.1
125emb|CR625290.1| full-length cDNA clone CS0DI018YK21 of Placenta ... 42 2.1
126emb|CR623985.1| full-length cDNA clone CS0DI016YC06 of Placenta ... 42 2.1
127emb|CR623984.1| full-length cDNA clone CS0DE006YH10 of Placenta ... 42 2.1
128emb|CR623805.1| full-length cDNA clone CS0DI033YB05 of Placenta ... 42 2.1
129emb|CR623606.1| full-length cDNA clone CS0DE007YN18 of Placenta ... 42 2.1
130emb|CR623599.1| full-length cDNA clone CS0DI026YB02 of Placenta ... 42 2.1
131emb|CR623261.1| full-length cDNA clone CS0DI060YJ04 of Placenta ... 42 2.1
132emb|CR623260.1| full-length cDNA clone CS0DI060YJ06 of Placenta ... 42 2.1
133emb|CR622704.1| full-length cDNA clone CS0DI078YJ19 of Placenta ... 42 2.1
134emb|CR621904.1| full-length cDNA clone CS0DE003YH14 of Placenta ... 42 2.1
135emb|CR621477.1| full-length cDNA clone CS0DI035YD05 of Placenta ... 42 2.1
136emb|CR621207.1| full-length cDNA clone CS0DN001YF06 of Adult bra... 42 2.1
137emb|CR620255.1| full-length cDNA clone CS0DD004YA07 of Neuroblas... 42 2.1
138emb|CR620123.1| full-length cDNA clone CS0DI005YK23 of Placenta ... 42 2.1
139emb|CR619761.1| full-length cDNA clone CS0DM007YA24 of Fetal liv... 42 2.1
140emb|CR618652.1| full-length cDNA clone CS0DI011YJ21 of Placenta ... 42 2.1
141emb|CR618599.1| full-length cDNA clone CS0DI004YN07 of Placenta ... 42 2.1
142emb|CR617790.1| full-length cDNA clone CS0DN003YI16 of Adult bra... 42 2.1
143emb|CR617470.1| full-length cDNA clone CS0DI034YO05 of Placenta ... 42 2.1
144emb|CR616153.1| full-length cDNA clone CS0DI062YB14 of Placenta ... 42 2.1
145emb|CR615996.1| full-length cDNA clone CS0DI082YN21 of Placenta ... 42 2.1
146emb|CR615361.1| full-length cDNA clone CS0DD001YE17 of Neuroblas... 42 2.1
147emb|CR615321.1| full-length cDNA clone CS0DI003YM04 of Placenta ... 42 2.1
148emb|CR614747.1| full-length cDNA clone CS0DI086YP09 of Placenta ... 42 2.1
149emb|CR614185.1| full-length cDNA clone CS0DC007YG13 of Neuroblas... 42 2.1
150emb|CR613980.1| full-length cDNA clone CS0DI052YK21 of Placenta ... 42 2.1
151emb|CR612224.1| full-length cDNA clone CS0DI055YA13 of Placenta ... 42 2.1
152emb|CR612204.1| full-length cDNA clone CS0DD001YH04 of Neuroblas... 42 2.1
153emb|CR613346.1| full-length cDNA clone CS0DI041YL20 of Placenta ... 42 2.1
154emb|CR613209.1| full-length cDNA clone CS0DI022YB21 of Placenta ... 42 2.1
155emb|CR610586.1| full-length cDNA clone CS0DI083YL07 of Placenta ... 42 2.1
156emb|CR609961.1| full-length cDNA clone CS0DN002YE24 of Adult bra... 42 2.1
157emb|CR608662.1| full-length cDNA clone CS0DE011YH16 of Placenta ... 42 2.1
158emb|CR607596.1| full-length cDNA clone CS0DC006YC07 of Neuroblas... 42 2.1
159emb|CR606740.1| full-length cDNA clone CS0DI086YD09 of Placenta ... 42 2.1
160emb|CR605862.1| full-length cDNA clone CS0DI010YG15 of Placenta ... 42 2.1
161gb|AC009380.6| Drosophila melanogaster 3L BAC RP98-17L5 (Roswell... 42 2.1
162emb|CR603874.1| full-length cDNA clone CS0DI073YI23 of Placenta ... 42 2.1
163emb|CR602168.1| full-length cDNA clone CS0DB004YP22 of Neuroblas... 42 2.1
164emb|CR601795.1| full-length cDNA clone CS0DI068YJ17 of Placenta ... 42 2.1
165emb|CR601731.1| full-length cDNA clone CS0DI027YA05 of Placenta ... 42 2.1
166emb|CR601235.1| full-length cDNA clone CS0DI004YH05 of Placenta ... 42 2.1
167emb|CR600420.1| full-length cDNA clone CS0DF015YJ07 of Fetal bra... 42 2.1
168emb|CR599819.1| full-length cDNA clone CS0DM006YE09 of Fetal liv... 42 2.1
169emb|CR599527.1| full-length cDNA clone CS0DE008YL19 of Placenta ... 42 2.1
170emb|CR599488.1| full-length cDNA clone CS0DI057YL15 of Placenta ... 42 2.1
171emb|CR599318.1| full-length cDNA clone CS0DM006YG13 of Fetal liv... 42 2.1
172emb|CR598855.1| full-length cDNA clone CS0DI016YK01 of Placenta ... 42 2.1
173emb|CR598624.1| full-length cDNA clone CS0DI011YM22 of Placenta ... 42 2.1
174emb|CR598094.1| full-length cDNA clone CS0DI084YG03 of Placenta ... 42 2.1
175emb|CR597736.1| full-length cDNA clone CS0DI083YH04 of Placenta ... 42 2.1
176emb|CR597434.1| full-length cDNA clone CS0DI043YL12 of Placenta ... 42 2.1
177emb|CR597297.1| full-length cDNA clone CS0DI021YG02 of Placenta ... 42 2.1
178emb|CR596721.1| full-length cDNA clone CS0DM009YI05 of Fetal liv... 42 2.1
179emb|CR596498.1| full-length cDNA clone CS0DI064YH11 of Placenta ... 42 2.1
180emb|CR595371.1| full-length cDNA clone CS0DC025YE23 of Neuroblas... 42 2.1
181emb|CR594135.1| full-length cDNA clone CS0DI079YO10 of Placenta ... 42 2.1
182emb|CR594536.1| full-length cDNA clone CS0DI017YJ20 of Placenta ... 42 2.1
183emb|CR593150.1| full-length cDNA clone CS0DI062YE07 of Placenta ... 42 2.1
184emb|CR592896.1| full-length cDNA clone CS0DI022YN18 of Placenta ... 42 2.1
185emb|CR591749.1| full-length cDNA clone CS0DI023YK02 of Placenta ... 42 2.1
186emb|CR591707.1| full-length cDNA clone CS0DM012YM01 of Fetal liv... 42 2.1
187emb|CR591549.1| full-length cDNA clone CS0DI025YG07 of Placenta ... 42 2.1
188ref|NM_002084.3| Homo sapiens glutathione peroxidase 3 (plasma) ... 42 2.1
189emb|CR591367.1| full-length cDNA clone CS0DI001YD20 of Placenta ... 42 2.1
190emb|CR591081.1| full-length cDNA clone CS0DE013YL14 of Placenta ... 42 2.1
191emb|CR590594.1| full-length cDNA clone CS0DC006YK10 of Neuroblas... 42 2.1
192emb|CR590253.1| full-length cDNA clone CS0DI032YM13 of Placenta ... 42 2.1
193gb|AY077655.1| Arabidopsis thaliana AT4g11600/T5C23_30 mRNA, com... 42 2.1
194dbj|AK146760.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu... 42 2.1
195dbj|AK154833.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 42 2.1
196dbj|AK150548.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 42 2.1
197dbj|AK160388.1| Mus musculus adult male kidney cDNA, RIKEN full-... 42 2.1
198emb|CR407475.1| Gallus gallus finished cDNA, clone ChEST136c12 42 2.1
199dbj|AK010999.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 42 2.1
200dbj|AK029731.1| Mus musculus adult male testis cDNA, RIKEN full-... 42 2.1
201gb|AC008641.7| Homo sapiens chromosome 5 clone CTB-17P3, complet... 42 2.1
202gb|M83094.1|HUMGLPEX Homo sapiens cytosolic selenium-dependent g... 42 2.1
203dbj|AK006161.1| Mus musculus adult male testis cDNA, RIKEN full-... 42 2.1
204gb|U13705.1|MMU13705 Mus musculus domesticus C57BL/6J plasma glu... 42 2.1
205gb|M21304.1|HUMGLP Human glutathione peroxidase (GPX1) mRNA, com... 42 2.1
206gb|AY039863.1| Arabidopsis thaliana AT4g11600/T5C23_30 mRNA, com... 42 2.1
207dbj|AK002219.1| Mus musculus adult male kidney cDNA, RIKEN full-... 42 2.1
208dbj|AK002262.1| Mus musculus adult male kidney cDNA, RIKEN full-... 42 2.1
209dbj|AK002245.1| Mus musculus adult male kidney cDNA, RIKEN full-... 42 2.1
210dbj|AK028171.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 42 2.1
211dbj|AK004942.1| Mus musculus adult male liver cDNA, RIKEN full-l... 42 2.1
212dbj|AK033841.1| Mus musculus adult male epididymis cDNA, RIKEN f... 42 2.1
213emb|BX931521.2| Gallus gallus finished cDNA, clone ChEST388k4 42 2.1
214dbj|AK011019.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 42 2.1
215dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
216dbj|AB121009.1| Cebus apella gpx3 mRNA for glutathione peroxidas... 42 2.1
217dbj|AB121008.1| Macaca fuscata gpx3 mRNA for glutathione peroxid... 42 2.1
218dbj|AB121007.1| Hylobates lar gpx3 mRNA for glutathione peroxida... 42 2.1
219dbj|AB121006.1| Pongo pygmaeus gpx3 mRNA for glutathione peroxid... 42 2.1
220dbj|AB120999.1| Cebus apella gpx1 mRNA for glutathione peroxidas... 42 2.1
221dbj|AB120998.1| Hylobates lar gpx1 mRNA for glutathione peroxida... 42 2.1
222dbj|AB120997.1| Pongo pygmaeus gpx1 mRNA for glutathione peroxid... 42 2.1
223gb|AC008666.5|AC008666 Homo sapiens chromosome 5 clone CTB-35A8,... 42 2.1
224emb|BX826695.1|CNS0A40O Arabidopsis thaliana Full-length cDNA Co... 42 2.1
225ref|NM_147165.1| Rattus norvegicus glutathione peroxidase 6 (Gpx... 42 2.1
226ref|NM_022525.2| Rattus norvegicus glutathione peroxidase 3 (Gpx... 42 2.1
227gb|AF217787.1|AF217787 Homo sapiens extracellular glutathione pe... 42 2.1
228emb|BX931419.1| Gallus gallus finished cDNA, clone ChEST335o15 42 2.1
229gb|AC019057.8| Homo sapiens BAC clone RP11-121A1 from 2, complet... 42 2.1
230gb|AY088647.1| Arabidopsis thaliana clone 8846 mRNA, complete se... 42 2.1
231gb|AC137076.1| Genomic sequence for Oryza sativa, Nipponbare str... 42 2.1
232dbj|AK190707.1| Mus musculus cDNA, clone:Y1G0103J01, strand:plus... 42 2.1
233emb|BX088649.8| Zebrafish DNA sequence from clone CH211-204M6 in... 42 2.1
234dbj|BS000214.2| Pan troglodytes chromosome 22 clone:RP43-036K01,... 42 2.1
235emb|AL593846.15| Mouse DNA sequence from clone RP23-171H16 on ch... 42 2.1
236dbj|AB001568.1| Arabidopsis thaliana mRNA for phospholipid hydro... 42 2.1
237gb|AC121247.2| Homo sapiens chromosome 3 clone RP11-3B7, complet... 42 2.1
238dbj|AK130160.1| Homo sapiens cDNA FLJ26650 fis, clone MPE04848, ... 42 2.1
239ref|NM_145451.1| Mus musculus glutathione peroxidase 6 (Gpx6), mRNA 42 2.1
240dbj|AK073938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.1
241gb|AY104663.1| Zea mays PCO114914 mRNA sequence 42 2.1
242gb|AE003519.3| Drosophila melanogaster chromosome 3L, section 66... 42 2.1
243gb|BC088710.1| Xenopus laevis hypothetical LOC496242, mRNA (cDNA... 42 2.1
244gb|AF030132.1|AF030132 Arabidopsis thaliana glutathione peroxida... 42 2.1
245gb|AF045185.1|AF045185 Canis familiaris epididymis-specific secr... 42 2.1
246emb|AM159087.1| Plantago major mRNA for glutathion peroxidase (g... 42 2.1
247gb|M76733.1|RATRY2D1A Rat odorant-metabolizing protein (RY2D1) m... 42 2.1
248gb|M68896.1|MUSGPOAD Mouse androgen-dependent glutathione peroxi... 42 2.1
249dbj|D00680.1|RATPGP Rattus norvegicus mRNA for plasma glutathion... 42 2.1
250dbj|D16362.1|HUMGPXP3 Homo sapiens DNA for plasma glutathione pe... 42 2.1
251dbj|D00632.1|HUMGSHPXA Homo sapiens mRNA for glutathione peroxid... 42 2.1
252ref|XM_522880.1| PREDICTED: Pan troglodytes similar to Glutathio... 40 8.4
253gb|AC114653.11| Mus musculus chromosome 5, clone RP24-158G19, co... 40 8.4
254gb|AY785560.1| Homo sapiens glutathione peroxidase 2 (gastrointe... 40 8.4
255gb|AY622862.1| Oncorhynchus mykiss glutathione peroxidase type 2... 40 8.4
256gb|AC164980.3| Mus musculus BAC clone RP23-184C3 from chromosome... 40 8.4
257gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ... 40 8.4
258gb|AC166326.2| Mus musculus BAC clone RP23-259L9 from chromosome... 40 8.4
259gb|AY674186.1| Ixodes pacificus clone F12_IPL_P23 truncated glut... 40 8.4
260gb|BC074251.1| Xenopus laevis MGC84001 protein, mRNA (cDNA clone... 40 8.4
261ref|XM_428816.1| PREDICTED: Gallus gallus similar to feminizatio... 40 8.4
262ref|NM_002083.2| Homo sapiens glutathione peroxidase 2 (gastroin... 40 8.4
263gb|AC183678.2| Pan troglodytes BAC clone CH251-485O9 from chromo... 40 8.4
264ref|XM_612375.2| PREDICTED: Bos taurus similar to Glutathione pe... 40 8.4
265gb|AC132331.3| Mus musculus BAC clone RP24-217D10 from chromosom... 40 8.4
266gb|AY625510.1| Glossina morsitans morsitans clone Gmm0092 putati... 40 8.4
267gb|BC066825.1| Mus musculus glutathione peroxidase 2, mRNA (cDNA... 40 8.4
268gb|AC167332.2| Mus musculus BAC clone RP24-165A19 from chromosom... 40 8.4
269gb|AY541694.1| Setaria italica phospholipid-hydroperoxide glutat... 40 8.4
270gb|AC183669.3| Pan troglodytes BAC clone CH251-549L23 from chrom... 40 8.4
271gb|AC134790.6| Mus musculus chromosome 15, clone RP24-541O5, com... 40 8.4
272gb|AC146699.5| Mus musculus chromosome 6, clone RP24-211G11, com... 40 8.4
273emb|CR925863.7| Zebrafish DNA sequence from clone DKEY-184N1 in ... 40 8.4
274gb|BC016756.1| Homo sapiens glutathione peroxidase 2 (gastrointe... 40 8.4
275gb|BC005277.1| Homo sapiens glutathione peroxidase 2 (gastrointe... 40 8.4
276gb|BC067221.1| Homo sapiens glutathione peroxidase 2 (gastrointe... 40 8.4
277gb|BC054848.1| Mus musculus glutathione peroxidase 2, mRNA (cDNA... 40 8.4
278gb|BC022820.1| Homo sapiens glutathione peroxidase 2 (gastrointe... 40 8.4
279gb|BC039658.1| Mus musculus glutathione peroxidase 2, mRNA (cDNA... 40 8.4
280gb|BC034335.1| Mus musculus glutathione peroxidase 2, mRNA (cDNA... 40 8.4
281gb|BC010823.1| Mus musculus glutathione peroxidase 2, mRNA (cDNA... 40 8.4
282gb|AC122241.4| Mus musculus BAC clone RP23-146M20 from chromosom... 40 8.4
283gb|AC116953.5| Mus musculus BAC clone RP23-119H17 from chromosom... 40 8.4
284emb|Z81015.1|CEC11E4 Caenorhabditis elegans Cosmid C11E4, comple... 40 8.4
285gb|AC130208.3| Mus musculus BAC clone RP24-352L7 from chromosome... 40 8.4
286ref|XM_537480.2| PREDICTED: Canis familiaris similar to Glutathi... 40 8.4
287emb|CR724927.2|CNS0GMAT Tetraodon nigroviridis full-length cDNA 40 8.4
288emb|CR721600.2|CNS0GJQE Tetraodon nigroviridis full-length cDNA 40 8.4
289emb|CR721212.2|CNS0GJFM Tetraodon nigroviridis full-length cDNA 40 8.4
290emb|CR721206.2|CNS0GJFG Tetraodon nigroviridis full-length cDNA 40 8.4
291emb|CR720520.2|CNS0GIWE Tetraodon nigroviridis full-length cDNA 40 8.4
292emb|CR719606.2|CNS0GI70 Tetraodon nigroviridis full-length cDNA 40 8.4
293emb|CR705310.2|CNS0G762 Tetraodon nigroviridis full-length cDNA 40 8.4
294ref|XM_847040.1| PREDICTED: Canis familiaris similar to junction... 40 8.4
295emb|CR671758.2|CNS0FHAS Tetraodon nigroviridis full-length cDNA 40 8.4
296ref|XM_667418.1| Plasmodium berghei strain ANKA hypothetical pro... 40 8.4
297gb|AC122269.4| Mus musculus chromosome 7 clone RP23-220G20, comp... 40 8.4
298gb|AC149806.16| Medicago truncatula clone mth2-150h12, complete ... 40 8.4
299emb|X07365.1|RNGSH Rat mRNA for glutathione peroxidase 40 8.4
300emb|AL928717.5| Human DNA sequence from clone RP11-363G10 on chr... 40 8.4
301emb|AL596179.3| Human DNA sequence from clone RP11-49A12 on chro... 40 8.4
302emb|AL354992.7| Human DNA sequence from clone RP11-293A1 on chro... 40 8.4
303emb|AL162456.14| Human DNA sequence from clone RP11-95C14 on chr... 40 8.4
304gb|AC092943.5| Homo sapiens 3 BAC RP11-564C24 (Roswell Park Canc... 40 8.4
305emb|X68314.1|HSGPGI H.sapiens mRNA for glutathione peroxidase-GI 40 8.4
306emb|X53463.1|HSGPLP Human mRNA for glutathione peroxidase-like p... 40 8.4
307emb|X12367.1|RNGPXIMR R.norvegicus mRNA for glutathione peroxida... 40 8.4
308gb|AC166356.1| Mus musculus BAC clone RP23-410F8 from chromosome... 40 8.4
309emb|BX957223.1| Methanococcus maripaludis S2 complete genome; se... 40 8.4
310emb|BX957219.1| Methanococcus maripaludis S2 complete genome; se... 40 8.4
311gb|AC157815.9| Mus musculus chromosome 3, clone RP24-175G5, comp... 40 8.4
312ref|NM_203630.1| Xenopus tropicalis glutathione peroxidase 3 (gp... 40 8.4
313emb|AL691468.12| Mouse DNA sequence from clone RP23-20K13 on chr... 40 8.4
314emb|AJ250951.1|MCR250951 Mesembryanthemum crystallinum mRNA for ... 40 8.4
315gb|BC066949.1| Homo sapiens glutathione peroxidase 3 (plasma), m... 40 8.4
316emb|AL732599.5| Mouse DNA sequence from clone RP24-312B5 on chro... 40 8.4
317emb|X91864.1|MMGPX2PS1 M.musculus DNA for Gpx2 pseudogene 40 8.4
318emb|CR857983.1| Pongo pygmaeus mRNA; cDNA DKFZp470K1222 (from cl... 40 8.4
319gb|AC123980.19| Pan troglodytes clone rp43-118j16, complete sequ... 40 8.4
320gb|AC008788.5| Homo sapiens chromosome 5 clone CTD-2039A19, comp... 40 8.4
321gb|AC022016.7| Homo sapiens chromosome 10 clone RP11-165M8, comp... 40 8.4
322gb|AC002335.3| Arabidopsis thaliana chromosome 2 clone T1O24 map... 40 8.4
323dbj|AK131940.1| Mus musculus ES cells cDNA, RIKEN full-length en... 40 8.4
324ref|NM_030826.2| Rattus norvegicus glutathione peroxidase 1 (Gpx... 40 8.4
325ref|NG_004788.1| Homo sapiens cofilin pseudogene 1 (CFLP1) on ch... 40 8.4
326gb|AF346906.1|AF346906 Momordica charantia phospholipid hydroper... 40 8.4
327gb|AC074254.4| Homo sapiens BAC clone RP11-784D7 from 4, complet... 40 8.4
328gb|M26130.1|STRSTRA S. parasanguis adhesin (fimA), ORF1, ORF3, a... 40 8.4
329gb|AF366451.1|AF366451 Allium cepa clone AGF166 maintainer line ... 40 8.4
330emb|BX248323.8| Zebrafish DNA sequence from clone CH211-199J6, c... 40 8.4
331gb|S50336.1| Rattus norvegicus glutathione peroxidase gene, comp... 40 8.4
332gb|S41066.1|S41066 Rattus norvegicus selenium-dependent glutathi... 40 8.4
333ref|NM_077215.1| Caenorhabditis elegans C11E4.2 (C11E4.2) mRNA, ... 40 8.4
334dbj|AK048555.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 8.4
335ref|NG_001377.1| Mus musculus glutathione peroxidase 2, pseudoge... 40 8.4
336gb|AC119995.22| Mus musculus chromosome 3, clone RP24-120B18, co... 40 8.4
337gb|AC155656.10| Mus musculus 6 BAC RP24-67I3 (Roswell Park Cance... 40 8.4
338dbj|AB121004.1| Cebus apella gpx2 mRNA for glutathione peroxidas... 40 8.4
339dbj|AB121003.1| Macaca fuscata gpx2 mRNA for glutathione peroxid... 40 8.4
340dbj|AB121002.1| Hylobates lar gpx2 mRNA for glutathione peroxida... 40 8.4
341dbj|AB121001.1| Pongo pygmaeus gpx2 mRNA for glutathione peroxid... 40 8.4
342gb|BC058438.1| Rattus norvegicus glutathione peroxidase 1, mRNA ... 40 8.4
343gb|AC097717.3| Homo sapiens BAC clone RP11-650N19 from 2, comple... 40 8.4
344gb|AC011361.4|AC011361 Homo sapiens chromosome 5 clone CTC-482N1... 40 8.4
345gb|M21210.1|RATGSHPX Rattus norvegicus glutathione peroxidase (G... 40 8.4
346gb|AF199441.1|AF199441 Homo sapiens gastrointestinal glutathione... 40 8.4
347gb|AC010478.5|AC010478 Homo sapiens chromosome 5 clone CTD-2314G... 40 8.4
348gb|AF099176.1|AF099176 Ateles belzebuth chamek glutathione perox... 40 8.4
349emb|AL731764.11| Mouse DNA sequence from clone RP23-75F12 on chr... 40 8.4
350gb|AY890813.1| Synthetic construct Homo sapiens clone FLH021710.... 40 8.4
351gb|AY890812.1| Synthetic construct Homo sapiens clone FLH021709.... 40 8.4
352emb|AJ242664.1|SBR242664 Solanum brevidens mcpi gene for metallo... 40 8.4
353ref|XM_312512.2| Anopheles gambiae str. PEST ENSANGP00000001168 ... 40 8.4
354emb|AL132898.2|CEY59A8B Caenorhabditis elegans YAC Y59A8B, compl... 40 8.4
355emb|BX908385.10| Zebrafish DNA sequence from clone CH211-282N12 ... 40 8.4
356emb|BX936304.7| Zebrafish DNA sequence from clone CH211-206G24 i... 40 8.4
357gb|AC157510.1| Dasypus novemcinctus, clone Dasypus novemcinctus-... 40 8.4
358gb|U62658.1|MMU62658 Mus musculus glutathione peroxidase (Gpx2) ... 40 8.4
359gb|AF116532.1|AF116532 Streptococcus parasanguinis endopeptidase... 40 8.4
360gb|AC007157.6|AC007157 Homo sapiens, clone hRPK.78_A_1, complete... 40 8.4
361emb|CR761198.2| Xenopus tropicalis finished cDNA, clone TEgg002n06 40 8.4
362emb|AL139022.4|CNS01DX4 Human chromosome 14 DNA sequence BAC R-8... 40 8.4
363dbj|AP000926.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 8.4
364dbj|AP001970.3| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 8.4
365emb|CR788257.9| Zebrafish DNA sequence from clone DKEY-244H24 in... 40 8.4
366ref|NM_183403.1| Rattus norvegicus glutathione peroxidase 2 (Gpx... 40 8.4
367gb|AC137708.16| Mus musculus chromosome 3, clone RP24-277H8, com... 40 8.4
368gb|BC046164.1| Homo sapiens cDNA clone IMAGE:5182669, containing... 40 8.4
369gb|BC039850.1| Homo sapiens cDNA clone IMAGE:5761158, containing... 40 8.4
370ref|NM_030677.1| Mus musculus glutathione peroxidase 2 (Gpx2), mRNA 40 8.4
371gb|BC061262.1| Xenopus tropicalis glutathione peroxidase 3, mRNA... 40 8.4
372gb|AC121815.4| Mus musculus BAC clone RP23-458C8 from 7, complet... 40 8.4
373gb|AY734530.1| Oplegnathus fasciatus glutathione peroxidase mRNA... 40 8.4
374gb|AC123821.4| Mus musculus BAC clone RP23-466F9 from chromosome... 40 8.4
375emb|AJ249277.1|MMU249277 Mus musculus partial gpx2 gene for glut... 40 8.4
376emb|AL606746.17| Mouse DNA sequence from clone RP23-423J10 on ch... 40 8.4
377emb|AL732478.7| Mouse DNA sequence from clone RP23-42N14 on chro... 40 8.4
378emb|X91863.1|HSGPX2GEN H.sapiens Gpx2 gene 40 8.4
379emb|AL691485.9| Mouse DNA sequence from clone RP23-26D14 on chro... 40 8.4

>gb|AF053311.1|AF053311 Zantedeschia aethiopica glutathione peroxidase (gpx) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 1110

 Score =  226 bits (114), Expect = 7e-56
 Identities = 348/426 (81%)
 Strand = Plus / Minus

                                                                       
Query: 190 atgccgcgacgagtttctggatgtccttctcaatttggaatggtgaagttgttggtgggt 249
           |||| ||||| ||||||  |||||| |||||||| ||||| || || ||||||||||| |
Sbjct: 778 atgcagcgaccagtttcctgatgtctttctcaatctggaagggggatgttgttggtggat 719

                                                                       
Query: 250 atctctccacaactttgccatttttgtccactaggaacttctcaaagttccacttcacta 309
           |||||||||| ||||||||||||||||| || ||||| ||||||||||||||||| |  |
Sbjct: 718 atctctccacgactttgccatttttgtcaaccaggaatttctcaaagttccactttatga 659

                                                                       
Query: 310 tatcacccaaaaatcctccagcactcgacttaagaaacttataaataggggctgtaaatg 369
            ||||||||  |||||||||||||| ||||||||||| | ||| |  || |||||   ||
Sbjct: 658 gatcacccaggaatcctccagcactggacttaagaaattgatatactggagctgtttttg 599

                                                                       
Query: 370 gtccattgacatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaagcaa 429
           |||| |||||||||||||| ||||||||||| |||||||||||||||||||| || ||||
Sbjct: 598 gtccgttgacatcaaccttgtcaaaaatagggaattcagctttaaaccttgtgcatgcaa 539

                                                                       
Query: 430 attgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcatggaaacg 489
           | || ||||| | ||  |||| |||||| ||||||   ||||| || ||||| || || |
Sbjct: 538 actgttttatttctgagtttgttccaggctcttgactcccaaactggttgcaagggaatg 479

                                                                       
Query: 490 ctagaatctcaaacccttgagtcttgtacttctcgtaaagatgagatagctcagtgtaat 549
           | || |||||||| |||||||| ||||| ||||| || |  ||||| || ||  ||||||
Sbjct: 478 ccaggatctcaaatccttgagttttgtatttctcatagatgtgagaaagttccatgtaat 419

                                                                       
Query: 550 ttgctgttgtaagcccacattgagaagcaacattaacaatcaacagtgcttttcccttga 609
           | | |||||| |  ||||||   ||||||||||| |||||||| |   ||||||||||||
Sbjct: 418 tggatgttgttaagccacatcttgaagcaacattgacaatcaataaaacttttcccttga 359

                 
Query: 610 acttgc 615
           | ||||
Sbjct: 358 atttgc 353



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  204 bits (103), Expect = 2e-49
 Identities = 136/147 (92%)
 Strand = Plus / Minus

                                                                           
Query: 218     ctcaatttggaatggtgaagttgttggtgggtatctctccacaactttgccatttttgtc 277
               |||||| ||||||||||||||||| |||||||||||||| |||||||| ||| |||||||
Sbjct: 4334404 ctcaatctggaatggtgaagttgtaggtgggtatctctcaacaacttttccagttttgtc 4334345

                                                                           
Query: 278     cactaggaacttctcaaagttccacttcactatatcacccaaaaatcctccagcactcga 337
               ||| | |||||||||||| ||||| ||||| | |||||||||||||||||||||||||||
Sbjct: 4334344 caccaagaacttctcaaaattccatttcacaagatcacccaaaaatcctccagcactcga 4334285

                                          
Query: 338     cttaagaaacttataaataggggctgt 364
               |||||||||||||||||||||||||||
Sbjct: 4334284 cttaagaaacttataaataggggctgt 4334258



 Score =  125 bits (63), Expect = 2e-25
 Identities = 105/119 (88%)
 Strand = Plus / Minus

                                                                           
Query: 384     accttatcaaaaataggaaattcagctttaaaccttgtacaagcaaattgctttatctgt 443
               ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||| 
Sbjct: 4334136 accttgtcaaaaataggaaattcagctttaaaccttgtacaagcaaactgcttaatctgc 4334077

                                                                          
Query: 444     gtatttgatccaggttcttgaaaaccaaattgattgcatggaaacgctagaatctcaaa 502
               |  ||||| |||||||||||   |||||| |||||||| ||||| || |||||||||||
Sbjct: 4334076 gggtttgacccaggttcttgtgcaccaaactgattgcaaggaaatgcaagaatctcaaa 4334018



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 60/64 (93%)
 Strand = Plus / Minus

                                                                           
Query: 504     ccttgagtcttgtacttctcgtaaagatgagatagctcagtgtaatttgctgttgtaagc 563
               |||||||||||||||||||| |||||||||||||| || ||||||||||||||||| |||
Sbjct: 4333836 ccttgagtcttgtacttctcataaagatgagatagttccgtgtaatttgctgttgtcagc 4333777

                   
Query: 564     ccac 567
               ||||
Sbjct: 4333776 ccac 4333773



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                    
Query: 183     agtacttatgccgcgacgagtttctggatgtccttct 219
               |||||||||||||| | ||||||||||||||||||||
Sbjct: 4335674 agtacttatgccgcaaggagtttctggatgtccttct 4335638



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                             
Query: 570     tgagaagcaacattaacaatcaacagtgcttttcccttgaacttgc 615
               ||||| |||||||||||||| | ||| ||  |||||||||||||||
Sbjct: 4333661 tgagatgcaacattaacaattagcagcgcccttcccttgaacttgc 4333616



to top

>dbj|AP003489.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0568D10
          Length = 63101

 Score =  204 bits (103), Expect = 2e-49
 Identities = 136/147 (92%)
 Strand = Plus / Minus

                                                                         
Query: 218   ctcaatttggaatggtgaagttgttggtgggtatctctccacaactttgccatttttgtc 277
             |||||| ||||||||||||||||| |||||||||||||| |||||||| ||| |||||||
Sbjct: 25984 ctcaatctggaatggtgaagttgtaggtgggtatctctcaacaacttttccagttttgtc 25925

                                                                         
Query: 278   cactaggaacttctcaaagttccacttcactatatcacccaaaaatcctccagcactcga 337
             ||| | |||||||||||| ||||| ||||| | |||||||||||||||||||||||||||
Sbjct: 25924 caccaagaacttctcaaaattccatttcacaagatcacccaaaaatcctccagcactcga 25865

                                        
Query: 338   cttaagaaacttataaataggggctgt 364
             |||||||||||||||||||||||||||
Sbjct: 25864 cttaagaaacttataaataggggctgt 25838



 Score =  125 bits (63), Expect = 2e-25
 Identities = 105/119 (88%)
 Strand = Plus / Minus

                                                                         
Query: 384   accttatcaaaaataggaaattcagctttaaaccttgtacaagcaaattgctttatctgt 443
             ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||| 
Sbjct: 25716 accttgtcaaaaataggaaattcagctttaaaccttgtacaagcaaactgcttaatctgc 25657

                                                                        
Query: 444   gtatttgatccaggttcttgaaaaccaaattgattgcatggaaacgctagaatctcaaa 502
             |  ||||| |||||||||||   |||||| |||||||| ||||| || |||||||||||
Sbjct: 25656 gggtttgacccaggttcttgtgcaccaaactgattgcaaggaaatgcaagaatctcaaa 25598



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 60/64 (93%)
 Strand = Plus / Minus

                                                                         
Query: 504   ccttgagtcttgtacttctcgtaaagatgagatagctcagtgtaatttgctgttgtaagc 563
             |||||||||||||||||||| |||||||||||||| || ||||||||||||||||| |||
Sbjct: 25416 ccttgagtcttgtacttctcataaagatgagatagttccgtgtaatttgctgttgtcagc 25357

                 
Query: 564   ccac 567
             ||||
Sbjct: 25356 ccac 25353



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                  
Query: 183   agtacttatgccgcgacgagtttctggatgtccttct 219
             |||||||||||||| | ||||||||||||||||||||
Sbjct: 27254 agtacttatgccgcaaggagtttctggatgtccttct 27218



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                           
Query: 570   tgagaagcaacattaacaatcaacagtgcttttcccttgaacttgc 615
             ||||| |||||||||||||| | ||| ||  |||||||||||||||
Sbjct: 25241 tgagatgcaacattaacaattagcagcgcccttcccttgaacttgc 25196



to top

>emb|AJ000508.1|PSPGLUPER Pisum sativum mRNA for phospholipid glutathione peroxidase
          Length = 936

 Score =  174 bits (88), Expect = 2e-40
 Identities = 241/292 (82%)
 Strand = Plus / Minus

                                                                       
Query: 204 ttctggatgtccttctcaatttggaatggtgaagttgttggtgggtatctctccacaact 263
           |||||||| |||||||||||||| || || || ||||||||||||||||| || ||||||
Sbjct: 723 ttctggatatccttctcaatttgaaaaggagaggttgttggtgggtatctttcaacaact 664

                                                                       
Query: 264 ttgccatttttgtccactaggaacttctcaaagttccacttcactatatcacccaaaaat 323
           || |||||||| || || | ||| ||||| || |||||||| || |||||||| ||||| 
Sbjct: 663 ttaccatttttatcaaccaagaatttctcgaaattccacttgacaatatcaccgaaaaag 604

                                                                       
Query: 324 cctccagcactcgacttaagaaacttataaataggggctgtaaatggtccattgacatca 383
           || |||| ||| || || |||||||  || |  || || |||||||||||||| ||||||
Sbjct: 603 cccccagaacttgatttcagaaactggtatactggagcagtaaatggtccatttacatca 544

                                                                       
Query: 384 accttatcaaaaataggaaattcagctttaaaccttgtacaagcaaattgctttatctgt 443
           |||||||||||||| |||||||| ||||| ||| | || |||||||||||||| || | |
Sbjct: 543 accttatcaaaaattggaaattctgctttgaacttagtgcaagcaaattgcttaatttct 484

                                                               
Query: 444 gtatttgatccaggttcttgaaaaccaaattgattgcatggaaacgctagaa 495
             |||||||||||| || || |  |||||||||||||| || || |||||||
Sbjct: 483 tcatttgatccaggctcctgcatgccaaattgattgcaagggaaagctagaa 432



to top

>ref|NM_119337.2| Arabidopsis thaliana ATGPX7 (GLUTATHIONE PEROXIDASE 7); glutathione
           peroxidase AT4G31870 (ATGPX7) mRNA, complete cds
          Length = 702

 Score =  145 bits (73), Expect = 2e-31
 Identities = 280/349 (80%)
 Strand = Plus / Minus

                                                                       
Query: 204 ttctggatgtccttctcaatttggaatggtgaagttgttggtgggtatctctccacaact 263
           ||||||||||||||||| |||||||| || |||||||| || ||||||||||| ||||||
Sbjct: 686 ttctggatgtccttctcgatttggaaaggagaagttgtgggagggtatctctcgacaact 627

                                                                       
Query: 264 ttgccatttttgtccactaggaacttctcaaagttccacttcactatatcacccaaaaat 323
           ||||| ||||| || || | ||| |||||||||||||| || |  |||||||| |  || 
Sbjct: 626 ttgccctttttatcaaccaagaatttctcaaagttccatttgatgatatcaccaaggaaa 567

                                                                       
Query: 324 cctccagcactcgacttaagaaacttataaataggggctgtaaatggtccattgacatca 383
           || |||||| | || || |  ||||| || || || |||||   ||||||||| ||||||
Sbjct: 566 ccaccagcattggatttcaagaacttgtagattggagctgtgcttggtccattcacatca 507

                                                                       
Query: 384 accttatcaaaaataggaaattcagctttaaaccttgtacaagcaaattgctttatctgt 443
           ||||| || || ||||| || || ||||| ||||  || |||||||||||||| ||||  
Sbjct: 506 accttgtcgaatatagggaactctgctttgaaccgggtgcaagcaaattgcttgatctca 447

                                                                       
Query: 444 gtatttgatccaggttcttgaaaaccaaattgattgcatggaaacgctagaatctcaaac 503
           |  ||||| || |||||||||   |||||||||||||| || || || ||||||||||| 
Sbjct: 446 gggtttgaaccgggttcttgacctccaaattgattgcaagggaaagcaagaatctcaaat 387

                                                            
Query: 504 ccttgagtcttgtacttctcgtaaagatgagatagctcagtgtaatttg 552
           |||||  ||||||| || ||||| || ||||| ||||| | ||||||||
Sbjct: 386 ccttggttcttgtatttttcgtacagttgagaaagctctgagtaatttg 338



to top

>ref|NM_128065.2| Arabidopsis thaliana ATGPX1 (GLUTATHIONE PEROXIDASE 1); glutathione
           peroxidase AT2G25080 (ATGPX1) mRNA, complete cds
          Length = 969

 Score =  133 bits (67), Expect = 8e-28
 Identities = 187/227 (82%)
 Strand = Plus / Minus

                                                                       
Query: 368 tggtccattgacatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaagc 427
           ||||||||| || |||||||||||||| ||||| || || ||||||||||  || |||||
Sbjct: 607 tggtccattcacgtcaaccttatcaaatatagggaactctgctttaaaccgggtgcaagc 548

                                                                       
Query: 428 aaattgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcatggaaa 487
            ||||| || ||||  |  ||||| || || ||||| |||||||| |||||||| |||||
Sbjct: 547 gaattgtttgatctcggagtttgacccgggctcttggaaaccaaactgattgcagggaaa 488

                                                                       
Query: 488 cgctagaatctcaaacccttgagtcttgtacttctcgtaaagatgagatagctcagtgta 547
            |||||||||||||| |||||||| ||||| |||||||| ||||| || ||||| | |||
Sbjct: 487 agctagaatctcaaatccttgagttttgtatttctcgtacagatgtgaaagctctgagta 428

                                                          
Query: 548 atttgctgttgtaagcccacattgagaagcaacattaacaatcaaca 594
           ||||| || ||| |  ||||||   ||||||||||| ||||||||||
Sbjct: 427 atttgatgatgtcaaaccacatcttgaagcaacattgacaatcaaca 381



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 204 ttctggatgtccttctcaatttggaatggtgaagttgttggtgggtatctctccacaact 263
           ||||||||||| ||||| |||||||| || || || || || ||||| ||||| || || 
Sbjct: 771 ttctggatgtctttctcgatttggaaaggggatgtggtgggagggtacctctcaacgacc 712

                                                 
Query: 264 ttgccatttttgtccactaggaacttctcaaagttcca 301
           || || ||||| || |  | ||||||||||||||||||
Sbjct: 711 tttccctttttatcaatcaagaacttctcaaagttcca 674



to top

>emb|X89866.1|ATGLUTPER A.thaliana mRNA for glutathione peroxidase
          Length = 928

 Score =  133 bits (67), Expect = 8e-28
 Identities = 187/227 (82%)
 Strand = Plus / Minus

                                                                       
Query: 368 tggtccattgacatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaagc 427
           ||||||||| || |||||||||||||| ||||| || || ||||||||||  || |||||
Sbjct: 579 tggtccattcacgtcaaccttatcaaatatagggaactctgctttaaaccgggtgcaagc 520

                                                                       
Query: 428 aaattgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcatggaaa 487
            ||||| || ||||  |  ||||| || || ||||| |||||||| |||||||| |||||
Sbjct: 519 gaattgtttgatctcggagtttgacccgggctcttggaaaccaaactgattgcagggaaa 460

                                                                       
Query: 488 cgctagaatctcaaacccttgagtcttgtacttctcgtaaagatgagatagctcagtgta 547
            |||||||||||||| |||||||| ||||| |||||||| ||||| || ||||| | |||
Sbjct: 459 agctagaatctcaaatccttgagttttgtatttctcgtacagatgtgaaagctctgagta 400

                                                          
Query: 548 atttgctgttgtaagcccacattgagaagcaacattaacaatcaaca 594
           ||||| || ||| |  ||||||   ||||||||||| ||||||||||
Sbjct: 399 atttgatgatgtcaaaccacatcttgaagcaacattgacaatcaaca 353



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 204 ttctggatgtccttctcaatttggaatggtgaagttgttggtgggtatctctccacaact 263
           ||||||||||| ||||| |||||||| || || || || || ||||| ||||| || || 
Sbjct: 743 ttctggatgtctttctcgatttggaaaggggatgtggtgggagggtacctctcaacgacc 684

                                                 
Query: 264 ttgccatttttgtccactaggaacttctcaaagttcca 301
           || || ||||| || |  | ||||||||||||||||||
Sbjct: 683 tttccctttttatcaatcaagaacttctcaaagttcca 646



to top

>gb|AY063024.1| Arabidopsis thaliana putative glutathione peroxidase (At2g25080)
           mRNA, complete cds
          Length = 742

 Score =  133 bits (67), Expect = 8e-28
 Identities = 187/227 (82%)
 Strand = Plus / Minus

                                                                       
Query: 368 tggtccattgacatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaagc 427
           ||||||||| || |||||||||||||| ||||| || || ||||||||||  || |||||
Sbjct: 531 tggtccattcacgtcaaccttatcaaatatagggaactctgctttaaaccgggtgcaagc 472

                                                                       
Query: 428 aaattgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcatggaaa 487
            ||||| || ||||  |  ||||| || || ||||| |||||||| |||||||| |||||
Sbjct: 471 gaattgtttgatctcggagtttgacccgggctcttggaaaccaaactgattgcagggaaa 412

                                                                       
Query: 488 cgctagaatctcaaacccttgagtcttgtacttctcgtaaagatgagatagctcagtgta 547
            |||||||||||||| |||||||| ||||| |||||||| ||||| || ||||| | |||
Sbjct: 411 agctagaatctcaaatccttgagttttgtatttctcgtacagatgtgaaagctctgagta 352

                                                          
Query: 548 atttgctgttgtaagcccacattgagaagcaacattaacaatcaaca 594
           ||||| || ||| |  ||||||   ||||||||||| ||||||||||
Sbjct: 351 atttgatgatgtcaaaccacatcttgaagcaacattgacaatcaaca 305



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 204 ttctggatgtccttctcaatttggaatggtgaagttgttggtgggtatctctccacaact 263
           ||||||||||| ||||| |||||||| || || || || || ||||| ||||| || || 
Sbjct: 695 ttctggatgtctttctcgatttggaaaggggatgtggtgggagggtacctctcaacgacc 636

                                                 
Query: 264 ttgccatttttgtccactaggaacttctcaaagttcca 301
           || || ||||| || |  | ||||||||||||||||||
Sbjct: 635 tttccctttttatcaatcaagaacttctcaaagttcca 598



to top

>gb|AY035153.1| Arabidopsis thaliana putative glutathione peroxidase (At2g25080)
           mRNA, complete cds
          Length = 936

 Score =  133 bits (67), Expect = 8e-28
 Identities = 187/227 (82%)
 Strand = Plus / Minus

                                                                       
Query: 368 tggtccattgacatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaagc 427
           ||||||||| || |||||||||||||| ||||| || || ||||||||||  || |||||
Sbjct: 580 tggtccattcacgtcaaccttatcaaatatagggaactctgctttaaaccgggtgcaagc 521

                                                                       
Query: 428 aaattgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcatggaaa 487
            ||||| || ||||  |  ||||| || || ||||| |||||||| |||||||| |||||
Sbjct: 520 gaattgtttgatctcggagtttgacccgggctcttggaaaccaaactgattgcagggaaa 461

                                                                       
Query: 488 cgctagaatctcaaacccttgagtcttgtacttctcgtaaagatgagatagctcagtgta 547
            |||||||||||||| |||||||| ||||| |||||||| ||||| || ||||| | |||
Sbjct: 460 agctagaatctcaaatccttgagttttgtatttctcgtacagatgtgaaagctctgagta 401

                                                          
Query: 548 atttgctgttgtaagcccacattgagaagcaacattaacaatcaaca 594
           ||||| || ||| |  ||||||   ||||||||||| ||||||||||
Sbjct: 400 atttgatgatgtcaaaccacatcttgaagcaacattgacaatcaaca 354



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 204 ttctggatgtccttctcaatttggaatggtgaagttgttggtgggtatctctccacaact 263
           ||||||||||| ||||| |||||||| || || || || || ||||| ||||| || || 
Sbjct: 744 ttctggatgtctttctcgatttggaaaggggatgtggtgggagggtacctctcaacgacc 685

                                                 
Query: 264 ttgccatttttgtccactaggaacttctcaaagttcca 301
           || || ||||| || |  | ||||||||||||||||||
Sbjct: 684 tttccctttttatcaatcaagaacttctcaaagttcca 647



to top

>emb|AJ000469.1|ATCHLGPX1 Arabidopsis thaliana chloroplast mRNA for glutathione peroxidase
          Length = 962

 Score =  133 bits (67), Expect = 8e-28
 Identities = 187/227 (82%)
 Strand = Plus / Minus

                                                                       
Query: 368 tggtccattgacatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaagc 427
           ||||||||| || |||||||||||||| ||||| || || ||||||||||  || |||||
Sbjct: 594 tggtccattcacgtcaaccttatcaaatatagggaactctgctttaaaccgggtgcaagc 535

                                                                       
Query: 428 aaattgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcatggaaa 487
            ||||| || ||||  |  ||||| || || ||||| |||||||| |||||||| |||||
Sbjct: 534 gaattgtttgatctcggagtttgacccgggctcttggaaaccaaactgattgcagggaaa 475

                                                                       
Query: 488 cgctagaatctcaaacccttgagtcttgtacttctcgtaaagatgagatagctcagtgta 547
            |||||||||||||| |||||||| ||||| |||||||| ||||| || ||||| | |||
Sbjct: 474 agctagaatctcaaatccttgagttttgtatttctcgtacagatgtgaaagctctgagta 415

                                                          
Query: 548 atttgctgttgtaagcccacattgagaagcaacattaacaatcaaca 594
           ||||| || ||| |  ||||||   ||||||||||| ||||||||||
Sbjct: 414 atttgatgatgtcaaaccacatcttgaagcaacattgacaatcaaca 368



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 204 ttctggatgtccttctcaatttggaatggtgaagttgttggtgggtatctctccacaact 263
           ||||||||||| ||||| |||||||| || || || || || ||||| ||||| || || 
Sbjct: 758 ttctggatgtctttctcgatttggaaaggggatgtggtgggagggtacctctcaacgacc 699

                                                 
Query: 264 ttgccatttttgtccactaggaacttctcaaagttcca 301
           || || ||||| || |  | ||||||||||||||||||
Sbjct: 698 tttccctttttatcaatcaagaacttctcaaagttcca 661



to top

>gb|AY347849.1| Malus x domestica clone 23-3 phospholipid glutathione peroxidase
           mRNA, partial cds
          Length = 297

 Score =  109 bits (55), Expect = 1e-20
 Identities = 166/203 (81%)
 Strand = Plus / Minus

                                                                       
Query: 195 gcgacgagtttctggatgtccttctcaatttggaatggtgaagttgttggtgggtatctc 254
           ||||| ||||||||||| |||||||||||||| || || || || |||||||||||||||
Sbjct: 206 gcgaccagtttctggatatccttctcaatttgaaaaggggatgtcgttggtgggtatctc 147

                                                                       
Query: 255 tccacaactttgccatttttgtccactaggaacttctcaaagttccacttcactatatca 314
           || |||||||| ||||| |||||||| |  ||||||||||| |||||||| |  || |||
Sbjct: 146 tcaacaactttaccattcttgtccaccaaaaacttctcaaaattccacttgataatgtca 87

                                                                       
Query: 315 cccaaaaatcctccagcactcgacttaagaaacttataaataggggctgtaaatggtcca 374
           || | ||| ||||| ||| | || || |||||||  ||||  || |||||    || || 
Sbjct: 86  cctagaaaacctcctgcatttgatttcagaaactggtaaaccggagctgtgctgggaccg 27

                                  
Query: 375 ttgacatcaaccttatcaaaaat 397
           |||||||||||||||||||||||
Sbjct: 26  ttgacatcaaccttatcaaaaat 4



to top

>gb|AC143339.12| Medicago truncatula clone mth2-20g20, complete sequence
          Length = 99993

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 140/170 (82%)
 Strand = Plus / Minus

                                                                         
Query: 218   ctcaatttggaatggtgaagttgttggtgggtatctctccacaactttgccatttttgtc 277
             ||||||||| || || || ||||||||||||||||  || |||||||| |||||||| ||
Sbjct: 81539 ctcaatttgaaaaggagaggttgttggtgggtatcgttcaacaactttaccatttttatc 81480

                                                                         
Query: 278   cactaggaacttctcaaagttccacttcactatatcacccaaaaatcctccagcactcga 337
              || | ||| |||||||| |||||||| || | |||||| ||||| ||||||| ||| ||
Sbjct: 81479 aaccaagaatttctcaaaattccacttgacaagatcaccaaaaaaccctccagaacttga 81420

                                                               
Query: 338   cttaagaaacttataaataggggctgtaaatggtccattgacatcaacct 387
             ||| |||||||  || |  || || |||||||||||||| ||||||||||
Sbjct: 81419 cttcagaaactggtatactggagcagtaaatggtccatttacatcaacct 81370



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                         
Query: 383   aaccttatcaaaaataggaaattcagctttaaaccttgtacaagcaaattgctttatctg 442
             ||||||||| ||||| |||||||| ||||| ||||| || ||||| |||| ||| || | 
Sbjct: 81295 aaccttatcgaaaattggaaattctgctttgaacctagtgcaagcgaatttcttaatttc 81236

                                                                  
Query: 443   tgtatttgatccaggttcttgaaaaccaaattgattgcatggaaacgctagaa 495
             |  |||||||||||| || || |  |||||||||||||| || || |||||||
Sbjct: 81235 ttcatttgatccaggctcctgcatgccaaattgattgcaagggaaagctagaa 81183



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 573   gaagcaacattaacaatcaa 592
             ||||||||||||||||||||
Sbjct: 79753 gaagcaacattaacaatcaa 79734



to top

>gb|AF411209.1| Brassica napus glutathione peroxidase mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 921

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 191/242 (78%)
 Strand = Plus / Minus

                                                                       
Query: 369 ggtccattgacatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaagca 428
           |||||||| |||||||||||||| || ||||| || ||||||||||| || |||||  | 
Sbjct: 562 ggtccattcacatcaaccttatcgaatatagggaactcagctttaaatctggtacacacg 503

                                                                       
Query: 429 aattgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcatggaaac 488
           ||  |||| || |  |  |||||| |||||||||||   |||||||||||||| || || 
Sbjct: 502 aaccgcttgatatccgggtttgattcaggttcttgacctccaaattgattgcaagggaaa 443

                                                                       
Query: 489 gctagaatctcaaacccttgagtcttgtacttctcgtaaagatgagatagctcagtgtaa 548
           |||||||||||||| |||||  |  |||| || ||||| |  || || ||||| ||||| 
Sbjct: 442 gctagaatctcaaatccttggtttctgtatttgtcgtacaattgtgaaagctctgtgtag 383

                                                                       
Query: 549 tttgctgttgtaagcccacattgagaagcaacattaacaatcaacagtgcttttcccttg 608
           |||| || ||| |  |||||||  |||||||| ||||| |||||||| | |||||| |||
Sbjct: 382 tttgatgatgttaaaccacattttgaagcaacgttaacgatcaacagaggttttcctttg 323

             
Query: 609 aa 610
           ||
Sbjct: 322 aa 321



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 204 ttctggatgtccttctcaatttggaatggtgaagttgttggtgggtatctctccacaact 263
           ||||||||||| ||||||||||| || || ||||| || || ||||||||||  || || 
Sbjct: 727 ttctggatgtctttctcaatttgtaaaggagaagtcgtgggagggtatctctggacgacg 668

                                                    
Query: 264 ttgccatttttgtccactaggaacttctcaaagttccactt 304
           ||||| |||||||| || | ||| |||||||||||||||||
Sbjct: 667 ttgccttttttgtcaaccaagaatttctcaaagttccactt 627



to top

>emb|AL161579.2|ATCHRIV75 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 75
          Length = 196242

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                          
Query: 222    atttggaatggtgaagttgttggtgggtatctctccacaactttgccatttttgtccact 281
              |||||||| || |||||||| || ||||||||||| ||||||||||| ||||| || || 
Sbjct: 177276 atttggaaaggagaagttgtgggagggtatctctcgacaactttgccctttttatcaacc 177217

                                  
Query: 282    aggaacttctcaaagttcca 301
              | ||| ||||||||||||||
Sbjct: 177216 aagaatttctcaaagttcca 177197



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                          
Query: 423    caagcaaattgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcat 482
              |||||||||||||| ||||  |  ||||| || |||||||||   |||||||||||||| 
Sbjct: 176994 caagcaaattgcttgatctcagggtttgaaccgggttcttgacctccaaattgattgcaa 176935

                                  
Query: 483    ggaaacgctagaatctcaaa 502
              || || || |||||||||||
Sbjct: 176934 gggaaagcaagaatctcaaa 176915



to top

>emb|AL049607.1|ATF11C18 Arabidopsis thaliana DNA chromosome 4, BAC clone F11C18 (ESSA project)
          Length = 111517

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                         
Query: 222   atttggaatggtgaagttgttggtgggtatctctccacaactttgccatttttgtccact 281
             |||||||| || |||||||| || ||||||||||| ||||||||||| ||||| || || 
Sbjct: 37937 atttggaaaggagaagttgtgggagggtatctctcgacaactttgccctttttatcaacc 37878

                                 
Query: 282   aggaacttctcaaagttcca 301
             | ||| ||||||||||||||
Sbjct: 37877 aagaatttctcaaagttcca 37858



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                         
Query: 423   caagcaaattgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcat 482
             |||||||||||||| ||||  |  ||||| || |||||||||   |||||||||||||| 
Sbjct: 37655 caagcaaattgcttgatctcagggtttgaaccgggttcttgacctccaaattgattgcaa 37596

                                 
Query: 483   ggaaacgctagaatctcaaa 502
             || || || |||||||||||
Sbjct: 37595 gggaaagcaagaatctcaaa 37576



to top

>emb|AJ487466.1|CAR487466 Cicer arietinum mRNA for putative phospholipid hydroperoxide
           glutathione peroxidase (phgpx gene)
          Length = 798

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 371 tccattgacatcaaccttatcaaaaataggaaattcagctttaaaccttgt 421
           ||||||||| |||||||||||||| || |||||||||||||| ||||||||
Sbjct: 363 tccattgacttcaaccttatcaaagattggaaattcagctttgaaccttgt 313



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 477 ttgcatggaaacgctagaatctcaaacccttgagtcttgtacttctcgta 526
           ||||||||||| || |  || |||||||||||| |||||||||| |||||
Sbjct: 257 ttgcatggaaatgccaagatttcaaacccttgattcttgtacttatcgta 208



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 564 ccacattgagaagcaacattaacaatca 591
           |||||||| ||||||||||| |||||||
Sbjct: 170 ccacattgtgaagcaacattgacaatca 143



to top

>gb|AY493200.1| Brassica oleracea var. botrytis GPx (GPx) mRNA, complete cds
          Length = 699

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 190/242 (78%)
 Strand = Plus / Minus

                                                                       
Query: 369 ggtccattgacatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaagca 428
           |||||||| |||||||||||||| || ||||| || ||||||||||| || |||||  | 
Sbjct: 518 ggtccattcacatcaaccttatcgaatatagggaactcagctttaaatctggtacacacg 459

                                                                       
Query: 429 aattgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcatggaaac 488
           ||  |||| || |  |  |||||| | |||||||||   |||||||||||||| || || 
Sbjct: 458 aaccgcttgatatccgggtttgattcgggttcttgacctccaaattgattgcaagggaaa 399

                                                                       
Query: 489 gctagaatctcaaacccttgagtcttgtacttctcgtaaagatgagatagctcagtgtaa 548
           |||| ||||||||| |||||  || |||| || ||||| |  || || ||||| ||||| 
Sbjct: 398 gctaaaatctcaaatccttggttcctgtatttgtcgtacaattgtgaaagctctgtgtag 339

                                                                       
Query: 549 tttgctgttgtaagcccacattgagaagcaacattaacaatcaacagtgcttttcccttg 608
           |||| || ||| |  |||||||  |||||||| ||||| |||||||| | |||||| |||
Sbjct: 338 tttgatgatgtcaaaccacattttgaagcaacgttaacgatcaacagaggttttcctttg 279

             
Query: 609 aa 610
           ||
Sbjct: 278 aa 277



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                       
Query: 204 ttctggatgtccttctcaatttggaatggtgaagttgttggtgggtatctctccacaact 263
           ||||||||||| ||||||||||| || || |  || || || ||||||||||  || || 
Sbjct: 683 ttctggatgtctttctcaatttgtaaaggcggggtcgtgggagggtatctctggacgacg 624

                                                    
Query: 264 ttgccatttttgtccactaggaacttctcaaagttccactt 304
           ||||| |||||||| || | ||| |||||||||||||||||
Sbjct: 623 ttgccctttttgtcaaccaagaatttctcaaagttccactt 583



to top

>emb|Y14707.1|HAGPXHA2 Heliantus annuus mRNA for glutathione peroxidase, partial
          Length = 743

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 450 gatccaggttcttgaaaaccaaattgattgcatggaaacgctagaatctcaaacccttga 509
           ||||||||||||||    |||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 278 gatccaggttcttgcccgccaaattggttgcatggaaaagcaagaatctcaaaaccttga 219

                        
Query: 510 gtcttgtacttct 522
             |||||||||||
Sbjct: 218 tccttgtacttct 206



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 564 ccacattgagaagcaacattaacaatcaacagtgcttttcccttgaacttgc 615
           |||||||| ||||||||||| ||||||| ||   ||||||||||| ||||||
Sbjct: 164 ccacattgtgaagcaacattgacaatcagcaagacttttcccttgtacttgc 113



to top

>ref|NM_129896.2| Arabidopsis thaliana ATGPX3 (GLUTATHIONE PEROXIDASE 3); glutathione
           peroxidase AT2G43350 (ATGPX3) mRNA, complete cds
          Length = 904

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 467 accaaattgattgcatggaaacgctagaatctcaaacccttgagtcttgtactt 520
           ||||||||| ||||| ||||| ||||  ||||||||||| ||||| ||||||||
Sbjct: 406 accaaattggttgcaaggaaatgctaagatctcaaacccctgagttttgtactt 353



to top

>gb|AY096479.1| Arabidopsis thaliana putative glutathione peroxidase (At2g43350)
           mRNA, complete cds
          Length = 652

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 467 accaaattgattgcatggaaacgctagaatctcaaacccttgagtcttgtactt 520
           ||||||||| ||||| ||||| ||||  ||||||||||| ||||| ||||||||
Sbjct: 339 accaaattggttgcaaggaaatgctaagatctcaaacccctgagttttgtactt 286



to top

>gb|AY065372.1| Arabidopsis thaliana putative glutathione peroxidase (At2g43350)
           mRNA, complete cds
          Length = 924

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 467 accaaattgattgcatggaaacgctagaatctcaaacccttgagtcttgtactt 520
           ||||||||| ||||| ||||| ||||  ||||||||||| ||||| ||||||||
Sbjct: 407 accaaattggttgcaaggaaatgctaagatctcaaacccctgagttttgtactt 354



to top

>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                           
Query: 449     tgatccaggttcttgaaaaccaaattgattgcatggaaacgctagaatctcaaacccttg 508
               ||||||||||||||||  |||||||||||| || || ||  |||||||  ||||||||||
Sbjct: 1380035 tgatccaggttcttgaccaccaaattgattacaagggaaacctagaattacaaacccttg 1380094

                                 
Query: 509     agtcttgtacttctcgta 526
               |   ||||| ||||||||
Sbjct: 1380095 atctttgtatttctcgta 1380112



to top

>gb|AY087030.1| Arabidopsis thaliana clone 30737 mRNA, complete sequence
          Length = 903

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 467 accaaattgattgcatggaaacgctagaatctcaaacccttgagtcttgtactt 520
           ||||||||| ||||| ||||| ||||  ||||||||||| ||||| ||||||||
Sbjct: 405 accaaattggttgcaaggaaatgctaagatctcaaacccctgagttttgtactt 352



to top

>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                           
Query: 449     tgatccaggttcttgaaaaccaaattgattgcatggaaacgctagaatctcaaacccttg 508
               ||||||||||||||||  |||||||||||| || || ||  |||||||  ||||||||||
Sbjct: 1303707 tgatccaggttcttgaccaccaaattgattacaagggaaacctagaattacaaacccttg 1303766

                                 
Query: 509     agtcttgtacttctcgta 526
               |   ||||| ||||||||
Sbjct: 1303767 atctttgtatttctcgta 1303784



to top

>dbj|D63425.1| Spinacia oleracea mRNA for phopholipid hydroperoxide glutathione
           peroxidase-like protein, complete cds
          Length = 927

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 558 gtaagcccacattgagaagcaacattaacaatcaacag 595
           |||||||||||||| || |||||||| |||||||||||
Sbjct: 342 gtaagcccacattgtgatgcaacattgacaatcaacag 305



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 372 ccattgacatcaaccttatcaaaaataggaaattcagcttt 412
           ||||| ||||||||||| |||||||| ||  ||||||||||
Sbjct: 528 ccattcacatcaaccttgtcaaaaatggggtattcagcttt 488



to top

>ref|XM_533828.2| PREDICTED: Canis familiaris glutathione peroxidase 1 (GPX1), mRNA
          Length = 736

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||||||||||||||||||||||||
Sbjct: 430 ccactaggaacttctcaaagttcca 406



to top

>gb|AF242650.1|AF242650 Hevea brasiliensis glutathione peroxidase mRNA, complete cds
          Length = 890

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 564 ccacattgagaagcaacattaacaatcaa 592
           |||||||| ||||||||||||||||||||
Sbjct: 247 ccacattgtgaagcaacattaacaatcaa 219



to top

>gb|AC135562.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0087P19, complete sequence
          Length = 172066

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 382   caaccttatcaaaaataggaaattcagctttaaaccttgtacaa 425
             ||||||| ||||||||||||||||| ||||| || || ||||||
Sbjct: 26526 caaccttgtcaaaaataggaaattctgctttgaatctggtacaa 26569



to top

>gb|BC071064.1| Xenopus laevis MGC78876 protein, mRNA (cDNA clone MGC:78876
           IMAGE:4058479), complete cds
          Length = 1103

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 277 ccactaggaacttctcaaagttccactt 304
           |||| |||||||||||||||||||||||
Sbjct: 644 ccacaaggaacttctcaaagttccactt 617



to top

>ref|XM_709201.1| Candida albicans SC5314 putative glutathione peroxidase/redox
           transducer (CaO19.85), mRNA
          Length = 492

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 452 tccaggttcttgaaaaccaaattgattgcatggaaa 487
           |||||||||||||  ||||||||||||||| |||||
Sbjct: 219 tccaggttcttgatgaccaaattgattgcaaggaaa 184



to top

>ref|XM_708924.1| Candida albicans SC5314 putative glutathione peroxidase/redox
           transducer (CaO19.7730), mRNA
          Length = 492

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 452 tccaggttcttgaaaaccaaattgattgcatggaaa 487
           |||||||||||||  ||||||||||||||| |||||
Sbjct: 219 tccaggttcttgatgaccaaattgattgcaaggaaa 184



to top

>emb|X66377.1|CSCSAPRO C.sinensis mRNA csa for salt-associated protein
          Length = 862

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 372 ccattgacatcaaccttatcaaaaataggaaattcagctttaaa 415
           ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 450 ccattaacatcaaccttatcaaatatgggaaactcagccttaaa 407



to top

>gb|DQ004739.1| Phaseolus lunatus glutathione peroxidase (GP1) mRNA, partial cds
          Length = 323

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 372 ccattgacatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaagcaaat 431
           ||||| ||||||||||| ||||||| |||||| ||||| || || |  |||||| |||| 
Sbjct: 262 ccattcacatcaaccttgtcaaaaacaggaaactcagccttgaagcgagtacaaacaaac 203

                                                                       
Query: 432 tgctttatctgtgtatttgatccaggttcttgaaaaccaaattgattgcatggaaacgct 491
           |  | |||||||  ||| |||||||| || ||    ||||||||||||||||| || || 
Sbjct: 202 tcttgtatctgttcattagatccaggctcctgtgccccaaattgattgcatgggaatgcc 143

                   
Query: 492 agaatctc 499
           ||||||||
Sbjct: 142 agaatctc 135



to top

>emb|BX934548.2| Gallus gallus finished cDNA, clone ChEST607g18
          Length = 978

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 277 ccactaggaacttctcaaagttccactt 304
           |||| |||||||||||||||||||||||
Sbjct: 625 ccaccaggaacttctcaaagttccactt 598



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 382      caaccttatcaaaaataggaaattcagctttaaaccttgtacaa 425
                ||||||| ||||||||||||||||| ||||| || || ||||||
Sbjct: 10130362 caaccttgtcaaaaataggaaattctgctttgaatctggtacaa 10130405



to top

>dbj|AK101586.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033050P15, full
            insert sequence
          Length = 1776

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 378  acatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaa 425
            ||||||| ||| ||||||||||||||||| ||||| || || ||||||
Sbjct: 1418 acatcaatcttgtcaaaaataggaaattctgctttgaatctggtacaa 1371



to top

>dbj|AK101583.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033050O15, full
            insert sequence
          Length = 1776

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 378  acatcaaccttatcaaaaataggaaattcagctttaaaccttgtacaa 425
            ||||||| ||| ||||||||||||||||| ||||| || || ||||||
Sbjct: 1418 acatcaatcttgtcaaaaataggaaattctgctttgaatctggtacaa 1371



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 382      caaccttatcaaaaataggaaattcagctttaaaccttgtacaa 425
                ||||||| ||||||||||||||||| ||||| || || ||||||
Sbjct: 10202059 caaccttgtcaaaaataggaaattctgctttgaatctggtacaa 10202102



to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 265   tgccatttttgtccactaggaacttctcaaagttccact 303
             |||| |||||| |||| ||||||||||| ||||||||||
Sbjct: 91789 tgccgtttttgcccaccaggaacttctcgaagttccact 91827



to top

>ref|XM_386326.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG06150.1)
           partial mRNA
          Length = 516

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 282 aggaacttctcaaagttccactt 304
           |||||||||||||||||||||||
Sbjct: 410 aggaacttctcaaagttccactt 388



to top

>ref|XM_503454.1| Yarrowia lipolytica CLIB122, YALI0E02310g predicted mRNA
          Length = 507

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 282 aggaacttctcaaagttccactt 304
           |||||||||||||||||||||||
Sbjct: 410 aggaacttctcaaagttccactt 388



to top

>gb|AC130797.5| Chlamydomonas reinhardtii clone cr-1j6b, complete sequence
          Length = 80650

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 273   ttgtccactaggaacttctcaaagttc 299
             |||||||| ||||||||||||||||||
Sbjct: 56278 ttgtccaccaggaacttctcaaagttc 56304



to top

>gb|AF014927.1|AF014927 Chlamydomonas reinhardtii glutathione peroxidase homolog (gpxh) gene,
            complete cds
          Length = 4947

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 273  ttgtccactaggaacttctcaaagttc 299
            |||||||| ||||||||||||||||||
Sbjct: 3676 ttgtccaccaggaacttctcaaagttc 3650



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia
              lipolytica
          Length = 4224103

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 282    aggaacttctcaaagttccactt 304
              |||||||||||||||||||||||
Sbjct: 255786 aggaacttctcaaagttccactt 255764



to top

>gb|AF047660.2| Caenorhabditis elegans cosmid T09A12, complete sequence
          Length = 32727

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 469  caaattgattgcatggaaacgc 490
            ||||||||||||||||||||||
Sbjct: 9097 caaattgattgcatggaaacgc 9076



to top

>gb|AC183773.2| Pan troglodytes BAC clone CH251-2N7 from chromosome 7, complete
             sequence
          Length = 168126

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 205   tctggatgtccttctcaatttg 226
             ||||||||||||||||||||||
Sbjct: 56023 tctggatgtccttctcaatttg 56002



to top

>gb|AC092648.3| Homo sapiens BAC clone RP11-421N10 from 7, complete sequence
          Length = 171881

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 205   tctggatgtccttctcaatttg 226
             ||||||||||||||||||||||
Sbjct: 47456 tctggatgtccttctcaatttg 47477



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 225     tggaatggtgaagttgttggtg 246
               ||||||||||||||||||||||
Sbjct: 2406347 tggaatggtgaagttgttggtg 2406368



to top

>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                           
Query: 449     tgatccaggttcttgaaaaccaaattgattgcatggaaacgctagaatctcaaacccttg 508
               |||||||||||||||   |||||||||||| || || ||  |||||||  ||||||||||
Sbjct: 1332339 tgatccaggttcttggccaccaaattgattacaagggaaacctagaattacaaacccttg 1332398

                                 
Query: 509     agtcttgtacttctcgta 526
               |   ||||| ||||||||
Sbjct: 1332399 atctttgtatttctcgta 1332416



to top

>emb|AJ238697.1|HVU238697 Hordeum vulgare mRNA for GPX12Hv, cultivar Haisa
          Length = 1026

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 372 ccattgacatcaaccttatcaaaaat 397
           ||||||||||||||||| ||||||||
Sbjct: 619 ccattgacatcaaccttgtcaaaaat 594



to top

>gb|L10325.1|BOVSELGP Cow glutathione peroxidase (GPx) plasma isoform mRNA, complete cds
          Length = 1510

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 277 ccactaggaacttctcaaagttccac 302
           |||| |||||||||||||||||||||
Sbjct: 576 ccaccaggaacttctcaaagttccac 551



to top

>ref|NM_001028197.1| Caenorhabditis elegans T09A12.2b (T09A12.2) mRNA, complete cds
          Length = 567

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 469 caaattgattgcatggaaacgc 490
           ||||||||||||||||||||||
Sbjct: 286 caaattgattgcatggaaacgc 265



to top

>ref|NM_001028196.1| Caenorhabditis elegans T09A12.2a (T09A12.2) mRNA, complete cds
          Length = 692

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 469 caaattgattgcatggaaacgc 490
           ||||||||||||||||||||||
Sbjct: 314 caaattgattgcatggaaacgc 293



to top

>ref|NM_174077.2| Bos taurus glutathione peroxidase 3 (plasma) (GPX3), mRNA
          Length = 1510

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 277 ccactaggaacttctcaaagttccac 302
           |||| |||||||||||||||||||||
Sbjct: 576 ccaccaggaacttctcaaagttccac 551



to top

>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                           
Query: 449     tgatccaggttcttgaaaaccaaattgattgcatggaaacgctagaatctcaaacccttg 508
               |||||||||||||||   |||||||||||| || || ||  |||||||  ||||||||||
Sbjct: 1303844 tgatccaggttcttggccaccaaattgattacaagggaaacctagaattacaaacccttg 1303903

                                 
Query: 509     agtcttgtacttctcgta 526
               |   ||||| ||||||||
Sbjct: 1303904 atctttgtatttctcgta 1303921



to top

>dbj|AK105165.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-E06, full
           insert sequence
          Length = 911

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 372 ccattgacatcaaccttatcaaaaat 397
           ||||| ||||||||||||||||||||
Sbjct: 523 ccattaacatcaaccttatcaaaaat 498



to top

>dbj|AK058456.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-H08, full
           insert sequence
          Length = 994

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 372 ccattgacatcaaccttatcaaaaat 397
           ||||| ||||||||||||||||||||
Sbjct: 530 ccattaacatcaaccttatcaaaaat 505



to top

>dbj|AB096704.1| Hordeum vulgare BarPHGPX mRNA for phospholipid hydroperoxide
           glutathione peroxidase-like protein, complete cds
          Length = 846

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 372 ccattgacatcaaccttatcaaaaat 397
           ||||||||||||||||| ||||||||
Sbjct: 364 ccattgacatcaaccttgtcaaaaat 339



to top

>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                           
Query: 449     tgatccaggttcttgaaaaccaaattgattgcatggaaacgctagaatctcaaacccttg 508
               |||||||||||||||   |||||||||||| || || ||  |||||||  ||||||||||
Sbjct: 1270492 tgatccaggttcttggccaccaaattgattacaagggaaacctagaattacaaacccttg 1270551

                                 
Query: 509     agtcttgtacttctcgta 526
               |   ||||| ||||||||
Sbjct: 1270552 atctttgtatttctcgta 1270569



to top

>ref|NM_117229.2| Arabidopsis thaliana ATGPX6 (GLUTATHIONE PEROXIDASE 6); glutathione
           peroxidase AT4G11600 (ATGPX6) mRNA, complete cds
          Length = 977

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 564 ccacattgagaagcaacattaacaatcaa 592
           ||||||||||||||||| || ||||||||
Sbjct: 343 ccacattgagaagcaacgttcacaatcaa 315



to top

>ref|XM_520933.1| PREDICTED: Pan troglodytes similar to Glutathione peroxidase 1
           (GSHPx-1) (Cellular glutathione peroxidase) (LOC465495),
           mRNA
          Length = 703

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 537 ccaccaggaacttctcaaagttcca 513



to top

>ref|NM_001003213.1| Canis familiaris glutathione peroxidase 5 (epididymal
           androgen-related protein) (GPX5), mRNA
          Length = 1524

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 645 ccaccaggaacttctcaaagttcca 621



to top

>ref|XM_527081.1| PREDICTED: Pan troglodytes similar to Plasma glutathione peroxidase
           precursor (GSHPx-P) (Extracellular glutathione
           peroxidase) (GPx-P) (LOC471703), mRNA
          Length = 681

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 565 ccaccaggaacttctcaaagttcca 541



to top

>ref|XM_517021.1| PREDICTED: Pan troglodytes similar to Glutathione peroxidase 1
           (GSHPx-1) (Cellular glutathione peroxidase) (LOC461015),
           mRNA
          Length = 833

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 531 ccaccaggaacttctcaaagttcca 507



to top

>ref|NM_010343.1| Mus musculus glutathione peroxidase 5 (Gpx5), mRNA
          Length = 1617

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 591 ccaccaggaacttctcaaagttcca 567



to top

>gb|AC107634.8| Mus musculus chromosome 5, clone RP23-19G21, complete sequence
          Length = 201345

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 56     attattttacagaaacagaaa 76
              |||||||||||||||||||||
Sbjct: 151308 attattttacagaaacagaaa 151328



to top

>gb|BT018110.1| Zea mays clone EL01N0553E06.c mRNA sequence
          Length = 762

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 467 accaaattgattgcatggaaacgctagaatctcaaacccttgagtcttgtacttctcgta 526
           |||||| || |||||||| || || || || ||||| ||||| | |||||||||||||||
Sbjct: 271 accaaactggttgcatgggaaagccaggatttcaaagccttgggccttgtacttctcgta 212

                                
Query: 527 aagatgagatagctcagtgta 547
            || || |  |||||||||||
Sbjct: 211 gagctgggccagctcagtgta 191



to top

>gb|AC161260.2| Mus musculus BAC clone RP23-448A11 from chromosome 9, complete sequence
          Length = 190608

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 277    ccactaggaacttctcaaagttcca 301
              |||| ||||||||||||||||||||
Sbjct: 129985 ccaccaggaacttctcaaagttcca 130009



to top

>gb|AC108399.11| Mus musculus chromosome 19, clone RP24-375O7, complete sequence
          Length = 180312

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 392    aaaaataggaaattcagcttt 412
              |||||||||||||||||||||
Sbjct: 145898 aaaaataggaaattcagcttt 145878



to top

>gb|AC137124.17| Mus musculus chromosome 3, clone RP24-229P11, complete sequence
          Length = 172081

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 231    ggtgaagttgttggtgggtat 251
              |||||||||||||||||||||
Sbjct: 141648 ggtgaagttgttggtgggtat 141668



to top

>ref|XM_864340.1| PREDICTED: Bos taurus similar to glutathione peroxidase 6
           (LOC613501), mRNA
          Length = 543

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           ||||||| |||||||||||||||||
Sbjct: 442 ccactagaaacttctcaaagttcca 418



to top

>ref|XM_425211.1| PREDICTED: Gallus gallus similar to glutathione peroxidase (EC
           1.11.1.9), plasma, precursor [similarity] - mouse
           (LOC427638), mRNA
          Length = 618

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 541 ccaccaggaacttctcaaagttcca 517



to top

>gb|BC013526.1| Mus musculus glutathione peroxidase 6, mRNA (cDNA clone MGC:19204
           IMAGE:4237630), complete cds
          Length = 1324

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 597 ccaccaggaacttctcaaagttcca 573



to top

>gb|AY966403.1| Callithrix jacchus cytosolic glutathione peroxidase (Gpx-1) mRNA,
           complete cds
          Length = 858

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 525 ccaccaggaacttctcaaagttcca 501



to top

>ref|NM_008160.2| Mus musculus glutathione peroxidase 1 (Gpx1), mRNA
          Length = 848

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 540 ccaccaggaacttctcaaagttcca 516



to top

>gb|BC070258.1| Homo sapiens cDNA clone MGC:88245 IMAGE:6452792, complete cds
          Length = 866

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 524 ccaccaggaacttctcaaagttcca 500



to top

>gb|BC103589.1| Mus musculus glutathione peroxidase 5, mRNA (cDNA clone MGC:124090
           IMAGE:40045837), complete cds
          Length = 1366

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 591 ccaccaggaacttctcaaagttcca 567



to top

>gb|BC103588.1| Mus musculus glutathione peroxidase 5, mRNA (cDNA clone MGC:124091
           IMAGE:40045838), complete cds
          Length = 1364

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 591 ccaccaggaacttctcaaagttcca 567



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                     
Query: 403      attcagctttaaaccttgtacaagcaaattgctttat 439
                ||||||||||||| ||||| |||||||| | ||||||
Sbjct: 13718357 attcagctttaaatcttgtgcaagcaaaatcctttat 13718321



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 474      tgattgcatggaaacgctagaatctcaaa 502
                |||||||| ||||| ||||||||||||||
Sbjct: 13718286 tgattgcagggaaatgctagaatctcaaa 13718258



to top

>emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome I, complete sequence
          Length = 3214944

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 468     ccaaattgattgcatggaaacgcta 492
               |||||||||||||| ||||||||||
Sbjct: 1308173 ccaaattgattgcacggaaacgcta 1308197



to top

>gb|BC086649.1| Mus musculus glutathione peroxidase 1, mRNA (cDNA clone MGC:113778
           IMAGE:6819448), complete cds
          Length = 854

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 523 ccaccaggaacttctcaaagttcca 499



to top

>gb|BC062227.1| Rattus norvegicus glutathione peroxidase 3, mRNA (cDNA clone
           MGC:72828 IMAGE:6921653), complete cds
          Length = 1478

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 609 ccaccaggaacttctcaaagttcca 585



to top

>gb|BC061950.1| Mus musculus glutathione peroxidase 3, mRNA (cDNA clone MGC:68217
           IMAGE:6528998), complete cds
          Length = 1495

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 581 ccaccaggaacttctcaaagttcca 557



to top

>gb|BC050378.1| Homo sapiens glutathione peroxidase 3 (plasma), mRNA (cDNA clone
           MGC:51890 IMAGE:5738272), complete cds
          Length = 1649

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 617 ccaccaggaacttctcaaagttcca 593



to top

>gb|BC007865.2| Homo sapiens glutathione peroxidase 1, transcript variant 1, mRNA
           (cDNA clone MGC:14399 IMAGE:4301275), complete cds
          Length = 851

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 518 ccaccaggaacttctcaaagttcca 494



to top

>gb|BC049235.1| Mus musculus glutathione peroxidase 3, mRNA (cDNA clone MGC:54712
           IMAGE:4221025), complete cds
          Length = 1442

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 593 ccaccaggaacttctcaaagttcca 569



to top

>gb|BC037134.1| Mus musculus glutathione peroxidase 3, mRNA (cDNA clone
           IMAGE:4972149)
          Length = 1480

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 603 ccaccaggaacttctcaaagttcca 579



to top

>gb|BC037027.1| Mus musculus glutathione peroxidase 3, mRNA (cDNA clone MGC:46926
           IMAGE:5370640), complete cds
          Length = 1476

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 624 ccaccaggaacttctcaaagttcca 600



to top

>gb|BC035841.1| Homo sapiens glutathione peroxidase 3 (plasma), mRNA (cDNA clone
           MGC:46126 IMAGE:5748087), complete cds
          Length = 1615

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 617 ccaccaggaacttctcaaagttcca 593



to top

>gb|BC025956.1| Homo sapiens cDNA clone IMAGE:5440952
          Length = 1648

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 617 ccaccaggaacttctcaaagttcca 593



to top

>gb|BC013601.1| Homo sapiens glutathione peroxidase 3 (plasma), mRNA (cDNA clone
           MGC:8913 IMAGE:3882071), complete cds
          Length = 1609

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 612 ccaccaggaacttctcaaagttcca 588



to top

>gb|BC000742.2| Homo sapiens glutathione peroxidase 1, transcript variant 1, mRNA
           (cDNA clone MGC:2335 IMAGE:3505654), complete cds
          Length = 863

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 531 ccaccaggaacttctcaaagttcca 507



to top

>gb|BC003339.1| Mus musculus glutathione peroxidase 3, mRNA (cDNA clone MGC:6076
           IMAGE:3257333), complete cds
          Length = 1448

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 589 ccaccaggaacttctcaaagttcca 565



to top

>gb|BC013218.1| Homo sapiens glutathione peroxidase 3 (plasma), mRNA (cDNA clone
           IMAGE:4149458)
          Length = 1474

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 612 ccaccaggaacttctcaaagttcca 588



to top

>gb|AC124460.5| Mus musculus BAC clone RP24-142P7 from chromosome 13, complete sequence
          Length = 184155

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 277    ccactaggaacttctcaaagttcca 301
              |||| ||||||||||||||||||||
Sbjct: 105538 ccaccaggaacttctcaaagttcca 105514



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 277   ccactaggaacttctcaaagttcca 301
             |||| ||||||||||||||||||||
Sbjct: 74023 ccaccaggaacttctcaaagttcca 74047



to top

>ref|XM_849924.1| PREDICTED: Canis familiaris similar to Plasma glutathione
           peroxidase precursor (GSHPx-P) (LOC612189), mRNA
          Length = 444

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 328 ccaccaggaacttctcaaagttcca 304



to top

>ref|XM_546297.2| PREDICTED: Canis familiaris similar to Plasma glutathione
           peroxidase precursor (GSHPx-P), transcript variant 1
           (LOC489179), mRNA
          Length = 1582

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 621 ccaccaggaacttctcaaagttcca 597



to top

>ref|XM_862342.1| PREDICTED: Canis familiaris similar to Plasma glutathione
           peroxidase precursor (GSHPx-P), transcript variant 3
           (LOC489179), mRNA
          Length = 1469

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 508 ccaccaggaacttctcaaagttcca 484



to top

>gb|BC100749.1| Mus musculus glutathione peroxidase 5, mRNA (cDNA clone MGC:124177
           IMAGE:40046457), complete cds
          Length = 1364

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 591 ccaccaggaacttctcaaagttcca 567



to top

>ref|NM_000581.2| Homo sapiens glutathione peroxidase 1 (GPX1), transcript variant 1,
           mRNA
          Length = 921

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 588 ccaccaggaacttctcaaagttcca 564



to top

>ref|NM_201397.1| Homo sapiens glutathione peroxidase 1 (GPX1), transcript variant 2,
           mRNA
          Length = 1200

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 867 ccaccaggaacttctcaaagttcca 843



to top

>ref|NM_008161.1| Mus musculus glutathione peroxidase 3 (Gpx3), mRNA
          Length = 1415

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 581 ccaccaggaacttctcaaagttcca 557



to top

>gb|AY327818.1| Homo sapiens glutathione peroxidase 1 (GPX1) gene, complete cds
          Length = 4877

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 277  ccactaggaacttctcaaagttcca 301
            |||| ||||||||||||||||||||
Sbjct: 2952 ccaccaggaacttctcaaagttcca 2928



to top

>gb|AC157907.2| Mus musculus chromosome 19, clone RP23-79H21, complete sequence
          Length = 153518

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 392    aaaaataggaaattcagcttt 412
              |||||||||||||||||||||
Sbjct: 131347 aaaaataggaaattcagcttt 131367



to top

>gb|AY310878.1| Homo sapiens glutathione peroxidase 3 (plasma) (GPX3) gene, complete
            cds
          Length = 11732

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 277  ccactaggaacttctcaaagttcca 301
            |||| ||||||||||||||||||||
Sbjct: 9543 ccaccaggaacttctcaaagttcca 9519



to top

>emb|Y00483.1|HSGSHPXG Human gene for gluthathione peroxidase
          Length = 1733

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 277  ccactaggaacttctcaaagttcca 301
            |||| ||||||||||||||||||||
Sbjct: 1253 ccaccaggaacttctcaaagttcca 1229



to top

>emb|Y00433.1|HSGSHPX Human mRNA for glutathione peroxidase (EC 1.11.1.9.)
          Length = 1134

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 820 ccaccaggaacttctcaaagttcca 796



to top

>emb|X58295.1|HSGPXP Human GPx-3 mRNA for plasma glutathione peroxidase
          Length = 1606

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 613 ccaccaggaacttctcaaagttcca 589



to top

>emb|X53780.1|MMARMEP2 Mouse mRNA for 24kDa major androgen regulated protein, arMEP24
          Length = 1471

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 427 ccaccaggaacttctcaaagttcca 403



to top

>emb|X13710.1|HSPEROXP H.sapiens unspliced mRNA for glutathione peroxidase
          Length = 1100

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 786 ccaccaggaacttctcaaagttcca 762



to top

>emb|X13709.1|HSPEROXR Human gpx1 mRNA for gluthatione peroxidase
          Length = 819

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 507 ccaccaggaacttctcaaagttcca 483



to top

>emb|X03920.1|MMGSHPX M.musculus GSHPx gene
          Length = 1498

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 277  ccactaggaacttctcaaagttcca 301
            |||| ||||||||||||||||||||
Sbjct: 1019 ccaccaggaacttctcaaagttcca 995



to top

>emb|AJ270955.1|OSA270955 Oryza sativa mRNA for putative phospholipid hydroperoxide
           glutathione peroxidase (riPHGPX gene)
          Length = 921

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 403 attcagctttaaaccttgtacaagcaaattgctttat 439
           ||||||||||||| ||||| |||||||| | ||||||
Sbjct: 365 attcagctttaaatcttgtgcaagcaaaatcctttat 329



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 474 tgattgcatggaaacgctagaatctcaaa 502
           |||||||| ||||| ||||||||||||||
Sbjct: 294 tgattgcagggaaatgctagaatctcaaa 266



to top

>emb|CR857195.1| Pongo pygmaeus mRNA; cDNA DKFZp469D1932 (from clone DKFZp469D1932)
          Length = 1650

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 630 ccaccaggaacttctcaaagttcca 606



to top

>emb|BX001068.7| Mouse DNA sequence from clone RP23-54E4 on chromosome 13 Contains the
              gene for a novel SCAN domain containing C2H2 type zinc
              finger protein, two novel genes (933017L02Rik,
              492150E05Rik), the Skz1 gene for SCAN-KRAB-zinc finger gene
              1, a ribosomal protein L29 (Rpl29) pseudogene, the Zfp96
              gene for Zinc finger protein 96, the gene for olfactory
              receptor MOR256-16, the gene for a novel protein similar to
              plasma glutathione peroxidase Gpx3, the (pseudo)gene for a
              novel protein similar to ribosomal protein L29 (Rpl29) and
              the Gpx5 gene for glutathione peroxidase 5 (epididymal
              androgen-related protein), complete sequence
          Length = 175880

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 277    ccactaggaacttctcaaagttcca 301
              |||| ||||||||||||||||||||
Sbjct: 167848 ccaccaggaacttctcaaagttcca 167824



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 277    ccactaggaacttctcaaagttcca 301
              |||| ||||||||||||||||||||
Sbjct: 136333 ccaccaggaacttctcaaagttcca 136357



to top

>emb|CR615956.1| full-length cDNA clone CS0DI066YD12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1600

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR615751.1| full-length cDNA clone CS0DI025YC23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1619

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|X84742.1|MMGPXG M.musculus GPX3 gene
          Length = 5585

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 277  ccactaggaacttctcaaagttcca 301
            |||| ||||||||||||||||||||
Sbjct: 4606 ccaccaggaacttctcaaagttcca 4582



to top

>gb|AC009385.8| Drosophila melanogaster 3L BAC RP98-23M20 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 178628

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 462    tgaaaaccaaattgattgcat 482
              |||||||||||||||||||||
Sbjct: 159508 tgaaaaccaaattgattgcat 159488



to top

>emb|CR626765.1| full-length cDNA clone CS0DI022YB17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1600

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR626479.1| full-length cDNA clone CS0CAP001YI17 of Thymus of Homo sapiens
           (human)
          Length = 838

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 522 ccaccaggaacttctcaaagttcca 498



to top

>emb|CR624695.1| full-length cDNA clone CS0DI081YG14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1564

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR624624.1| full-length cDNA clone CS0DI068YD13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1594

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR625755.1| full-length cDNA clone CS0DI056YJ21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1615

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR625290.1| full-length cDNA clone CS0DI018YK21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1490

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR623985.1| full-length cDNA clone CS0DI016YC06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1549

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR623984.1| full-length cDNA clone CS0DE006YH10 of Placenta of Homo sapiens
           (human)
          Length = 1528

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 612 ccaccaggaacttctcaaagttcca 588



to top

>emb|CR623805.1| full-length cDNA clone CS0DI033YB05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1625

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR623606.1| full-length cDNA clone CS0DE007YN18 of Placenta of Homo sapiens
           (human)
          Length = 1566

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR623599.1| full-length cDNA clone CS0DI026YB02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1560

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR623261.1| full-length cDNA clone CS0DI060YJ04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1603

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR623260.1| full-length cDNA clone CS0DI060YJ06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1539

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 602 ccaccaggaacttctcaaagttcca 578



to top

>emb|CR622704.1| full-length cDNA clone CS0DI078YJ19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1496

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR621904.1| full-length cDNA clone CS0DE003YH14 of Placenta of Homo sapiens
           (human)
          Length = 1607

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR621477.1| full-length cDNA clone CS0DI035YD05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1564

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR621207.1| full-length cDNA clone CS0DN001YF06 of Adult brain of Homo sapiens
           (human)
          Length = 1557

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 614 ccaccaggaacttctcaaagttcca 590



to top

>emb|CR620255.1| full-length cDNA clone CS0DD004YA07 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 828

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 531 ccaccaggaacttctcaaagttcca 507



to top

>emb|CR620123.1| full-length cDNA clone CS0DI005YK23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1577

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR619761.1| full-length cDNA clone CS0DM007YA24 of Fetal liver of Homo sapiens
           (human)
          Length = 1558

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR618652.1| full-length cDNA clone CS0DI011YJ21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1585

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR618599.1| full-length cDNA clone CS0DI004YN07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1557

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR617790.1| full-length cDNA clone CS0DN003YI16 of Adult brain of Homo sapiens
           (human)
          Length = 1436

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR617470.1| full-length cDNA clone CS0DI034YO05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1613

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR616153.1| full-length cDNA clone CS0DI062YB14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 374 ccaccaggaacttctcaaagttcca 350



to top

>emb|CR615996.1| full-length cDNA clone CS0DI082YN21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1594

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR615361.1| full-length cDNA clone CS0DD001YE17 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1575

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 617 ccaccaggaacttctcaaagttcca 593



to top

>emb|CR615321.1| full-length cDNA clone CS0DI003YM04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1558

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 613 ccaccaggaacttctcaaagttcca 589



to top

>emb|CR614747.1| full-length cDNA clone CS0DI086YP09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 849

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 556 ccaccaggaacttctcaaagttcca 532



to top

>emb|CR614185.1| full-length cDNA clone CS0DC007YG13 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1560

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR613980.1| full-length cDNA clone CS0DI052YK21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1552

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 617 ccaccaggaacttctcaaagttcca 593



to top

>emb|CR612224.1| full-length cDNA clone CS0DI055YA13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1556

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR612204.1| full-length cDNA clone CS0DD001YH04 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1558

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 599 ccaccaggaacttctcaaagttcca 575



to top

>emb|CR613346.1| full-length cDNA clone CS0DI041YL20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1596

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR613209.1| full-length cDNA clone CS0DI022YB21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1602

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR610586.1| full-length cDNA clone CS0DI083YL07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1601

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR609961.1| full-length cDNA clone CS0DN002YE24 of Adult brain of Homo sapiens
           (human)
          Length = 1560

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR608662.1| full-length cDNA clone CS0DE011YH16 of Placenta of Homo sapiens
           (human)
          Length = 1617

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR607596.1| full-length cDNA clone CS0DC006YC07 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1031

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 87  ccaccaggaacttctcaaagttcca 63



to top

>emb|CR606740.1| full-length cDNA clone CS0DI086YD09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1556

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 616 ccaccaggaacttctcaaagttcca 592



to top

>emb|CR605862.1| full-length cDNA clone CS0DI010YG15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1562

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>gb|AC009380.6| Drosophila melanogaster 3L BAC RP98-17L5 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 187973

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 462    tgaaaaccaaattgattgcat 482
              |||||||||||||||||||||
Sbjct: 103839 tgaaaaccaaattgattgcat 103819



to top

>emb|CR603874.1| full-length cDNA clone CS0DI073YI23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1565

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR602168.1| full-length cDNA clone CS0DB004YP22 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1273

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 308 ccaccaggaacttctcaaagttcca 284



to top

>emb|CR601795.1| full-length cDNA clone CS0DI068YJ17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 792

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 476 ccaccaggaacttctcaaagttcca 452



to top

>emb|CR601731.1| full-length cDNA clone CS0DI027YA05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1558

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 614 ccaccaggaacttctcaaagttcca 590



to top

>emb|CR601235.1| full-length cDNA clone CS0DI004YH05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1534

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 616 ccaccaggaacttctcaaagttcca 592



to top

>emb|CR600420.1| full-length cDNA clone CS0DF015YJ07 of Fetal brain of Homo sapiens
           (human)
          Length = 1616

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR599819.1| full-length cDNA clone CS0DM006YE09 of Fetal liver of Homo sapiens
           (human)
          Length = 1621

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR599527.1| full-length cDNA clone CS0DE008YL19 of Placenta of Homo sapiens
           (human)
          Length = 1493

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 612 ccaccaggaacttctcaaagttcca 588



to top

>emb|CR599488.1| full-length cDNA clone CS0DI057YL15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1608

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR599318.1| full-length cDNA clone CS0DM006YG13 of Fetal liver of Homo sapiens
           (human)
          Length = 1560

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 616 ccaccaggaacttctcaaagttcca 592



to top

>emb|CR598855.1| full-length cDNA clone CS0DI016YK01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1557

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 612 ccaccaggaacttctcaaagttcca 588



to top

>emb|CR598624.1| full-length cDNA clone CS0DI011YM22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1559

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 614 ccaccaggaacttctcaaagttcca 590



to top

>emb|CR598094.1| full-length cDNA clone CS0DI084YG03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1602

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR597736.1| full-length cDNA clone CS0DI083YH04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1558

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR597434.1| full-length cDNA clone CS0DI043YL12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1565

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR597297.1| full-length cDNA clone CS0DI021YG02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1602

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR596721.1| full-length cDNA clone CS0DM009YI05 of Fetal liver of Homo sapiens
           (human)
          Length = 1603

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR596498.1| full-length cDNA clone CS0DI064YH11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1602

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR595371.1| full-length cDNA clone CS0DC025YE23 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 849

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 533 ccaccaggaacttctcaaagttcca 509



to top

>emb|CR594135.1| full-length cDNA clone CS0DI079YO10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1560

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR594536.1| full-length cDNA clone CS0DI017YJ20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1558

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR593150.1| full-length cDNA clone CS0DI062YE07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1598

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR592896.1| full-length cDNA clone CS0DI022YN18 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1476

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR591749.1| full-length cDNA clone CS0DI023YK02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1600

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>emb|CR591707.1| full-length cDNA clone CS0DM012YM01 of Fetal liver of Homo sapiens
           (human)
          Length = 1522

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 619 ccaccaggaacttctcaaagttcca 595



to top

>emb|CR591549.1| full-length cDNA clone CS0DI025YG07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1576

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>ref|NM_002084.3| Homo sapiens glutathione peroxidase 3 (plasma) (GPX3), mRNA
          Length = 1779

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 782 ccaccaggaacttctcaaagttcca 758



to top

>emb|CR591367.1| full-length cDNA clone CS0DI001YD20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1539

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 612 ccaccaggaacttctcaaagttcca 588



to top

>emb|CR591081.1| full-length cDNA clone CS0DE013YL14 of Placenta of Homo sapiens
           (human)
          Length = 1550

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 615 ccaccaggaacttctcaaagttcca 591



to top

>emb|CR590594.1| full-length cDNA clone CS0DC006YK10 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1576

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 616 ccaccaggaacttctcaaagttcca 592



to top

>emb|CR590253.1| full-length cDNA clone CS0DI032YM13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1570

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 657 ccaccaggaacttctcaaagttcca 633



to top

>gb|AY077655.1| Arabidopsis thaliana AT4g11600/T5C23_30 mRNA, complete cds
          Length = 699

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 564 ccacattgagaagcaacattaacaatcaa 592
           ||||||||||||||||| || ||||||||
Sbjct: 317 ccacattgagaagcaacgttcacaatcaa 289



to top

>dbj|AK146760.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920050N18 product:glutathione peroxidase
           3, full insert sequence
          Length = 1436

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 606 ccaccaggaacttctcaaagttcca 582



to top

>dbj|AK154833.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630108G20
           product:glutathione peroxidase 1, full insert sequence
          Length = 849

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 540 ccaccaggaacttctcaaagttcca 516



to top

>dbj|AK150548.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830011M22 product:glutathione
           peroxidase 1, full insert sequence
          Length = 847

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 541 ccaccaggaacttctcaaagttcca 517



to top

>dbj|AK160388.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610006D11 product:glutathione peroxidase
           1, full insert sequence
          Length = 847

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 541 ccaccaggaacttctcaaagttcca 517



to top

>emb|CR407475.1| Gallus gallus finished cDNA, clone ChEST136c12
          Length = 980

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 626 ccaccaggaacttctcaaagttcca 602



to top

>dbj|AK010999.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510026G08 product:glutathione peroxidase
           1, full insert sequence
          Length = 848

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 540 ccaccaggaacttctcaaagttcca 516



to top

>dbj|AK029731.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930516L02 product:glutathione peroxidase
           5, full insert sequence
          Length = 900

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 592 ccaccaggaacttctcaaagttcca 568



to top

>gb|AC008641.7| Homo sapiens chromosome 5 clone CTB-17P3, complete sequence
          Length = 176629

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 277   ccactaggaacttctcaaagttcca 301
             |||| ||||||||||||||||||||
Sbjct: 21990 ccaccaggaacttctcaaagttcca 21966



to top

>gb|M83094.1|HUMGLPEX Homo sapiens cytosolic selenium-dependent glutathione peroxidase
            gene, complete cds, and rhoh12 gene, 3' end
          Length = 4407

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 277  ccactaggaacttctcaaagttcca 301
            |||| ||||||||||||||||||||
Sbjct: 3337 ccaccaggaacttctcaaagttcca 3313



to top

>dbj|AK006161.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700020G18 product:SIMILAR TO GLUTATHIONE
           PEROXIDASE 3 (PLASMA) homolog [Mus musculus], full
           insert sequence
          Length = 477

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 236 ccaccaggaacttctcaaagttcca 212



to top

>gb|U13705.1|MMU13705 Mus musculus domesticus C57BL/6J plasma glutathione peroxidase
           (MUSPGPX) mRNA, complete cds
          Length = 1415

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 581 ccaccaggaacttctcaaagttcca 557



to top

>gb|M21304.1|HUMGLP Human glutathione peroxidase (GPX1) mRNA, complete cds
          Length = 856

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 543 ccaccaggaacttctcaaagttcca 519



to top

>gb|AY039863.1| Arabidopsis thaliana AT4g11600/T5C23_30 mRNA, complete cds
          Length = 905

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 564 ccacattgagaagcaacattaacaatcaa 592
           ||||||||||||||||| || ||||||||
Sbjct: 342 ccacattgagaagcaacgttcacaatcaa 314



to top

>dbj|AK002219.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610005C19 product:glutathione peroxidase
           3, full insert sequence
          Length = 1440

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 606 ccaccaggaacttctcaaagttcca 582



to top

>dbj|AK002262.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610006P13 product:glutathione peroxidase
           3, full insert sequence
          Length = 1435

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 605 ccaccaggaacttctcaaagttcca 581



to top

>dbj|AK002245.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610006H04 product:glutathione peroxidase
           1, full insert sequence
          Length = 845

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 540 ccaccaggaacttctcaaagttcca 516



to top

>dbj|AK028171.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510012H20 product:glutathione peroxidase
           1, full insert sequence
          Length = 844

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 540 ccaccaggaacttctcaaagttcca 516



to top

>dbj|AK004942.1| Mus musculus adult male liver cDNA, RIKEN full-length enriched
           library, clone:1300008G01 product:glutathione peroxidase
           3, full insert sequence
          Length = 1437

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 606 ccaccaggaacttctcaaagttcca 582



to top

>dbj|AK033841.1| Mus musculus adult male epididymis cDNA, RIKEN full-length enriched
           library, clone:9230118F08 product:glutathione peroxidase
           5, full insert sequence
          Length = 1223

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 184 ccaccaggaacttctcaaagttcca 160



to top

>emb|BX931521.2| Gallus gallus finished cDNA, clone ChEST388k4
          Length = 996

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 644 ccaccaggaacttctcaaagttcca 620



to top

>dbj|AK011019.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510028M20 product:glutathione peroxidase
           1, full insert sequence
          Length = 847

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 540 ccaccaggaacttctcaaagttcca 516



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                     
Query: 403      attcagctttaaaccttgtacaagcaaattgctttat 439
                ||||||||||||| ||||| |||||||| | ||||||
Sbjct: 13713332 attcagctttaaatcttgtgcaagcaaaatcctttat 13713296



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 474      tgattgcatggaaacgctagaatctcaaa 502
                |||||||| ||||| ||||||||||||||
Sbjct: 13713261 tgattgcagggaaatgctagaatctcaaa 13713233



to top

>dbj|AB121009.1| Cebus apella gpx3 mRNA for glutathione peroxidase 3, complete cds
          Length = 681

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 565 ccaccaggaacttctcaaagttcca 541



to top

>dbj|AB121008.1| Macaca fuscata gpx3 mRNA for glutathione peroxidase 3, complete cds
          Length = 681

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 565 ccaccaggaacttctcaaagttcca 541



to top

>dbj|AB121007.1| Hylobates lar gpx3 mRNA for glutathione peroxidase 3, complete cds
          Length = 681

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 565 ccaccaggaacttctcaaagttcca 541



to top

>dbj|AB121006.1| Pongo pygmaeus gpx3 mRNA for glutathione peroxidase 3, complete cds
          Length = 681

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 565 ccaccaggaacttctcaaagttcca 541



to top

>dbj|AB120999.1| Cebus apella gpx1 mRNA for glutathione peroxidase 1, complete cds
          Length = 606

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 502 ccaccaggaacttctcaaagttcca 478



to top

>dbj|AB120998.1| Hylobates lar gpx1 mRNA for glutathione peroxidase 1, complete cds
          Length = 606

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 502 ccaccaggaacttctcaaagttcca 478



to top

>dbj|AB120997.1| Pongo pygmaeus gpx1 mRNA for glutathione peroxidase 1, complete cds
          Length = 606

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 502 ccaccaggaacttctcaaagttcca 478



to top

>gb|AC008666.5|AC008666 Homo sapiens chromosome 5 clone CTB-35A8, complete sequence
          Length = 99108

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 277   ccactaggaacttctcaaagttcca 301
             |||| ||||||||||||||||||||
Sbjct: 76914 ccaccaggaacttctcaaagttcca 76938



to top

>emb|BX826695.1|CNS0A40O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB55ZH08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 784

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 564 ccacattgagaagcaacattaacaatcaa 592
           ||||||||||||||||| || ||||||||
Sbjct: 222 ccacattgagaagcaacgttcacaatcaa 194



to top

>ref|NM_147165.1| Rattus norvegicus glutathione peroxidase 6 (Gpx6), mRNA
          Length = 1151

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 610 ccaccaggaacttctcaaagttcca 586



to top

>ref|NM_022525.2| Rattus norvegicus glutathione peroxidase 3 (Gpx3), mRNA
          Length = 1478

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 609 ccaccaggaacttctcaaagttcca 585



to top

>gb|AF217787.1|AF217787 Homo sapiens extracellular glutathione peroxidase mRNA, complete
           cds
          Length = 697

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 569 ccaccaggaacttctcaaagttcca 545



to top

>emb|BX931419.1| Gallus gallus finished cDNA, clone ChEST335o15
          Length = 967

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 613 ccaccaggaacttctcaaagttcca 589



to top

>gb|AC019057.8| Homo sapiens BAC clone RP11-121A1 from 2, complete sequence
          Length = 186896

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   gcttaactgaagccagactca 180
             |||||||||||||||||||||
Sbjct: 78951 gcttaactgaagccagactca 78971



to top

>gb|AY088647.1| Arabidopsis thaliana clone 8846 mRNA, complete sequence
          Length = 829

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 564 ccacattgagaagcaacattaacaatcaa 592
           ||||||||||||||||| || ||||||||
Sbjct: 265 ccacattgagaagcaacgttcacaatcaa 237



to top

>gb|AC137076.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBb0033D20, from chromosome 3, complete sequence
          Length = 128707

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 403    attcagctttaaaccttgtacaagcaaattgctttat 439
              ||||||||||||| ||||| |||||||| | ||||||
Sbjct: 109029 attcagctttaaatcttgtgcaagcaaaatcctttat 108993



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 474    tgattgcatggaaacgctagaatctcaaa 502
              |||||||| ||||| ||||||||||||||
Sbjct: 108958 tgattgcagggaaatgctagaatctcaaa 108930



to top

>dbj|AK190707.1| Mus musculus cDNA, clone:Y1G0103J01, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000029796, based on BLAT search
          Length = 429

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 320 ccaccaggaacttctcaaagttcca 344



to top

>emb|BX088649.8| Zebrafish DNA sequence from clone CH211-204M6 in linkage group 17,
              complete sequence
          Length = 163494

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 41     tatacacatcagtgaattatt 61
              |||||||||||||||||||||
Sbjct: 144843 tatacacatcagtgaattatt 144823



to top

>dbj|BS000214.2| Pan troglodytes chromosome 22 clone:RP43-036K01, map 22, complete
             sequences
          Length = 115787

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 277   ccactaggaacttctcaaagttcca 301
             |||| ||||||||||||||||||||
Sbjct: 49103 ccaccaggaacttctcaaagttcca 49127



to top

>emb|AL593846.15| Mouse DNA sequence from clone RP23-171H16 on chromosome 11, complete
             sequence
          Length = 213263

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 277   ccactaggaacttctcaaagttcca 301
             |||| ||||||||||||||||||||
Sbjct: 34034 ccaccaggaacttctcaaagttcca 34010



to top

>dbj|AB001568.1| Arabidopsis thaliana mRNA for phospholipid hydroperoxide
           glutathione peroxidase-like protein, complete cds
          Length = 803

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 564 ccacattgagaagcaacattaacaatcaa 592
           ||||||||||||||||| || ||||||||
Sbjct: 240 ccacattgagaagcaacgttcacaatcaa 212



to top

>gb|AC121247.2| Homo sapiens chromosome 3 clone RP11-3B7, complete sequence
          Length = 170787

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 277   ccactaggaacttctcaaagttcca 301
             |||| ||||||||||||||||||||
Sbjct: 23409 ccaccaggaacttctcaaagttcca 23385



to top

>dbj|AK130160.1| Homo sapiens cDNA FLJ26650 fis, clone MPE04848, highly similar to
           Glutathione peroxidase (EC 1.11.1.9)
          Length = 863

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 549 ccaccaggaacttctcaaagttcca 525



to top

>ref|NM_145451.1| Mus musculus glutathione peroxidase 6 (Gpx6), mRNA
          Length = 1324

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 597 ccaccaggaacttctcaaagttcca 573



to top

>dbj|AK073938.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076L03, full
           insert sequence
          Length = 881

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 403 attcagctttaaaccttgtacaagcaaattgctttat 439
           ||||||||||||| ||||| |||||||| | ||||||
Sbjct: 388 attcagctttaaatcttgtgcaagcaaaatcctttat 352



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 474 tgattgcatggaaacgctagaatctcaaa 502
           |||||||| ||||| ||||||||||||||
Sbjct: 317 tgattgcagggaaatgctagaatctcaaa 289



to top

>gb|AY104663.1| Zea mays PCO114914 mRNA sequence
          Length = 1013

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 204 ttctggatgtccttctcaatt 224
           |||||||||||||||||||||
Sbjct: 610 ttctggatgtccttctcaatt 590



to top

>gb|AE003519.3| Drosophila melanogaster chromosome 3L, section 66 of 83 of the complete
             sequence
          Length = 294542

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 462   tgaaaaccaaattgattgcat 482
             |||||||||||||||||||||
Sbjct: 63669 tgaaaaccaaattgattgcat 63649



to top

>gb|BC088710.1| Xenopus laevis hypothetical LOC496242, mRNA (cDNA clone MGC:99284
           IMAGE:7211219), complete cds
          Length = 1237

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 282 aggaacttctcaaagttccac 302
           |||||||||||||||||||||
Sbjct: 502 aggaacttctcaaagttccac 482



to top

>gb|AF030132.1|AF030132 Arabidopsis thaliana glutathione peroxidase mRNA, complete cds
          Length = 905

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 564 ccacattgagaagcaacattaacaatcaa 592
           ||||||||||||||||| || ||||||||
Sbjct: 335 ccacattgagaagcaacgttcacaatcaa 307



to top

>gb|AF045185.1|AF045185 Canis familiaris epididymis-specific secretory glutathione
           peroxidase-like protein GPX5 mRNA, complete cds
          Length = 1524

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 645 ccaccaggaacttctcaaagttcca 621



to top

>emb|AM159087.1| Plantago major mRNA for glutathion peroxidase (gpx1 gene)
          Length = 695

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 576 gcaacattaacaatcaacagtgcttttcccttg 608
           ||||||||||||||||||||  | |||||||||
Sbjct: 154 gcaacattaacaatcaacaggacctttcccttg 122



to top

>gb|M76733.1|RATRY2D1A Rat odorant-metabolizing protein (RY2D1) mRNA, complete cds
          Length = 1151

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 610 ccaccaggaacttctcaaagttcca 586



to top

>gb|M68896.1|MUSGPOAD Mouse androgen-dependent glutathione peroxidase-like protein gene,
            complete cds
          Length = 8076

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 277  ccactaggaacttctcaaagttcca 301
            |||| ||||||||||||||||||||
Sbjct: 6152 ccaccaggaacttctcaaagttcca 6128



to top

>dbj|D00680.1|RATPGP Rattus norvegicus mRNA for plasma glutathione peroxidase precursor,
           complete cds
          Length = 1034

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 277 ccactaggaacttctcaaagttcca 301
           |||| ||||||||||||||||||||
Sbjct: 698 ccaccaggaacttctcaaagttcca 674



to top

>dbj|D16362.1|HUMGPXP3 Homo sapiens DNA for plasma glutathione peroxidase, exon 3, 4 and 5
          Length = 2918

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 277  ccactaggaacttctcaaagttcca 301
            |||| ||||||||||||||||||||
Sbjct: 1304 ccaccaggaacttctcaaagttcca 1280


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,760,833
Number of Sequences: 3902068
Number of extensions: 6760833
Number of successful extensions: 141984
Number of sequences better than 10.0: 379
Number of HSP's better than 10.0 without gapping: 379
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 140873
Number of HSP's gapped (non-prelim): 1095
length of query: 615
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 592
effective length of database: 17,143,297,704
effective search space: 10148832240768
effective search space used: 10148832240768
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top