>gb|BC065810.1| Mus musculus cDNA clone IMAGE:3825663, partial cds
          Length = 906

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 161 aggcactgcctctttatccagtt 183
           |||||||||||||||||||||||
Sbjct: 503 aggcactgcctctttatccagtt 481

>ref|XM_701999.1| PREDICTED: Danio rerio similar to Solute carrier family 13
            (sodium-dependent dicarboxylate transporter), member 2,
            transcript variant 7 (LOC572872), mRNA
          Length = 2502

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 179  cagtttcctcttcttttcagctt 201
            |||||||||||||||||||||||
Sbjct: 1303 cagtttcctcttcttttcagctt 1281

>emb|AL596384.17| Mouse DNA sequence from clone RP23-353J21 on chromosome 11, complete
             sequence
          Length = 219695

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 161   aggcactgcctctttatccagtt 183
             |||||||||||||||||||||||
Sbjct: 32558 aggcactgcctctttatccagtt 32580

>dbj|AB093603.1| Turnip mosaic virus gene for polyprotein, complete cds,
            isolate:PV0104
          Length = 9798

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 182  tttcctcttcttttcagcttgcttct 207
            |||||||| |||||||||||||||||
Sbjct: 8785 tttcctctccttttcagcttgcttct 8760

>dbj|AB076532.1| Turnip mosaic virus CP gene for polyprotein, partial cds,
           isolate:PV0104
          Length = 864

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 182 tttcctcttcttttcagcttgcttct 207
           |||||||| |||||||||||||||||
Sbjct: 63  tttcctctccttttcagcttgcttct 38

>gb|AY739095.1| Takifugu rubripes frMCM8, frQ9UJA2, frPLCB1, frAL834445, frCDC5L, and
             frSUPTH3 genes, complete sequence; frRUNT (frRUNT) gene,
             complete cds; and frFSTL6 gene, complete sequence
          Length = 109075

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 179   cagtttcctcttcttttcagcttgc 203
             ||||||||||| |||||||||||||
Sbjct: 67447 cagtttcctctccttttcagcttgc 67423

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
               sequence
          Length = 1632307

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 318     atgaagtctggggatggtgga 338
               |||||||||||||||||||||
Sbjct: 1606065 atgaagtctggggatggtgga 1606085

>gb|AC090338.6| Homo sapiens chromosome 18, clone RP11-704C2, complete sequence
          Length = 200525

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 173  tttatccagtttcctcttctt 193
            |||||||||||||||||||||
Sbjct: 6847 tttatccagtttcctcttctt 6827

>gb|AC021506.5|AC021506 Homo sapiens chromosome 18, clone RP11-173L6, complete sequence
          Length = 155863

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 173   tttatccagtttcctcttctt 193
             |||||||||||||||||||||
Sbjct: 28614 tttatccagtttcctcttctt 28634

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 186     ctcttcttttcagcttgctt 205
               ||||||||||||||||||||
Sbjct: 3659791 ctcttcttttcagcttgctt 3659772

>gb|BT013557.1| Lycopersicon esculentum clone 132294F, mRNA sequence
          Length = 2034

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 189 ttcttttcagcttgcttctt 208
           ||||||||||||||||||||
Sbjct: 632 ttcttttcagcttgcttctt 613

>gb|BC088560.1| Xenopus tropicalis zinc finger, MYND-type containing 12, mRNA (cDNA
           clone MGC:97745 IMAGE:6987619), complete cds
          Length = 1183

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 68  cctactattgtgattcagat 87
           ||||||||||||||||||||
Sbjct: 152 cctactattgtgattcagat 171

>gb|AC110822.6| Mus musculus BAC clone RP24-226H7 from chromosome 9, complete sequence
          Length = 144131

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 279   ggtgagagcttgtatcagat 298
             ||||||||||||||||||||
Sbjct: 64407 ggtgagagcttgtatcagat 64388

>emb|CR854849.7| Human DNA sequence from clone RP13-79M23 on chromosome 1, complete
              sequence
          Length = 153012

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 324    tctggggatggtggagcaag 343
              ||||||||||||||||||||
Sbjct: 128842 tctggggatggtggagcaag 128861

>emb|BX470067.4| Human DNA sequence from clone WI2-84067D5 on chromosome 1 Contains a
             two preferentially expressed antigen in melanoma (PRAME)
             pseudogenes and the 5' end of the gene for a novel protein
             similar to preferentially expressed antigen in melanoma
             (PRAME), complete sequence
          Length = 41516

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 324   tctggggatggtggagcaag 343
             ||||||||||||||||||||
Sbjct: 24417 tctggggatggtggagcaag 24436

>emb|AL603890.14| Human DNA sequence from clone RP11-584P2 on chromosome 1 Contains the
            3' end of a novel gene  similar to preferentially
            expressed antigen in melanoma (PRAME), two novel proteins
            similar to preferentially expressed antigen in melanoma
            (PRAME), a novel gene and a CpG island, complete sequence
          Length = 88806

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 324  tctggggatggtggagcaag 343
            ||||||||||||||||||||
Sbjct: 1427 tctggggatggtggagcaag 1408

>emb|AL365443.16| Human DNA sequence from clone RP11-219C24 on chromosome 1 Contains six
              novel genes similar to preferentially expressed antigen in
              melanoma (PRAME), two novel genes, two preferentially
              expressed antigen in melanoma (PRAME) pseudogenes and a CpG
              island, complete sequence
          Length = 184591

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 324    tctggggatggtggagcaag 343
              ||||||||||||||||||||
Sbjct: 153698 tctggggatggtggagcaag 153717

>emb|AL022101.1|HS845O24 Human DNA sequence from clone RP5-845O24 on chromosome 1p36.1-36.2
             Contains the 3' end of the gene for a novel protein
             similar to preferentially expressed antigen in melanoma
             (PRAME) (LOC65121), four genes for novel proteins similar
             to preferentially expressed antigen in melanoma (PRAME)
             (LOC343068, LOC65122, LOC343070 and LOC343071), a novel
             gene, a pseudogene similar to preferentially expressed
             antigen in melanoma (PRAME) and the gene for a novel
             protein similar to heterogeneous nuclear ribonucleoprotein
             C (C1/C2) (HNRPC) (LOC343069), complete sequence
          Length = 119198

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 324   tctggggatggtggagcaag 343
             ||||||||||||||||||||
Sbjct: 11437 tctggggatggtggagcaag 11418

>ref|NM_001011379.1| Xenopus tropicalis zinc finger, MYND-type containing 12 (zmynd12),
           mRNA
          Length = 1183

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 68  cctactattgtgattcagat 87
           ||||||||||||||||||||
Sbjct: 152 cctactattgtgattcagat 171

>emb|CR854856.5| Human DNA sequence from clone RP13-299H21 on chromosome 1, complete
             sequence
          Length = 186712

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 324   tctggggatggtggagcaag 343
             ||||||||||||||||||||
Sbjct: 82852 tctggggatggtggagcaag 82833

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 195      tcagcttgcttcttgcctga 214
                ||||||||||||||||||||
Sbjct: 20485815 tcagcttgcttcttgcctga 20485796

>dbj|AP004225.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
            clone:B1156H12
          Length = 159509

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 195  tcagcttgcttcttgcctga 214
            ||||||||||||||||||||
Sbjct: 9637 tcagcttgcttcttgcctga 9618

>dbj|AK101868.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033070D24, full
            insert sequence
          Length = 3160

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 195  tcagcttgcttcttgcctga 214
            ||||||||||||||||||||
Sbjct: 2660 tcagcttgcttcttgcctga 2679

>emb|CT033761.14| Mouse DNA sequence from clone RP23-203P12 on chromosome 9, complete
              sequence
          Length = 208050

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 279    ggtgagagcttgtatcagat 298
              ||||||||||||||||||||
Sbjct: 118319 ggtgagagcttgtatcagat 118300

>dbj|AK060747.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F03, full
            insert sequence
          Length = 1595

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 195  tcagcttgcttcttgcctga 214
            ||||||||||||||||||||
Sbjct: 1110 tcagcttgcttcttgcctga 1129

>emb|CR848399.2| Xenopus tropicalis finished cDNA, clone TNeu136j05
          Length = 1163

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 68  cctactattgtgattcagat 87
           ||||||||||||||||||||
Sbjct: 155 cctactattgtgattcagat 174

>emb|AL844550.5| Mouse DNA sequence from clone RP23-277K21 on chromosome 2, complete
             sequence
          Length = 118080

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 272   gggtggcggtgagagcttgt 291
             ||||||||||||||||||||
Sbjct: 60949 gggtggcggtgagagcttgt 60930


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,736,912
Number of Sequences: 3902068
Number of extensions: 3736912
Number of successful extensions: 79064
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78988
Number of HSP's gapped (non-prelim): 76
length of query: 396
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 374
effective length of database: 17,147,199,772
effective search space: 6413052714728
effective search space used: 6413052714728
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)