ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal18f17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL606609.2|OSJN00064 Oryza sativa genomic DNA, chromosome 4,... 46 0.15
2dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.15
3emb|AL662940.3|OSJN00142 Oryza sativa genomic DNA, chromosome 4,... 46 0.15
4emb|AL935115.6| Zebrafish DNA sequence from clone CH211-199D18, ... 44 0.59
5gb|AC104708.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.3
6gb|AC127546.4| Mus musculus BAC clone RP24-485N8 from chromosome... 42 2.3
7gb|AC133502.4| Mus musculus chromosome 7 clone RP24-290G20, comp... 42 2.3
8gb|AC018977.9| Homo sapiens chromosome 10 clone RP11-386C23, com... 42 2.3
9emb|AL162614.25| Human DNA sequence from clone RP1-220G17 on chr... 42 2.3
10gb|AC121799.5| Mus musculus BAC clone RP23-429M22 from chromosom... 42 2.3
11emb|AJ438576.1|SSC438576 Saimiri sciureus sciureus Sasc-31 gene ... 42 2.3
12gb|AC079331.11| Homo sapiens chromosome 17, clone RP11-360N9, co... 42 2.3
13gb|AC012558.9| Homo sapiens chromosome 10 clone RP11-174J11, com... 42 2.3
14gb|AC091165.15| Homo sapiens chromosome 8, clone RP11-366G13, co... 42 2.3
15dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.3
16gb|AC131254.5| Homo sapiens chromosome 8, clone RP11-94H18, comp... 42 2.3
17dbj|AB025633.2| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 2.3
18gb|AC006534.10| Homo sapiens chromosome 17, clone RP11-557B23, c... 42 2.3
19ref|XM_523606.1| PREDICTED: Pan troglodytes similar to cardiomyo... 40 9.2
20gb|AC152828.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 40 9.2
21gb|AC166159.2| Mus musculus BAC clone RP24-129B16 from chromosom... 40 9.2
22gb|AC136746.15| Mus musculus chromosome 5, clone RP23-151C5, com... 40 9.2
23gb|AC138278.9| Mus musculus chromosome 8, clone RP23-378E4, comp... 40 9.2
24gb|AC154314.2| Mus musculus BAC clone RP23-347J22 from chromosom... 40 9.2
25gb|AC166107.4| Mus musculus BAC clone RP23-205A7 from chromosome... 40 9.2
26gb|BC081513.1| Danio rerio cDNA clone IMAGE:7263329, partial cds 40 9.2
27ref|NM_178788.2| Mus musculus dCMP deaminase (Dctd), mRNA 40 9.2
28ref|NM_001040320.1| Danio rerio zgc:136389 (zgc:136389), mRNA 40 9.2
29gb|AC163995.4| Mus musculus chromosome 5, clone RP24-242C19, com... 40 9.2
30gb|AC164559.3| Mus musculus BAC clone RP23-198H17 from chromosom... 40 9.2
31gb|AC132424.3| Mus musculus BAC clone RP23-310P13 from chromosom... 40 9.2
32emb|CR925863.7| Zebrafish DNA sequence from clone DKEY-184N1 in ... 40 9.2
33gb|AC127267.3| Mus musculus BAC clone RP23-401H14 from chromosom... 40 9.2
34gb|BC031719.1| Mus musculus dCMP deaminase, mRNA (cDNA clone MGC... 40 9.2
35gb|BC093242.1| Danio rerio similar to Serum amyloid P-component ... 40 9.2
36gb|BC115109.1| Danio rerio cDNA clone MGC:136389 IMAGE:7252397, ... 40 9.2
37emb|AL022161.1|HS380C13 Human DNA sequence from clone RP3-380C13... 40 9.2
38emb|CR933001.12| Zebrafish DNA sequence from clone DKEY-158B11 i... 40 9.2
39emb|AL672010.8| Mouse DNA sequence from clone RP23-223C15 on chr... 40 9.2
40gb|AC134399.12| Mus musculus chromosome 5, clone RP24-282I19, co... 40 9.2
41gb|AC161354.2| Mus musculus chromosome 8, clone RP23-373C4, comp... 40 9.2
42gb|AC022706.7| Homo sapiens chromosome , clone RP11-47L3, comple... 40 9.2
43ref|NM_173167.2| Homo sapiens unc-45 homolog B (C. elegans) (UNC... 40 9.2
44ref|NM_001033576.1| Homo sapiens unc-45 homolog B (C. elegans) (... 40 9.2
45gb|AC093689.4| Homo sapiens BAC clone RP11-725M22 from 4, comple... 40 9.2
46gb|AC116618.4| Homo sapiens BAC clone RP11-98L17 from 4, complet... 40 9.2
47gb|AC073174.5| Homo sapiens chromosome 10 clone RP11-319F12, com... 40 9.2
48gb|AC093749.3| Homo sapiens BAC clone RP11-30B7 from 4, complete... 40 9.2
49gb|AC104300.2| Homo sapiens chromosome 3 clone RP11-147N17, comp... 40 9.2
50ref|XM_694014.1| PREDICTED: Danio rerio similar to Serum amyloid... 40 9.2
51gb|AC022916.11| Homo sapiens chromosome 17, clone RP11-799D4, co... 40 9.2
52dbj|AK171894.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 9.2
53gb|AC127346.4| Mus musculus BAC clone RP23-54F4 from chromosome ... 40 9.2
54dbj|AK077663.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 40 9.2
55dbj|AK039066.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 40 9.2
56emb|AL672153.3| Mouse DNA sequence from clone RP23-8C14 on chrom... 40 9.2
57dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.2
58gb|AY168008.1| Sphoeroides nephelus dlx1/dlx2 intergenic region,... 40 9.2
59gb|BC095616.1| Danio rerio cDNA clone IMAGE:7250490, partial cds 40 9.2
60gb|AF539794.1| Homo sapiens striated muscle UNC45 (UNC45) mRNA, ... 40 9.2
61dbj|AP004992.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.2
62emb|AL929027.10| Mouse DNA sequence from clone RP23-217F24 on ch... 40 9.2
63emb|BX647642.1|HSM807788 Homo sapiens mRNA; cDNA DKFZp451P086 (f... 40 9.2
64gb|AC146871.3| Xenopus tropicalis clone CH216-38E19, complete se... 40 9.2
65emb|AL732544.12| Zebrafish DNA sequence from clone BUSM1-6I1 in ... 40 9.2
66gb|AC164420.4| Mus musculus chromosome 8, clone RP24-388L13, com... 40 9.2
67emb|BX510915.23| Zebrafish DNA sequence from clone DKEY-24M12 in... 40 9.2
68emb|BX001030.7| Zebrafish DNA sequence from clone CH211-234P6 in... 40 9.2
69gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 9.2
70gb|BC101062.2| Homo sapiens unc-45 homolog B (C. elegans), mRNA ... 40 9.2
71gb|AC142109.4| Mus musculus BAC clone RP24-96D16 from chromosome... 40 9.2
72gb|AC140293.4| Mus musculus BAC clone RP24-328A10 from 13, compl... 40 9.2
73gb|AC160019.2| Gallus gallus BAC clone CH261-50H15 from chromoso... 40 9.2
74gb|AC157951.2| Gallus gallus BAC clone CH261-173J5 from chromoso... 40 9.2
75gb|BC101063.2| Homo sapiens unc-45 homolog B (C. elegans), trans... 40 9.2
76gb|AC120789.12| Mus musculus chromosome 8, clone RP23-441F24, co... 40 9.2
77gb|AC161877.5| Mus musculus BAC clone RP23-350G11 from chromosom... 40 9.2
78emb|AL833281.1|HSM804594 Homo sapiens mRNA; cDNA DKFZp451I048 (f... 40 9.2
79emb|AL832355.1|HSM803663 Homo sapiens mRNA; cDNA DKFZp451E226 (f... 40 9.2

>emb|AL606609.2|OSJN00064 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0089K24,
             complete sequence
          Length = 121799

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 93    atacataaatttgagattgcaaa 115
             |||||||||||||||||||||||
Sbjct: 86982 atacataaatttgagattgcaaa 87004



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 93      atacataaatttgagattgcaaa 115
               |||||||||||||||||||||||
Sbjct: 1307016 atacataaatttgagattgcaaa 1307038



to top

>emb|AL662940.3|OSJN00142 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0035A12,
             complete sequence
          Length = 130499

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 93    atacataaatttgagattgcaaa 115
             |||||||||||||||||||||||
Sbjct: 9979  atacataaatttgagattgcaaa 10001



to top

>emb|AL935115.6| Zebrafish DNA sequence from clone CH211-199D18, complete sequence
          Length = 187326

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 229   tgaaataaaaacacatgaatta 250
             ||||||||||||||||||||||
Sbjct: 41159 tgaaataaaaacacatgaatta 41138



to top

>gb|AC104708.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1174_H11,
             complete sequence
          Length = 102567

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 213   aaaatctacacaaacatgaaa 233
             |||||||||||||||||||||
Sbjct: 88148 aaaatctacacaaacatgaaa 88128



to top

>gb|AC127546.4| Mus musculus BAC clone RP24-485N8 from chromosome 7, complete sequence
          Length = 151861

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 635   gaagctggctggtgaggtgga 655
             |||||||||||||||||||||
Sbjct: 28908 gaagctggctggtgaggtgga 28888



to top

>gb|AC133502.4| Mus musculus chromosome 7 clone RP24-290G20, complete sequence
          Length = 160238

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 635   gaagctggctggtgaggtgga 655
             |||||||||||||||||||||
Sbjct: 17930 gaagctggctggtgaggtgga 17950



to top

>gb|AC018977.9| Homo sapiens chromosome 10 clone RP11-386C23, complete sequence
          Length = 222810

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 313   aaaattgcaaatctccaaatg 333
             |||||||||||||||||||||
Sbjct: 26129 aaaattgcaaatctccaaatg 26109



to top

>emb|AL162614.25| Human DNA sequence from clone RP1-220G17 on chromosome 11p12-14.1,
             complete sequence
          Length = 93100

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 222   acaaacatgaaataaaaacacatgaatta 250
             |||||||||||||||| ||||| ||||||
Sbjct: 50202 acaaacatgaaataaatacacaggaatta 50174



to top

>gb|AC121799.5| Mus musculus BAC clone RP23-429M22 from chromosome 1, complete sequence
          Length = 212595

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 220    acacaaacatgaaataaaaacacat 244
              |||||||||| ||||||||||||||
Sbjct: 158604 acacaaacataaaataaaaacacat 158628



to top

>emb|AJ438576.1|SSC438576 Saimiri sciureus sciureus Sasc-31 gene for MHC class I antigen,
           exons 1-8
          Length = 4023

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 553 ctctgcggggaggagcgaagg 573
           |||||||||||||||||||||
Sbjct: 622 ctctgcggggaggagcgaagg 642



to top

>gb|AC079331.11| Homo sapiens chromosome 17, clone RP11-360N9, complete sequence
          Length = 182535

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   catgaaataaaaacacatgaa 247
             |||||||||||||||||||||
Sbjct: 44186 catgaaataaaaacacatgaa 44166



to top

>gb|AC012558.9| Homo sapiens chromosome 10 clone RP11-174J11, complete sequence
          Length = 179391

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 313    aaaattgcaaatctccaaatg 333
              |||||||||||||||||||||
Sbjct: 119645 aaaattgcaaatctccaaatg 119625



to top

>gb|AC091165.15| Homo sapiens chromosome 8, clone RP11-366G13, complete sequence
          Length = 188456

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 75    aaggaagatacattggaaata 95
             |||||||||||||||||||||
Sbjct: 88295 aaggaagatacattggaaata 88275



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 213      aaaatctacacaaacatgaaa 233
                |||||||||||||||||||||
Sbjct: 19628249 aaaatctacacaaacatgaaa 19628229



to top

>gb|AC131254.5| Homo sapiens chromosome 8, clone RP11-94H18, complete sequence
          Length = 153000

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 75     aaggaagatacattggaaata 95
              |||||||||||||||||||||
Sbjct: 119857 aaggaagatacattggaaata 119877



to top

>dbj|AB025633.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQM1
          Length = 81365

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 219   tacacaaacatgaaataaaaacacatgaa 247
             |||| ||||||||||| ||||||||||||
Sbjct: 38465 tacaaaaacatgaaatcaaaacacatgaa 38493



to top

>gb|AC006534.10| Homo sapiens chromosome 17, clone RP11-557B23, complete sequence
          Length = 216789

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   catgaaataaaaacacatgaa 247
             |||||||||||||||||||||
Sbjct: 36816 catgaaataaaaacacatgaa 36836



to top

>ref|XM_523606.1| PREDICTED: Pan troglodytes similar to cardiomyopathy associated 4;
            striated muscle UNC45 (LOC468215), mRNA
          Length = 1944

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 547  gtgctgctctgcggggagga 566
            ||||||||||||||||||||
Sbjct: 1576 gtgctgctctgcggggagga 1595



to top

>gb|AC152828.1| Ornithorhynchus anatinus chromosome UNK clone OABb-462A1, complete
             sequence
          Length = 146407

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 222   acaaacatgaaataaaaaca 241
             ||||||||||||||||||||
Sbjct: 62795 acaaacatgaaataaaaaca 62776



to top

>gb|AC166159.2| Mus musculus BAC clone RP24-129B16 from chromosome 15, complete
             sequence
          Length = 216481

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 312   taaaattgcaaatctccaaa 331
             ||||||||||||||||||||
Sbjct: 91148 taaaattgcaaatctccaaa 91129



to top

>gb|AC136746.15| Mus musculus chromosome 5, clone RP23-151C5, complete sequence
          Length = 195530

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 220  acacaaacatgaaataaaaa 239
            ||||||||||||||||||||
Sbjct: 6413 acacaaacatgaaataaaaa 6394



to top

>gb|AC138278.9| Mus musculus chromosome 8, clone RP23-378E4, complete sequence
          Length = 177245

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   aaaatctacacaaacatgaa 232
             ||||||||||||||||||||
Sbjct: 19897 aaaatctacacaaacatgaa 19878



to top

>gb|AC154314.2| Mus musculus BAC clone RP23-347J22 from chromosome 13, complete
           sequence
          Length = 189556

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 82  atacattggaaatacataaa 101
           ||||||||||||||||||||
Sbjct: 826 atacattggaaatacataaa 807



to top

>gb|AC166107.4| Mus musculus BAC clone RP23-205A7 from chromosome 6, complete sequence
          Length = 177843

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 224   aaacatgaaataaaaacaca 243
             ||||||||||||||||||||
Sbjct: 99729 aaacatgaaataaaaacaca 99748



to top

>gb|BC081513.1| Danio rerio cDNA clone IMAGE:7263329, partial cds
          Length = 799

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 314 aaattgcaaatctccaaatgtggg 337
           ||||||||||||| ||||||||||
Sbjct: 550 aaattgcaaatctgcaaatgtggg 573



to top

>ref|NM_178788.2| Mus musculus dCMP deaminase (Dctd), mRNA
          Length = 2053

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  atgaaataaaaacacatgaa 247
            ||||||||||||||||||||
Sbjct: 1956 atgaaataaaaacacatgaa 1937



to top

>ref|NM_001040320.1| Danio rerio zgc:136389 (zgc:136389), mRNA
          Length = 948

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 314 aaattgcaaatctccaaatgtggg 337
           ||||||||||||| ||||||||||
Sbjct: 695 aaattgcaaatctgcaaatgtggg 718



to top

>gb|AC163995.4| Mus musculus chromosome 5, clone RP24-242C19, complete sequence
          Length = 177877

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 220    acacaaacatgaaataaaaa 239
              ||||||||||||||||||||
Sbjct: 129207 acacaaacatgaaataaaaa 129188



to top

>gb|AC164559.3| Mus musculus BAC clone RP23-198H17 from chromosome 6, complete sequence
          Length = 194636

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 217    tctacacaaacatgaaataa 236
              ||||||||||||||||||||
Sbjct: 189250 tctacacaaacatgaaataa 189231



to top

>gb|AC132424.3| Mus musculus BAC clone RP23-310P13 from chromosome 15, complete
            sequence
          Length = 199655

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 312  taaaattgcaaatctccaaa 331
            ||||||||||||||||||||
Sbjct: 9074 taaaattgcaaatctccaaa 9093



to top

>emb|CR925863.7| Zebrafish DNA sequence from clone DKEY-184N1 in linkage group 8,
             complete sequence
          Length = 134388

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 98    taaatttgagattgcaaaat 117
             ||||||||||||||||||||
Sbjct: 10970 taaatttgagattgcaaaat 10989



to top

>gb|AC127267.3| Mus musculus BAC clone RP23-401H14 from chromosome 6, complete sequence
          Length = 186704

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 217    tctacacaaacatgaaataa 236
              ||||||||||||||||||||
Sbjct: 140544 tctacacaaacatgaaataa 140525



to top

>gb|BC031719.1| Mus musculus dCMP deaminase, mRNA (cDNA clone MGC:25698
            IMAGE:3672932), complete cds
          Length = 1923

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  atgaaataaaaacacatgaa 247
            ||||||||||||||||||||
Sbjct: 1769 atgaaataaaaacacatgaa 1750



to top

>gb|BC093242.1| Danio rerio similar to Serum amyloid P-component precursor (SAP),
           mRNA (cDNA clone IMAGE:7431391), partial cds
          Length = 870

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 314 aaattgcaaatctccaaatgtggg 337
           ||||||||||||| ||||||||||
Sbjct: 552 aaattgcaaatctgcaaatgtggg 575



to top

>gb|BC115109.1| Danio rerio cDNA clone MGC:136389 IMAGE:7252397, complete cds
          Length = 948

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 314 aaattgcaaatctccaaatgtggg 337
           ||||||||||||| ||||||||||
Sbjct: 695 aaattgcaaatctgcaaatgtggg 718



to top

>emb|AL022161.1|HS380C13 Human DNA sequence from clone RP3-380C13 on chromosome Xq22.1-22.3
              Contains a calmodulin 2 (phosphorylase kinase, delta)
              (CALM2) pseudogene, complete sequence
          Length = 139444

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 231    aaataaaaacacatgaatta 250
              ||||||||||||||||||||
Sbjct: 131261 aaataaaaacacatgaatta 131280



to top

>emb|CR933001.12| Zebrafish DNA sequence from clone DKEY-158B11 in linkage group 5,
             complete sequence
          Length = 158802

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 212   taaaatctacacaaacatgaaataaaaa 239
             ||||||||||| ||||||| ||||||||
Sbjct: 86889 taaaatctacataaacatgtaataaaaa 86916



to top

>emb|AL672010.8| Mouse DNA sequence from clone RP23-223C15 on chromosome 11 Contains
             three novel genes and a CpG island, complete sequence
          Length = 193223

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 223   caaacatgaaataaaaacac 242
             ||||||||||||||||||||
Sbjct: 11599 caaacatgaaataaaaacac 11580



to top

>gb|AC134399.12| Mus musculus chromosome 5, clone RP24-282I19, complete sequence
          Length = 155228

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 220   acacaaacatgaaataaaaa 239
             ||||||||||||||||||||
Sbjct: 66165 acacaaacatgaaataaaaa 66184



to top

>gb|AC161354.2| Mus musculus chromosome 8, clone RP23-373C4, complete sequence
          Length = 98660

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   aaaatctacacaaacatgaa 232
             ||||||||||||||||||||
Sbjct: 58805 aaaatctacacaaacatgaa 58824



to top

>gb|AC022706.7| Homo sapiens chromosome , clone RP11-47L3, complete sequence
          Length = 162474

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 547   gtgctgctctgcggggagga 566
             ||||||||||||||||||||
Sbjct: 11092 gtgctgctctgcggggagga 11111



to top

>ref|NM_173167.2| Homo sapiens unc-45 homolog B (C. elegans) (UNC45B), transcript
            variant 1, mRNA
          Length = 5694

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 547  gtgctgctctgcggggagga 566
            ||||||||||||||||||||
Sbjct: 2525 gtgctgctctgcggggagga 2544



to top

>ref|NM_001033576.1| Homo sapiens unc-45 homolog B (C. elegans) (UNC45B), transcript
            variant 2, mRNA
          Length = 5688

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 547  gtgctgctctgcggggagga 566
            ||||||||||||||||||||
Sbjct: 2519 gtgctgctctgcggggagga 2538



to top

>gb|AC093689.4| Homo sapiens BAC clone RP11-725M22 from 4, complete sequence
          Length = 167590

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 85     cattggaaatacataaattt 104
              ||||||||||||||||||||
Sbjct: 150376 cattggaaatacataaattt 150395



to top

>gb|AC116618.4| Homo sapiens BAC clone RP11-98L17 from 4, complete sequence
          Length = 153040

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   tcaactaaaatctacacaaa 226
             ||||||||||||||||||||
Sbjct: 12525 tcaactaaaatctacacaaa 12544



to top

>gb|AC073174.5| Homo sapiens chromosome 10 clone RP11-319F12, complete sequence
          Length = 161551

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 226    acatgaaataaaaacacatg 245
              ||||||||||||||||||||
Sbjct: 122376 acatgaaataaaaacacatg 122395



to top

>gb|AC093749.3| Homo sapiens BAC clone RP11-30B7 from 4, complete sequence
          Length = 163102

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   tcaactaaaatctacacaaa 226
             ||||||||||||||||||||
Sbjct: 87355 tcaactaaaatctacacaaa 87336



to top

>gb|AC104300.2| Homo sapiens chromosome 3 clone RP11-147N17, complete sequence
          Length = 156024

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   tgagattgcaaaatagcctg 123
             ||||||||||||||||||||
Sbjct: 49826 tgagattgcaaaatagcctg 49845



to top

>ref|XM_694014.1| PREDICTED: Danio rerio similar to Serum amyloid P-component
           precursor (SAP) (LOC570524), mRNA
          Length = 1029

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 314 aaattgcaaatctccaaatgtggg 337
           ||||||||||||| ||||||||||
Sbjct: 872 aaattgcaaatctgcaaatgtggg 895



to top

>gb|AC022916.11| Homo sapiens chromosome 17, clone RP11-799D4, complete sequence
          Length = 215786

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 547    gtgctgctctgcggggagga 566
              ||||||||||||||||||||
Sbjct: 150461 gtgctgctctgcggggagga 150480



to top

>dbj|AK171894.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830018C18 product:dCMP deaminase, full
            insert sequence
          Length = 2493

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  atgaaataaaaacacatgaa 247
            ||||||||||||||||||||
Sbjct: 2393 atgaaataaaaacacatgaa 2374



to top

>gb|AC127346.4| Mus musculus BAC clone RP23-54F4 from chromosome 6, complete sequence
          Length = 203187

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 217  tctacacaaacatgaaataa 236
            ||||||||||||||||||||
Sbjct: 1255 tctacacaaacatgaaataa 1236



to top

>dbj|AK077663.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:5730512H23
            product:DEOXYCYTIDYLATE DEAMINASE (EC 3.5.4.12) (DCMP
            DEAMINASE) homolog [Homo sapiens], full insert sequence
          Length = 2053

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  atgaaataaaaacacatgaa 247
            ||||||||||||||||||||
Sbjct: 1956 atgaaataaaaacacatgaa 1937



to top

>dbj|AK039066.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched
            library, clone:A230092D16 product:deoxycytidylate
            deaminase homolog [Homo sapiens], full insert sequence
          Length = 1884

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  atgaaataaaaacacatgaa 247
            ||||||||||||||||||||
Sbjct: 1784 atgaaataaaaacacatgaa 1765



to top

>emb|AL672153.3| Mouse DNA sequence from clone RP23-8C14 on chromosome 2, complete
             sequence
          Length = 137628

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 223   caaacatgaaataaaaacac 242
             ||||||||||||||||||||
Sbjct: 31458 caaacatgaaataaaaacac 31477



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 423      ctccagccggccgaatcaat 442
                ||||||||||||||||||||
Sbjct: 14247707 ctccagccggccgaatcaat 14247688



to top

>gb|AY168008.1| Sphoeroides nephelus dlx1/dlx2 intergenic region, partial sequence
          Length = 5358

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 86   attggaaatacataaatttgagat 109
            |||||||||||||||||| |||||
Sbjct: 3674 attggaaatacataaattggagat 3651



to top

>gb|BC095616.1| Danio rerio cDNA clone IMAGE:7250490, partial cds
          Length = 788

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 314 aaattgcaaatctccaaatgtggg 337
           ||||||||||||| ||||||||||
Sbjct: 481 aaattgcaaatctgcaaatgtggg 504



to top

>gb|AF539794.1| Homo sapiens striated muscle UNC45 (UNC45) mRNA, complete cds
          Length = 2796

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 547  gtgctgctctgcggggagga 566
            ||||||||||||||||||||
Sbjct: 2428 gtgctgctctgcggggagga 2447



to top

>dbj|AP004992.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0022O02
          Length = 176625

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 423   ctccagccggccgaatcaat 442
             ||||||||||||||||||||
Sbjct: 91171 ctccagccggccgaatcaat 91152



to top

>emb|AL929027.10| Mouse DNA sequence from clone RP23-217F24 on chromosome 2, complete
              sequence
          Length = 174282

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 224    aaacatgaaataaaaacaca 243
              ||||||||||||||||||||
Sbjct: 142005 aaacatgaaataaaaacaca 142024



to top

>emb|BX647642.1|HSM807788 Homo sapiens mRNA; cDNA DKFZp451P086 (from clone DKFZp451P086)
          Length = 5686

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 547  gtgctgctctgcggggagga 566
            ||||||||||||||||||||
Sbjct: 2519 gtgctgctctgcggggagga 2538



to top

>gb|AC146871.3| Xenopus tropicalis clone CH216-38E19, complete sequence
          Length = 163001

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 224   aaacatgaaataaaaacaca 243
             ||||||||||||||||||||
Sbjct: 73773 aaacatgaaataaaaacaca 73754



to top

>emb|AL732544.12| Zebrafish DNA sequence from clone BUSM1-6I1 in linkage group 7,
             complete sequence
          Length = 135141

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 218   ctacacaaacatgaaataaa 237
             ||||||||||||||||||||
Sbjct: 67280 ctacacaaacatgaaataaa 67299



to top

>gb|AC164420.4| Mus musculus chromosome 8, clone RP24-388L13, complete sequence
          Length = 174120

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    atgaaataaaaacacatgaa 247
              ||||||||||||||||||||
Sbjct: 105296 atgaaataaaaacacatgaa 105315



to top

>emb|BX510915.23| Zebrafish DNA sequence from clone DKEY-24M12 in linkage group 21,
              complete sequence
          Length = 253718

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 230    gaaataaaaacacatgaattacac 253
              ||||| ||||||||||||||||||
Sbjct: 205683 gaaatgaaaacacatgaattacac 205706



to top

>emb|BX001030.7| Zebrafish DNA sequence from clone CH211-234P6 in linkage group 24,
             complete sequence
          Length = 156560

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 314   aaattgcaaatctccaaatgtggg 337
             ||||||||||||| ||||||||||
Sbjct: 97011 aaattgcaaatctgcaaatgtggg 97034



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 206     atcaactaaaatctacacaaacat 229
               |||||||||||||| |||||||||
Sbjct: 1311297 atcaactaaaatctccacaaacat 1311274



to top

>gb|BC101062.2| Homo sapiens unc-45 homolog B (C. elegans), mRNA (cDNA clone
            MGC:119540 IMAGE:40008186), complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 547  gtgctgctctgcggggagga 566
            ||||||||||||||||||||
Sbjct: 2185 gtgctgctctgcggggagga 2204



to top

>gb|AC142109.4| Mus musculus BAC clone RP24-96D16 from chromosome 15, complete sequence
          Length = 148041

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 312   taaaattgcaaatctccaaa 331
             ||||||||||||||||||||
Sbjct: 42657 taaaattgcaaatctccaaa 42676



to top

>gb|AC140293.4| Mus musculus BAC clone RP24-328A10 from 13, complete sequence
          Length = 188473

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 82     atacattggaaatacataaa 101
              ||||||||||||||||||||
Sbjct: 143123 atacattggaaatacataaa 143104



to top

>gb|AC160019.2| Gallus gallus BAC clone CH261-50H15 from chromosome unknown, complete
              sequence
          Length = 228494

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 358    accttttgctttggagatgc 377
              ||||||||||||||||||||
Sbjct: 181792 accttttgctttggagatgc 181773



to top

>gb|AC157951.2| Gallus gallus BAC clone CH261-173J5 from chromosome unknown, complete
              sequence
          Length = 206432

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 358    accttttgctttggagatgc 377
              ||||||||||||||||||||
Sbjct: 155534 accttttgctttggagatgc 155553



to top

>gb|BC101063.2| Homo sapiens unc-45 homolog B (C. elegans), transcript variant 2,
            mRNA (cDNA clone MGC:119541 IMAGE:40008187), complete cds
          Length = 2790

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 547  gtgctgctctgcggggagga 566
            ||||||||||||||||||||
Sbjct: 2422 gtgctgctctgcggggagga 2441



to top

>gb|AC120789.12| Mus musculus chromosome 8, clone RP23-441F24, complete sequence
          Length = 204013

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   atgaaataaaaacacatgaa 247
             ||||||||||||||||||||
Sbjct: 11844 atgaaataaaaacacatgaa 11863



to top

>gb|AC161877.5| Mus musculus BAC clone RP23-350G11 from chromosome 14, complete sequence
          Length = 227413

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 458    tgattcaatagatgggggag 477
              ||||||||||||||||||||
Sbjct: 204368 tgattcaatagatgggggag 204349



to top

>emb|AL833281.1|HSM804594 Homo sapiens mRNA; cDNA DKFZp451I048 (from clone DKFZp451I048)
          Length = 5651

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 547  gtgctgctctgcggggagga 566
            ||||||||||||||||||||
Sbjct: 2492 gtgctgctctgcggggagga 2511



to top

>emb|AL832355.1|HSM803663 Homo sapiens mRNA; cDNA DKFZp451E226 (from clone DKFZp451E226)
          Length = 5684

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 547  gtgctgctctgcggggagga 566
            ||||||||||||||||||||
Sbjct: 2513 gtgctgctctgcggggagga 2532


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,973,949
Number of Sequences: 3902068
Number of extensions: 6973949
Number of successful extensions: 124970
Number of sequences better than 10.0: 79
Number of HSP's better than 10.0 without gapping: 79
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 124632
Number of HSP's gapped (non-prelim): 338
length of query: 675
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 652
effective length of database: 17,143,297,704
effective search space: 11177430103008
effective search space used: 11177430103008
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top