ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal18i18
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete se... 98 5e-17
2gb|DQ128029.1| Triticum turgidum clone Td3-2, genomic sequence 56 2e-04
3gb|DQ128040.1| Triticum aestivum clone A4-4 Ty3/gypsy-like retro... 50 0.011
4gb|AY204215.1| Hordeum vulgare subsp. spontaneum clone Ghs-L-4 T... 48 0.043
5gb|CP000021.1| Vibrio fischeri ES114 chromosome II, complete seq... 44 0.68
6emb|CR854851.12| Zebrafish DNA sequence from clone DKEY-98D7 in ... 44 0.68
7emb|BX293999.7| Mouse DNA sequence from clone RP24-213L10 on chr... 44 0.68
8emb|AL663053.12| Mouse DNA sequence from clone RP23-436M12 on ch... 44 0.68
9emb|AL604045.7| Mouse DNA sequence from clone RP23-418O11 on chr... 44 0.68
10gb|AC146432.3| Pan troglodytes BAC clone RP43-19M2 from 7, compl... 42 2.7
11gb|DQ128063.1| Triticum monococcum clone tm3-1, genomic sequence 42 2.7
12gb|DQ128062.1| Triticum monococcum clone p8-3, genomic sequence 42 2.7
13gb|DQ128055.1| Triticum aestivum clone p3-3, genomic sequence 42 2.7
14gb|DQ128054.1| Triticum aestivum clone p3-2, genomic sequence 42 2.7
15gb|DQ145754.1| Triticum aestivum clone A3-3, genomic sequence 42 2.7
16gb|DQ128047.1| Triticum aestivum clone P8-1 Ty3/gypsy-like retro... 42 2.7
17gb|DQ128046.1| Triticum aestivum clone P4-6 Ty3/gypsy-like retro... 42 2.7
18gb|DQ128041.1| Triticum aestivum clone A4-5 Ty3/gypsy-like retro... 42 2.7
19gb|DQ128039.1| Triticum aestivum clone A4-3 Ty3/gypsy-like retro... 42 2.7
20gb|DQ128037.1| Triticum aestivum clone A3-6 Ty3/gypsy-like retro... 42 2.7
21gb|DQ128035.1| Triticum aestivum clone A3-4 Ty3/gypsy-like retro... 42 2.7
22gb|AC005078.1| Homo sapiens BAC clone CTA-252K19 from 7, complet... 42 2.7
23emb|AL627232.6| Human DNA sequence from clone RP11-363P13 on chr... 42 2.7
24emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 42 2.7
25emb|BX571723.7| Zebrafish DNA sequence from clone DKEYP-51D5 in ... 42 2.7
26gb|AC010243.7| Homo sapiens chromosome 5 clone CTC-361G14, compl... 42 2.7
27dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 42 2.7
28gb|AC074318.5| Staphylococcus aureus clone sabac-108, complete s... 42 2.7
29gb|AC067942.6| Homo sapiens BAC clone RP11-791G16 from 4, comple... 42 2.7
30gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete... 42 2.7
31gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 42 2.7
32gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl... 42 2.7
33gb|AC146038.2| Pan troglodytes BAC clone RP43-96B12 from chromos... 42 2.7
34gb|AC025591.8| Staphylococcus aureus clone sabac-134, complete s... 42 2.7
35dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 42 2.7
36dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 42 2.7
37emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2... 42 2.7
38emb|AJ938182.1| Staphylococcus aureus RF122 complete genome 42 2.7
39dbj|AP001575.3| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 2.7 
>gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete sequence
          Length = 285506

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 73/81 (90%)
 Strand = Plus / Minus

                                                                          
Query: 295    cgctcctctccaaacacgcaatctggccaagacaatagcgagggacatgccagtaagtac 354
              ||||||||||||  || | |||||||||||||||||||| ||||||| |||||| |||||
Sbjct: 265849 cgctcctctccacgcaagaaatctggccaagacaatagccagggacaagccagtgagtac 265790

                                   
Query: 355    tttgaatgtactcgtaaacat 375
              |||||||||||||| ||||||
Sbjct: 265789 tttgaatgtactcgcaaacat 265769



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                  
Query: 681    aataacatgcatgccatagtcgggcgtntgagcgacaccacataaagggctt 732
              ||||||| |||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 265623 aataacaagcatgccacagtcgggcgtctgagcgacaccacataaagggctt 265572



 Score = 77.8 bits (39), Expect = 5e-11
 Identities = 41/42 (97%)
 Strand = Plus / Minus

                                                        
Query: 691    atgccatagtcgggcgtntgagcgacaccacataaagggctt 732
              ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 265213 atgccatagtcgggcgtctgagcgacaccacataaagggctt 265172



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                        
Query: 691    atgccatagtcgggcgtntgagcgacaccacataaagggctt 732
              |||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 265563 atgccacagtcgggcgtctgagcgacaccacataaagggctt 265522



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                        
Query: 691    atgccatagtcgggcgtntgagcgacaccacataaagggctt 732
              |||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 265513 atgccacagtcgggcgtctgagcgacaccacataaagggctt 265472



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                        
Query: 691    atgccatagtcgggcgtntgagcgacaccacataaagggctt 732
              |||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 265413 atgccacagtcgggcgtctgagcgacaccacataaagggctt 265372



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                        
Query: 691    atgccatagtcgggcgtntgagcgacaccacataaagggctt 732
              |||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 265313 atgccacagtcgggcgtctgagcgacaccacataaagggctt 265272



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                                
Query: 699    gtcgggcgtntgagcgacaccacataaagggctt 732
              ||||||||| ||||||||||||||||||||||||
Sbjct: 265455 gtcgggcgtctgagcgacaccacataaagggctt 265422



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                        
Query: 691    atgccatagtcgggcgtntgagcgacaccacataaagggctt 732
              |||||| |||||||||| |||| |||||||||||||||||||
Sbjct: 265363 atgccacagtcgggcgtctgagagacaccacataaagggctt 265322



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                        
Query: 691    atgccatagtcgggcgtntgagcgacaccacataaagggctt 732
              |||||| |||||||||| ||||||||||||||||| ||||||
Sbjct: 265263 atgccacagtcgggcgtctgagcgacaccacataaggggctt 265222



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                        
Query: 691    atgccatagtcgggcgtntgagcgacaccacataaagggctt 732
              |||||| |||||||||| | ||||||||||||||||||||||
Sbjct: 265163 atgccacagtcgggcgtctaagcgacaccacataaagggctt 265122
to top
>gb|DQ128029.1| Triticum turgidum clone Td3-2, genomic sequence
          Length = 403

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 698 agtcgggcgtntgagcgacaccacataaagggctt 732
           |||||||||| | ||||||||||||||||||||||
Sbjct: 279 agtcgggcgtcttagcgacaccacataaagggctt 313



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 698 agtcgggcgtntgagcgacaccacataaagggctt 732
           |||||||||| | ||||||||||||||||||||||
Sbjct: 179 agtcgggcgtcttagcgacaccacataaagggctt 213



 Score = 46.1 bits (23), Expect = 0.17
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 691 atgccatagtcgggcgtntgagcgacaccacataaagggctt 732
           |||||| |||||||||| | | ||||| ||||||||||||||
Sbjct: 72  atgccacagtcgggcgtcttaccgacaacacataaagggctt 113
to top
>gb|DQ128040.1| Triticum aestivum clone A4-4 Ty3/gypsy-like retrotransposon,
           partial sequence
          Length = 470

 Score = 50.1 bits (25), Expect = 0.011
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| |||||||||| ||||||
Sbjct: 84  ccgatcgggtgtctgaagcgatgcctcgaaagg 52
to top
>gb|AY204215.1| Hordeum vulgare subsp. spontaneum clone Ghs-L-4 Ty3-gypsy
           retrotransposon RT gene, partial sequence
          Length = 477

 Score = 48.1 bits (24), Expect = 0.043
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 343 gccagtaagtactttgaatgtactcgtaaaca 374
           |||||| ||||||||||||||||||| |||||
Sbjct: 382 gccagtgagtactttgaatgtactcgcaaaca 413
to top
>gb|CP000021.1| Vibrio fischeri ES114 chromosome II, complete sequence
          Length = 1332022

 Score = 44.1 bits (22), Expect = 0.68
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 483    taaccatattgataatttaata 504
              ||||||||||||||||||||||
Sbjct: 551569 taaccatattgataatttaata 551548
to top
>emb|CR854851.12| Zebrafish DNA sequence from clone DKEY-98D7 in linkage group 16, complete
              sequence
          Length = 218036

 Score = 44.1 bits (22), Expect = 0.68
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 460    taagtgcaaacaaacagataat 481
              ||||||||||||||||||||||
Sbjct: 187874 taagtgcaaacaaacagataat 187853
to top
>emb|BX293999.7| Mouse DNA sequence from clone RP24-213L10 on chromosome 2, complete
             sequence
          Length = 42983

 Score = 44.1 bits (22), Expect = 0.68
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 404   gttaatatgcacttgaaataattcaa 429
             ||||| ||||||||||||||||||||
Sbjct: 33030 gttaaaatgcacttgaaataattcaa 33055
to top
>emb|AL663053.12| Mouse DNA sequence from clone RP23-436M12 on chromosome 11,
           complete sequence
          Length = 203593

 Score = 44.1 bits (22), Expect = 0.68
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 470 caaacagataatttaaccatat 491
           ||||||||||||||||||||||
Sbjct: 741 caaacagataatttaaccatat 720
to top
>emb|AL604045.7| Mouse DNA sequence from clone RP23-418O11 on chromosome 11, complete
              sequence
          Length = 221399

 Score = 44.1 bits (22), Expect = 0.68
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 470    caaacagataatttaaccatat 491
              ||||||||||||||||||||||
Sbjct: 220140 caaacagataatttaaccatat 220119
to top
>gb|AC146432.3| Pan troglodytes BAC clone RP43-19M2 from 7, complete sequence
          Length = 177888

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 724   aaagggcttataagaaataataaca 748
             |||||||||||||||||||| ||||
Sbjct: 56076 aaagggcttataagaaataaaaaca 56100
to top
>gb|DQ128063.1| Triticum monococcum clone tm3-1, genomic sequence
          Length = 499

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| ||||| |||| ||||||
Sbjct: 89  ccgatcgggtgtctgaagcgacgcctcgaaagg 57
to top
>gb|DQ128062.1| Triticum monococcum clone p8-3, genomic sequence
          Length = 474

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| ||||| |||| ||||||
Sbjct: 89  ccgatcgggtgtctgaagcgacgcctcgaaagg 57
to top
>gb|DQ128055.1| Triticum aestivum clone p3-3, genomic sequence
          Length = 484

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| ||||| |||| ||||||
Sbjct: 84  ccgatcgggtgtctgaagcgacgcctcgaaagg 52
to top
>gb|DQ128054.1| Triticum aestivum clone p3-2, genomic sequence
          Length = 310

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| ||||| |||| ||||||
Sbjct: 90  ccgatcgggtgtctgaagcgacgcctcgaaagg 58
to top
>gb|DQ145754.1| Triticum aestivum clone A3-3, genomic sequence
          Length = 493

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| ||||| |||| ||||||
Sbjct: 89  ccgatcgggtgtctgaagcgacgcctcgaaagg 57
to top
>gb|DQ128047.1| Triticum aestivum clone P8-1 Ty3/gypsy-like retrotransposon,
           partial sequence
          Length = 473

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| ||||| |||| ||||||
Sbjct: 89  ccgatcgggtgtctgaagcgacgcctcgaaagg 57
to top
>gb|DQ128046.1| Triticum aestivum clone P4-6 Ty3/gypsy-like retrotransposon,
           partial sequence
          Length = 494

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 582 ccgatcgggtgtctggagcgatgcc 606
           ||||||||||||||| |||||||||
Sbjct: 90  ccgatcgggtgtctgaagcgatgcc 66
to top
>gb|DQ128041.1| Triticum aestivum clone A4-5 Ty3/gypsy-like retrotransposon,
           partial sequence
          Length = 487

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| ||||| |||| ||||||
Sbjct: 84  ccgatcgggtgtctgaagcgacgcctcgaaagg 52
to top
>gb|DQ128039.1| Triticum aestivum clone A4-3 Ty3/gypsy-like retrotransposon,
           partial sequence
          Length = 490

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| ||||| |||| ||||||
Sbjct: 90  ccgatcgggtgtctgaagcgacgcctcgaaagg 58
to top
>gb|DQ128037.1| Triticum aestivum clone A3-6 Ty3/gypsy-like retrotransposon,
           partial sequence
          Length = 488

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| ||||| |||| ||||||
Sbjct: 84  ccgatcgggtgtctgaagcgacgcctcgaaagg 52
to top
>gb|DQ128035.1| Triticum aestivum clone A3-4 Ty3/gypsy-like retrotransposon,
           partial sequence
          Length = 486

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 582 ccgatcgggtgtctggagcgatgccttgaaagg 614
           ||||||||||||||| ||||| |||| ||||||
Sbjct: 84  ccgatcgggtgtctgaagcgacgcctcgaaagg 52
to top
>gb|AC005078.1| Homo sapiens BAC clone CTA-252K19 from 7, complete sequence
          Length = 73231

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 724   aaagggcttataagaaataataaca 748
             |||||||||||||||||||| ||||
Sbjct: 67773 aaagggcttataagaaataaaaaca 67749
to top
>emb|AL627232.6| Human DNA sequence from clone RP11-363P13 on chromosome 13 Contains
             parts of 3 novel genes, complete sequence
          Length = 55529

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 501   aataagcaatcaaagaaataaagattaat 529
             |||||||||||||||||| | ||||||||
Sbjct: 53499 aataagcaatcaaagaaaaatagattaat 53527
to top
>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 481    tttaaccatattgataatttaataa 505
              ||||| |||||||||||||||||||
Sbjct: 213751 tttaatcatattgataatttaataa 213775
to top
>emb|BX571723.7| Zebrafish DNA sequence from clone DKEYP-51D5 in linkage group 17,
              complete sequence
          Length = 201159

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 374    atcatgaaatcaaacataaaa 394
              |||||||||||||||||||||
Sbjct: 160638 atcatgaaatcaaacataaaa 160658
to top
>gb|AC010243.7| Homo sapiens chromosome 5 clone CTC-361G14, complete sequence
          Length = 178858

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 370   aaacatcatgaaatcaaacataaaa 394
             |||||||||||||||| ||||||||
Sbjct: 88319 aaacatcatgaaatcatacataaaa 88295
to top
>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 481    tttaaccatattgataatttaataa 505
              ||||| |||||||||||||||||||
Sbjct: 236980 tttaatcatattgataatttaataa 237004
to top
>gb|AC074318.5| Staphylococcus aureus clone sabac-108, complete sequence
          Length = 51691

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 481   tttaaccatattgataatttaataa 505
             ||||| |||||||||||||||||||
Sbjct: 15925 tttaatcatattgataatttaataa 15901
to top
>gb|AC067942.6| Homo sapiens BAC clone RP11-791G16 from 4, complete sequence
          Length = 187399

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 339   acatgccagtaagtactttga 359
             |||||||||||||||||||||
Sbjct: 98207 acatgccagtaagtactttga 98227
to top
>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 481    tttaaccatattgataatttaataa 505
              ||||| |||||||||||||||||||
Sbjct: 217990 tttaatcatattgataatttaataa 218014
to top
>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 481    tttaaccatattgataatttaataa 505
              ||||| |||||||||||||||||||
Sbjct: 184077 tttaatcatattgataatttaataa 184101
to top
>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 481    tttaaccatattgataatttaataa 505
              ||||| |||||||||||||||||||
Sbjct: 238747 tttaatcatattgataatttaataa 238771
to top
>gb|AC146038.2| Pan troglodytes BAC clone RP43-96B12 from chromosome 7, complete sequence
          Length = 189363

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 724    aaagggcttataagaaataataaca 748
              |||||||||||||||||||| ||||
Sbjct: 167821 aaagggcttataagaaataaaaaca 167797
to top
>gb|AC025591.8| Staphylococcus aureus clone sabac-134, complete sequence
          Length = 58431

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 481   tttaaccatattgataatttaataa 505
             ||||| |||||||||||||||||||
Sbjct: 26593 tttaatcatattgataatttaataa 26617
to top
>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 481    tttaaccatattgataatttaataa 505
              ||||| |||||||||||||||||||
Sbjct: 215051 tttaatcatattgataatttaataa 215075
to top
>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 481    tttaaccatattgataatttaataa 505
              ||||| |||||||||||||||||||
Sbjct: 237020 tttaatcatattgataatttaataa 237044
to top
>emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA252, complete genome
          Length = 2902619

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 481    tttaaccatattgataatttaataa 505
              ||||| |||||||||||||||||||
Sbjct: 231368 tttaatcatattgataatttaataa 231392
to top
>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 481    tttaaccatattgataatttaataa 505
              ||||| |||||||||||||||||||
Sbjct: 181909 tttaatcatattgataatttaataa 181933
to top
>dbj|AP001575.3| Homo sapiens genomic DNA, chromosome 8q23, clone:KB2005E8
          Length = 56662

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 487   catattgataatttaataagc 507
             |||||||||||||||||||||
Sbjct: 43363 catattgataatttaataagc 43343


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,045,882
Number of Sequences: 3902068
Number of extensions: 8045882
Number of successful extensions: 159259
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 158764
Number of HSP's gapped (non-prelim): 495
length of query: 769
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 746
effective length of database: 17,143,297,704
effective search space: 12788900087184
effective search space used: 12788900087184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)
to top