| Clone Name | rbaal17m15 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY846819.1| Triticum aestivum ribosomal protein L36 mRNA, complete cds Length = 406 Score = 315 bits (159), Expect = 9e-83 Identities = 231/255 (90%) Strand = Plus / Minus Query: 334 accagcagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccct 393 ||||||||| ||||||||||| |||||||| ||||||||||||||||||||||| || || Sbjct: 379 accagcagacctcatcttcctaaggacacttgacatctcctctctcttcttctttgctct 320 Query: 394 cttgtgggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaacctt 453 |||||| || || | ||||| ||| || ||||| || |||||||| ||||| |||||||| Sbjct: 319 cttgtgagtaccaagctttctcttggcgaccttgagtgcacgcttgtcctttccaacctt 260 Query: 454 gagaagctcagtgatacgcttctcatatggagcaaacccagcaacctccctgatcaagct 513 |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| | Sbjct: 259 aagaagctcagtgatacgcttctcatagggagcaaatccagcaacctccctgatcaagtt 200 Query: 514 cctaacgaaatgcaccctcttggtacctttccccttgcggtcggacgggcgcggcggcag 573 ||| || |||||||||||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 199 cctgacaaaatgcaccctctttgtacctttccccttgcggtcggacgggcgaggcggcag 140 Query: 574 ctcgcgcttggtgac 588 ||||||||||||||| Sbjct: 139 ctcgcgcttggtgac 125
>ref|XM_475364.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 342 Score = 313 bits (158), Expect = 4e-82 Identities = 227/250 (90%) Strand = Plus / Minus Query: 339 cagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgt 398 |||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||| Sbjct: 307 cagacctcatcttcctgaggacaccagccatctcctctctcttcttcttggccctcttgt 248 Query: 399 gggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaa 458 ||||||| | ||||| ||| ||||||||||| |||||||| ||||||||||| ||||||| Sbjct: 247 gggtgccaagctttctctttgccaccttcagtgcacgcttgtccttgccaactttgagaa 188 Query: 459 gctcagtgatacgcttctcatatggagcaaacccagcaacctccctgatcaagctcctaa 518 |||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||| | Sbjct: 187 gctcagtgatacgcttctcatagggagcaaatccagcaacctccctgatcaagttcctga 128 Query: 519 cgaaatgcaccctcttggtacctttccccttgcggtcggacgggcgcggcggcagctcgc 578 | || |||||||||||| |||||||||||||||||||||||| ||||||||||||| Sbjct: 127 caaaggtcaccctcttggtggatttccccttgcggtcggacgggcgaggcggcagctcgc 68 Query: 579 gcttggtgac 588 |||||||||| Sbjct: 67 gcttggtgac 58
>dbj|AK058918.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-B04, full insert sequence Length = 579 Score = 313 bits (158), Expect = 4e-82 Identities = 227/250 (90%) Strand = Plus / Minus Query: 339 cagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgt 398 |||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||| Sbjct: 356 cagacctcatcttcctgaggacaccagccatctcctctctcttcttcttggccctcttgt 297 Query: 399 gggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaa 458 ||||||| | ||||| ||| ||||||||||| |||||||| ||||||||||| ||||||| Sbjct: 296 gggtgccaagctttctctttgccaccttcagtgcacgcttgtccttgccaactttgagaa 237 Query: 459 gctcagtgatacgcttctcatatggagcaaacccagcaacctccctgatcaagctcctaa 518 |||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||| | Sbjct: 236 gctcagtgatacgcttctcatagggagcaaatccagcaacctccctgatcaagttcctga 177 Query: 519 cgaaatgcaccctcttggtacctttccccttgcggtcggacgggcgcggcggcagctcgc 578 | || |||||||||||| |||||||||||||||||||||||| ||||||||||||| Sbjct: 176 caaaggtcaccctcttggtggatttccccttgcggtcggacgggcgaggcggcagctcgc 117 Query: 579 gcttggtgac 588 |||||||||| Sbjct: 116 gcttggtgac 107 Score = 44.1 bits (22), Expect = 0.51 Identities = 44/50 (88%), Gaps = 1/50 (2%) Strand = Plus / Minus Query: 279 attgccattaacttcacgagcttgg-gatactctacttcttcttctcggt 327 |||||||| |||||| || ||||| ||||||||| |||||||||||||| Sbjct: 423 attgccatggacttcatgaacttggagatactctatttcttcttctcggt 374
>ref|NM_190535.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 333 Score = 266 bits (134), Expect = 7e-68 Identities = 227/258 (87%) Strand = Plus / Minus Query: 331 agtaccagcagatctcatcttcctgaggacactggacatctcctctctcttcttcttggc 390 |||||||||||| ||||||||||||| ||||| | ||||||||||||||||||||| || Sbjct: 315 agtaccagcagacctcatcttcctgatgacacccgccatctcctctctcttcttctttgc 256 Query: 391 cctcttgtgggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaac 450 ||||||||||| || | ||||| ||| || |||||||| |||||||| ||||| ||||| Sbjct: 255 tctcttgtgggtaccgagctttctcttagcgaccttcagtgcacgcttgtcctttccaac 196 Query: 451 cttgagaagctcagtgatacgcttctcatatggagcaaacccagcaacctccctgatcaa 510 ||| |||||||||||||| || ||||||||||||||||| || |||||||||| ||||| Sbjct: 195 cttcagaagctcagtgattcgtttctcatatggagcaaatcccacaacctccctaatcaa 136 Query: 511 gctcctaacgaaatgcaccctcttggtacctttccccttgcggtcggacgggcgcggcgg 570 || ||| || |||| ||| |||||||||| |||||||||||||||||||||||| || || Sbjct: 135 gcccctgacaaaattcactctcttggtacttttccccttgcggtcggacgggcgaggtgg 76 Query: 571 cagctcgcgcttggtgac 588 |||||||||||||||||| Sbjct: 75 cagctcgcgcttggtgac 58
>gb|AY796052.1| Saccharum officinarum putative 60S ribosomal protein L36 mRNA, complete cds Length = 503 Score = 256 bits (129), Expect = 7e-65 Identities = 225/257 (87%) Strand = Plus / Minus Query: 332 gtaccagcagatctcatcttcctgaggacactggacatctcctctctcttcttcttggcc 391 |||||||| |||||||| ||| ||||||||| | ||||||||||||||||||||| ||| Sbjct: 318 gtaccagccgatctcattttcttgaggacacccgccatctcctctctcttcttctttgcc 259 Query: 392 ctcttgtgggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaacc 451 |||||||| || || | ||||| ||| || ||||||| ||||||||| |||||||||||| Sbjct: 258 ctcttgtgagttccaagctttctcttggcaaccttcaaagcacgcttgtccttgccaacc 199 Query: 452 ttgagaagctcagtgatacgcttctcatatggagcaaacccagcaacctccctgatcaag 511 || |||||||||||||||||||||||||| |||||||||||||||||||| ||||||| | Sbjct: 198 ttaagaagctcagtgatacgcttctcataaggagcaaacccagcaacctctctgatcagg 139 Query: 512 ctcctaacgaaatgcaccctcttggtacctttccccttgcggtcggacgggcgcggcggc 571 | ||| || | ||||||||| || ||||||||||||||| |||||||||||| ||| Sbjct: 138 cccctgaccatggacaccctcttcgttgctttccccttgcggtgggacgggcgcggaggc 79 Query: 572 agctcgcgcttggtgac 588 ||||||||||||||||| Sbjct: 78 agctcgcgcttggtgac 62
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05, complete sequence Length = 163130 Score = 242 bits (122), Expect = 1e-60 Identities = 176/194 (90%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 41834 ctcatcttcctgaggacaccagccatctcctctctcttcttcttggccctcttgtgggtg 41775 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 || | ||||| ||| ||||||||||| |||||||| ||||||||||| |||||||||||| Sbjct: 41774 ccaagctttctctttgccaccttcagtgcacgcttgtccttgccaactttgagaagctca 41715 Query: 464 gtgatacgcttctcatatggagcaaacccagcaacctccctgatcaagctcctaacgaaa 523 ||||||||||||||||| |||||||| ||||||||||||||||||||| |||| || || Sbjct: 41714 gtgatacgcttctcatagggagcaaatccagcaacctccctgatcaagttcctgacaaag 41655 Query: 524 tgcaccctcttggt 537 |||||||||||| Sbjct: 41654 gtcaccctcttggt 41641 Score = 81.8 bits (41), Expect = 2e-12 Identities = 44/45 (97%) Strand = Plus / Minus Query: 544 ccccttgcggtcggacgggcgcggcggcagctcgcgcttggtgac 588 ||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 40948 ccccttgcggtcggacgggcgaggcggcagctcgcgcttggtgac 40904 Score = 44.1 bits (22), Expect = 0.51 Identities = 44/50 (88%), Gaps = 1/50 (2%) Strand = Plus / Minus Query: 279 attgccattaacttcacgagcttgg-gatactctacttcttcttctcggt 327 |||||||| |||||| || ||||| ||||||||| |||||||||||||| Sbjct: 42457 attgccatggacttcatgaacttggagatactctatttcttcttctcggt 42408
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 242 bits (122), Expect = 1e-60 Identities = 176/194 (90%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 22452427 ctcatcttcctgaggacaccagccatctcctctctcttcttcttggccctcttgtgggtg 22452368 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 || | ||||| ||| ||||||||||| |||||||| ||||||||||| |||||||||||| Sbjct: 22452367 ccaagctttctctttgccaccttcagtgcacgcttgtccttgccaactttgagaagctca 22452308 Query: 464 gtgatacgcttctcatatggagcaaacccagcaacctccctgatcaagctcctaacgaaa 523 ||||||||||||||||| |||||||| ||||||||||||||||||||| |||| || || Sbjct: 22452307 gtgatacgcttctcatagggagcaaatccagcaacctccctgatcaagttcctgacaaag 22452248 Query: 524 tgcaccctcttggt 537 |||||||||||| Sbjct: 22452247 gtcaccctcttggt 22452234 Score = 81.8 bits (41), Expect = 2e-12 Identities = 44/45 (97%) Strand = Plus / Minus Query: 544 ccccttgcggtcggacgggcgcggcggcagctcgcgcttggtgac 588 ||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 22451541 ccccttgcggtcggacgggcgaggcggcagctcgcgcttggtgac 22451497 Score = 44.1 bits (22), Expect = 0.51 Identities = 44/50 (88%), Gaps = 1/50 (2%) Strand = Plus / Minus Query: 279 attgccattaacttcacgagcttgg-gatactctacttcttcttctcggt 327 |||||||| |||||| || ||||| ||||||||| |||||||||||||| Sbjct: 22453050 attgccatggacttcatgaacttggagatactctatttcttcttctcggt 22453001 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 560 gggcgcggcggcagctcgcgc 580 ||||||||||||||||||||| Sbjct: 10764328 gggcgcggcggcagctcgcgc 10764308
>gb|AY103812.1| Zea mays PCO072020 mRNA sequence Length = 667 Score = 224 bits (113), Expect = 3e-55 Identities = 221/257 (85%) Strand = Plus / Minus Query: 332 gtaccagcagatctcatcttcctgaggacactggacatctcctctctcttcttcttggcc 391 |||||||| |||||||||||||||||||| | ||||||||||||||||||||| ||| Sbjct: 364 gtaccagccgatctcatcttcctgaggacgcccatcatctcctctctcttcttctttgcc 305 Query: 392 ctcttgtgggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaacc 451 |||||||| || || | ||||| ||| || | ||||||||| ||||| |||||||||||| Sbjct: 304 ctcttgtgagttccaagctttctcttggcaagcttcagagcgcgcttgtccttgccaacc 245 Query: 452 ttgagaagctcagtgatacgcttctcatatggagcaaacccagcaacctccctgatcaag 511 || |||||||| ||||||||||||||||| |||||||| ||||||||||| ||||||| | Sbjct: 244 ttcagaagctcggtgatacgcttctcataaggagcaaagccagcaacctctctgatcagg 185 Query: 512 ctcctaacgaaatgcaccctcttggtacctttccccttgcggtcggacgggcgcggcggc 571 | ||| || | ||||||||| || ||||||||||||||| |||||||||| | ||| Sbjct: 184 cccctgaccatggacaccctcttcgttgctttccccttgcggtgggacgggcgcagaggc 125 Query: 572 agctcgcgcttggtgac 588 ||||||||||||||||| Sbjct: 124 agctcgcgcttggtgac 108
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 176 bits (89), Expect = 5e-41 Identities = 173/201 (86%) Strand = Plus / Plus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 ||||||||||||| ||||| | ||||||||||||||||||||| || ||||||||||| Sbjct: 36077363 ctcatcttcctgatgacacccgccatctcctctctcttcttctttgctctcttgtgggta 36077422 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 || | ||||| ||| || |||||||| |||||||| ||||| |||||||| ||||||||| Sbjct: 36077423 ccgagctttctcttagcgaccttcagtgcacgcttgtcctttccaaccttcagaagctca 36077482 Query: 464 gtgatacgcttctcatatggagcaaacccagcaacctccctgatcaagctcctaacgaaa 523 ||||| || ||||||||||||||||| || |||||||||| ||||||| ||| || ||| Sbjct: 36077483 gtgattcgtttctcatatggagcaaatcccacaacctccctaatcaagcccctgacaaaa 36077542 Query: 524 tgcaccctcttggtacctttc 544 | ||| |||||||||| |||| Sbjct: 36077543 ttcactctcttggtacttttc 36077563 Score = 73.8 bits (37), Expect = 6e-10 Identities = 43/45 (95%) Strand = Plus / Plus Query: 544 ccccttgcggtcggacgggcgcggcggcagctcgcgcttggtgac 588 ||||||||||||||||||||| || |||||||||||||||||||| Sbjct: 36078614 ccccttgcggtcggacgggcgaggtggcagctcgcgcttggtgac 36078658
>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0408C03 Length = 141273 Score = 176 bits (89), Expect = 5e-41 Identities = 173/201 (86%) Strand = Plus / Plus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 ||||||||||||| ||||| | ||||||||||||||||||||| || ||||||||||| Sbjct: 90088 ctcatcttcctgatgacacccgccatctcctctctcttcttctttgctctcttgtgggta 90147 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 || | ||||| ||| || |||||||| |||||||| ||||| |||||||| ||||||||| Sbjct: 90148 ccgagctttctcttagcgaccttcagtgcacgcttgtcctttccaaccttcagaagctca 90207 Query: 464 gtgatacgcttctcatatggagcaaacccagcaacctccctgatcaagctcctaacgaaa 523 ||||| || ||||||||||||||||| || |||||||||| ||||||| ||| || ||| Sbjct: 90208 gtgattcgtttctcatatggagcaaatcccacaacctccctaatcaagcccctgacaaaa 90267 Query: 524 tgcaccctcttggtacctttc 544 | ||| |||||||||| |||| Sbjct: 90268 ttcactctcttggtacttttc 90288 Score = 73.8 bits (37), Expect = 6e-10 Identities = 43/45 (95%) Strand = Plus / Plus Query: 544 ccccttgcggtcggacgggcgcggcggcagctcgcgcttggtgac 588 ||||||||||||||||||||| || |||||||||||||||||||| Sbjct: 91339 ccccttgcggtcggacgggcgaggtggcagctcgcgcttggtgac 91383
>gb|BT013173.1| Lycopersicon esculentum clone 134246F, mRNA sequence Length = 553 Score = 143 bits (72), Expect = 7e-31 Identities = 141/164 (85%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||| |||||||| ||||||||| |||| ||||||||||| || Sbjct: 340 ctcatcttgcggagaacactagacatctcttctctcttcctctttgccctcttgtgagta 281 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||| | ||| || ||||||| |||||||| ||||| ||||| |||||||||||| Sbjct: 280 cccaacttcctcttggctaccttcaaggcacgcttgtcctttccaactttgagaagctca 221 Query: 464 gtgatacgcttctcatatggagcaaacccagcaacctccctgat 507 ||||| | |||||||||||||||||| |||||||| || ||||| Sbjct: 220 gtgatcctcttctcatatggagcaaatccagcaacttctctgat 177
>gb|AC146755.23| Medicago truncatula clone mth2-15i15, complete sequence Length = 108159 Score = 143 bits (72), Expect = 7e-31 Identities = 162/192 (84%) Strand = Plus / Plus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||||||||||||| | ||||||||||||||||||||||| || | ||||||||| Sbjct: 21692 ctcatcttcctgaggacattagacatctcctctctcttcttctttgcacgcttgtgggtt 21751 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 || | ||||| ||| || ||||| || || | ||| || || ||||||||||| | |||| Sbjct: 21752 ccaagctttctctttgcaaccttaagcgccctcttgtcttttccaaccttgagcaactca 21811 Query: 464 gtgatacgcttctcatatggagcaaacccagcaacctccctgatcaagctcctaacgaaa 523 || |||||||||||||| || ||||||||||||||||| ||||| | | |||| || || Sbjct: 21812 gttatacgcttctcataaggtgcaaacccagcaacctctctgatgaggttcctcacaaag 21871 Query: 524 tgcaccctcttg 535 |||||||||||| Sbjct: 21872 tgcaccctcttg 21883
>ref|NM_129316.2| Arabidopsis thaliana structural constituent of ribosome AT2G37600 mRNA, complete cds Length = 545 Score = 125 bits (63), Expect = 2e-25 Identities = 123/143 (86%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||| |||||||||||||||||| |||| || |||||||| || Sbjct: 340 ctcatcttgcggagaacactagacatctcctctctcttcctcttagctctcttgtgagta 281 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||| | ||| || ||||| ||||||||||| || || |||||||||||||||||| Sbjct: 280 cccaacttcctcttagcaaccttaagagcacgcttgtctttcccaaccttgagaagctca 221 Query: 464 gtgatacgcttctcatatggagc 486 ||||| | ||||||||| ||||| Sbjct: 220 gtgattctcttctcataaggagc 198
>gb|AC004684.3| Arabidopsis thaliana chromosome 2 clone F13M22 map ve018, complete sequence Length = 93845 Score = 125 bits (63), Expect = 2e-25 Identities = 123/143 (86%) Strand = Plus / Plus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||| |||||||||||||||||| |||| || |||||||| || Sbjct: 30659 ctcatcttgcggagaacactagacatctcctctctcttcctcttagctctcttgtgagta 30718 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||| | ||| || ||||| ||||||||||| || || |||||||||||||||||| Sbjct: 30719 cccaacttcctcttagcaaccttaagagcacgcttgtctttcccaaccttgagaagctca 30778 Query: 464 gtgatacgcttctcatatggagc 486 ||||| | ||||||||| ||||| Sbjct: 30779 gtgattctcttctcataaggagc 30801
>gb|AY060496.1| Arabidopsis thaliana At2g37600/F13M22.10 mRNA, complete cds Length = 342 Score = 125 bits (63), Expect = 2e-25 Identities = 123/143 (86%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||| |||||||||||||||||| |||| || |||||||| || Sbjct: 302 ctcatcttgcggagaacactagacatctcctctctcttcctcttagctctcttgtgagta 243 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||| | ||| || ||||| ||||||||||| || || |||||||||||||||||| Sbjct: 242 cccaacttcctcttagcaaccttaagagcacgcttgtctttcccaaccttgagaagctca 183 Query: 464 gtgatacgcttctcatatggagc 486 ||||| | ||||||||| ||||| Sbjct: 182 gtgattctcttctcataaggagc 160
>gb|AY052221.1| Arabidopsis thaliana At2g37600/F13M22.10 mRNA, complete cds Length = 523 Score = 125 bits (63), Expect = 2e-25 Identities = 123/143 (86%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||| |||||||||||||||||| |||| || |||||||| || Sbjct: 335 ctcatcttgcggagaacactagacatctcctctctcttcctcttagctctcttgtgagta 276 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||| | ||| || ||||| ||||||||||| || || |||||||||||||||||| Sbjct: 275 cccaacttcctcttagcaaccttaagagcacgcttgtctttcccaaccttgagaagctca 216 Query: 464 gtgatacgcttctcatatggagc 486 ||||| | ||||||||| ||||| Sbjct: 215 gtgattctcttctcataaggagc 193
>emb|BX821546.1|CNS0AABC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL51ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 515 Score = 125 bits (63), Expect = 2e-25 Identities = 123/143 (86%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||| |||||||||||||||||| |||| || |||||||| || Sbjct: 310 ctcatcttgcggagaacactagacatctcctctctcttcctcttagctctcttgtgagta 251 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||| | ||| || ||||| ||||||||||| || || |||||||||||||||||| Sbjct: 250 cccaacttcctcttagcaaccttaagagcacgcttgtctttcccaaccttgagaagctca 191 Query: 464 gtgatacgcttctcatatggagc 486 ||||| | ||||||||| ||||| Sbjct: 190 gtgattctcttctcataaggagc 168
>gb|U47095.1|DCU47095 Daucus carota putative ribosomal protein mRNA, somatic embryo clone Gea42, partial cds Length = 528 Score = 123 bits (62), Expect = 7e-25 Identities = 119/137 (86%), Gaps = 1/137 (0%) Strand = Plus / Minus Query: 363 tggacatctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgc-c 421 ||||||||||||||||||||||||| || |||||||| ||||||||||||| ||| || | Sbjct: 300 tggacatctcctctctcttcttctttgctctcttgtgagtgcccaactttctcttggcgc 241 Query: 422 accttcagagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatat 481 || |||| |||||||||||| || ||||| ||||| |||||||| || | ||||||||| Sbjct: 240 actttcaaagcacgcttatcttttccaactttgagcagctcagtaatcctcttctcatac 181 Query: 482 ggagcaaacccagcaac 498 |||| ||| |||||||| Sbjct: 180 ggagnaaaaccagcaac 164
>gb|AY086261.1| Arabidopsis thaliana clone 23114 mRNA, complete sequence Length = 542 Score = 117 bits (59), Expect = 4e-23 Identities = 122/143 (85%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||| |||||||||||||||||| |||| || |||||||| || Sbjct: 340 ctcatcttgcggagaacactagacatctcctctctcttcctcttagctctcttgtgagta 281 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||| | ||| || ||||| ||||||||||| || || || ||||||||||||||| Sbjct: 280 cccaacttcctcttagcaaccttaagagcacgcttgtctttccctaccttgagaagctca 221 Query: 464 gtgatacgcttctcatatggagc 486 ||||| | ||||||||| ||||| Sbjct: 220 gtgattctcttctcataaggagc 198
>gb|AF401680.1|AF401680 Orobanche cumana putative 60S ribosomal protein L36 mRNA, partial cds Length = 497 Score = 113 bits (57), Expect = 7e-22 Identities = 115/133 (86%), Gaps = 1/133 (0%) Strand = Plus / Minus Query: 367 catctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgcc-acct 425 ||||||||||||||||||||| || |||||| |||||||||| |||| ||| || |||| Sbjct: 204 catctcctctctcttcttctttgctctcttgggggtgcccaattttctcttggcgtacct 145 Query: 426 tcagagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatatggag 485 | ||||||||||| ||||| || || || |||||||||||||| | ||||||||| || | Sbjct: 144 taagagcacgcttgtcctttccgactttaagaagctcagtgatcctcttctcataagggg 85 Query: 486 caaacccagcaac 498 ||||||||||||| Sbjct: 84 caaacccagcaac 72
>emb|BX820780.1|CNS0A9P3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH68ZG12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 482 Score = 113 bits (57), Expect = 7e-22 Identities = 108/125 (86%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||| |||||||||||||||||| |||| || |||||||| || Sbjct: 339 ctcatcttgcggagaacactagacatctcctctctcttcctcttagctctcttgtgagta 280 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||| | ||| || ||||| ||||||||||| || || |||||||||||||||||| Sbjct: 279 cccaacttcctcttagcaaccttaagagcacgcttgtctttcccaaccttgagaagctca 220 Query: 464 gtgat 468 ||||| Sbjct: 219 gtgat 215
>ref|NM_001035778.1| Arabidopsis thaliana structural constituent of ribosome AT3G53740 transcript variant AT3G53740.3 mRNA, complete cds Length = 579 Score = 111 bits (56), Expect = 3e-21 Identities = 125/148 (84%) Strand = Plus / Minus Query: 339 cagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgt 398 |||| |||||||| | ||| ||||||||||||||||||||||| |||||| ||||||| Sbjct: 353 cagacctcatcttgcggagaacactggacatctcctctctctttcgcttggctctcttgt 294 Query: 399 gggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaa 458 |||| |||||||| | ||| || ||||| |||||||| || || || |||||||| | || Sbjct: 293 gggttcccaacttcctcttagcaaccttaagagcacgtttgtctttaccaaccttcaaaa 234 Query: 459 gctcagtgatacgcttctcatatggagc 486 |||||||||| | ||||||||| ||||| Sbjct: 233 gctcagtgattctcttctcatagggagc 206
>ref|NM_180366.2| Arabidopsis thaliana structural constituent of ribosome AT3G53740 transcript variant AT3G53740.2 mRNA, complete cds Length = 598 Score = 111 bits (56), Expect = 3e-21 Identities = 125/148 (84%) Strand = Plus / Minus Query: 339 cagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgt 398 |||| |||||||| | ||| ||||||||||||||||||||||| |||||| ||||||| Sbjct: 357 cagacctcatcttgcggagaacactggacatctcctctctctttcgcttggctctcttgt 298 Query: 399 gggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaa 458 |||| |||||||| | ||| || ||||| |||||||| || || || |||||||| | || Sbjct: 297 gggttcccaacttcctcttagcaaccttaagagcacgtttgtctttaccaaccttcaaaa 238 Query: 459 gctcagtgatacgcttctcatatggagc 486 |||||||||| | ||||||||| ||||| Sbjct: 237 gctcagtgattctcttctcatagggagc 210
>gb|AY081579.1| Arabidopsis thaliana 60S ribosomal protein L36-like protein (F5K20.4) mRNA, complete cds Length = 485 Score = 111 bits (56), Expect = 3e-21 Identities = 125/148 (84%) Strand = Plus / Minus Query: 339 cagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgt 398 |||| |||||||| | ||| ||||||||||||||||||||||| |||||| ||||||| Sbjct: 307 cagacctcatcttgcggagaacactggacatctcctctctctttcgcttggctctcttgt 248 Query: 399 gggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaa 458 |||| |||||||| | ||| || ||||| |||||||| || || || |||||||| | || Sbjct: 247 gggttcccaacttcctcttagcaaccttaagagcacgtttgtctttaccaaccttcaaaa 188 Query: 459 gctcagtgatacgcttctcatatggagc 486 |||||||||| | ||||||||| ||||| Sbjct: 187 gctcagtgattctcttctcatagggagc 160
>gb|AY062791.1| Arabidopsis thaliana 60S RIBOSOMAL PROTEIN L36 homolog (F5K20.4) mRNA, complete cds Length = 558 Score = 111 bits (56), Expect = 3e-21 Identities = 125/148 (84%) Strand = Plus / Minus Query: 339 cagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgt 398 |||| |||||||| | ||| ||||||||||||||||||||||| |||||| ||||||| Sbjct: 357 cagacctcatcttgcggagaacactggacatctcctctctctttcgcttggctctcttgt 298 Query: 399 gggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaa 458 |||| |||||||| | ||| || ||||| |||||||| || || || |||||||| | || Sbjct: 297 gggttcccaacttcctcttagcaaccttaagagcacgtttgtctttaccaaccttcaaaa 238 Query: 459 gctcagtgatacgcttctcatatggagc 486 |||||||||| | ||||||||| ||||| Sbjct: 237 gctcagtgattctcttctcatagggagc 210
>emb|BX822929.1|CNS0A75W Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB73ZF01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 538 Score = 111 bits (56), Expect = 3e-21 Identities = 125/148 (84%) Strand = Plus / Minus Query: 339 cagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgt 398 |||| |||||||| | ||| ||||||||||||||||||||||| |||||| ||||||| Sbjct: 312 cagacctcatcttgcggagaacactggacatctcctctctctttcgcttggctctcttgt 253 Query: 399 gggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaa 458 |||| |||||||| | ||| || ||||| |||||||| || || || |||||||| | || Sbjct: 252 gggttcccaacttcctcttagcaaccttaagagcacgtttgtctttaccaaccttcaaaa 193 Query: 459 gctcagtgatacgcttctcatatggagc 486 |||||||||| | ||||||||| ||||| Sbjct: 192 gctcagtgattctcttctcatagggagc 165
>gb|AY310777.1| Nicotiana benthamiana clone 8-287 unknown mRNA Length = 457 Score = 109 bits (55), Expect = 1e-20 Identities = 154/188 (81%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| || || || |||||||||||||||||||| || |||||||| || Sbjct: 317 ctcatcttgcggagaacgcttganatctcctctctcttcttctttgctctcttgtgagta 258 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||| | ||| || ||||||| ||| ||||| ||||| |||||| | || |||||| Sbjct: 257 cccaacttcctcttggctaccttcaaagcccgcttgtcctttccaaccntaagcagctca 198 Query: 464 gtgatacgcttctcatatggagcaaacccagcaacctccctgatcaagctcctaacgaaa 523 || || | ||||| |||||| ||||| |||||||| || ||||| | ||| || |||||| Sbjct: 197 gtaattctcttctnatatggtgcaaatccagcaacttctctgatgaggcttcttacgaaa 138 Query: 524 tgcaccct 531 || ||||| Sbjct: 137 tggaccct 130
>emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BAC clone F5K20 Length = 119407 Score = 109 bits (55), Expect = 1e-20 Identities = 121/143 (84%) Strand = Plus / Plus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 16577 ctcatcttgcggagaacactggacatctcctctctctttcgcttggctctcttgtgggtt 16636 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||| | ||| || ||||| |||||||| || || || |||||||| | ||||||| Sbjct: 16637 cccaacttcctcttagcaaccttaagagcacgtttgtctttaccaaccttcaaaagctca 16696 Query: 464 gtgatacgcttctcatatggagc 486 ||||| | ||||||||| ||||| Sbjct: 16697 gtgattctcttctcatagggagc 16719
>emb|BX822668.1|CNS0A7SZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB57ZC11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 580 Score = 103 bits (52), Expect = 6e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 339 cagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgt 398 |||| |||||||| | ||| ||||||||||||||||||||||| |||||| ||||||| Sbjct: 334 cagacctcatcttgcggagaacactggacatctcctctctctttcgcttggctctcttgt 275 Query: 399 gggtgcccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaa 458 ||| |||||||| | ||| || ||||| |||||||| || || || |||||||| | || Sbjct: 274 aggttcccaacttcctcttagcaaccttaagagcacgtttgtctttaccaaccttcaaaa 215 Query: 459 gctcagtgatacgcttctcatatggagc 486 |||||||||| | ||||||||| ||||| Sbjct: 214 gctcagtgattctcttctcatagggagc 187
>ref|NM_120323.2| Arabidopsis thaliana structural constituent of ribosome AT5G02450 mRNA, complete cds Length = 650 Score = 95.6 bits (48), Expect = 2e-16 Identities = 146/178 (82%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 312 acttcttcttctcggtt---ccagtaccagcagatctcatcttcctgaggacactggaca 368 ||||||||||||||| | |||| |||| |||| |||||||| | ||| |||||||||| Sbjct: 405 acttcttcttctcggatgcaccagcaccaccagacctcatcttgcggagaacactggaca 346 Query: 369 tctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgccaccttca 428 ||||||||||||| || || |||||||| || |||||||||||||| || || || | Sbjct: 345 tctcctctctctttcgtttagctctcttgtgagttcccaactttcgcttggcaactttaa 286 Query: 429 gagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatatggagc 486 |||| | ||| || || |||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 285 gagctctcttgtctttaccaaccttcaaaagctcagtgatcctcttctcatagggagc 228
>gb|AF339702.1| Arabidopsis thaliana putative 60S ribosomal protein (At5g02450) mRNA, complete cds Length = 377 Score = 95.6 bits (48), Expect = 2e-16 Identities = 146/178 (82%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 312 acttcttcttctcggtt---ccagtaccagcagatctcatcttcctgaggacactggaca 368 ||||||||||||||| | |||| |||| |||| |||||||| | ||| |||||||||| Sbjct: 325 acttcttcttctcggatgcaccagcaccaccagacctcatcttgcggagaacactggaca 266 Query: 369 tctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgccaccttca 428 ||||||||||||| || || |||||||| || |||||||||||||| || || || | Sbjct: 265 tctcctctctctttcgtttagctctcttgtgagttcccaactttcgcttggcaactttaa 206 Query: 429 gagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatatggagc 486 |||| | ||| || || |||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 205 gagctctcttgtctttaccaaccttcaaaagctcagtgatcctcttctcatagggagc 148
>gb|AF326882.1| Arabidopsis thaliana putative 60S ribosomal protein (At5g02450) mRNA, complete cds Length = 528 Score = 95.6 bits (48), Expect = 2e-16 Identities = 146/178 (82%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 312 acttcttcttctcggtt---ccagtaccagcagatctcatcttcctgaggacactggaca 368 ||||||||||||||| | |||| |||| |||| |||||||| | ||| |||||||||| Sbjct: 367 acttcttcttctcggatgcaccagcaccaccagacctcatcttgcggagaacactggaca 308 Query: 369 tctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgccaccttca 428 ||||||||||||| || || |||||||| || |||||||||||||| || || || | Sbjct: 307 tctcctctctctttcgtttagctctcttgtgagttcccaactttcgcttggcaactttaa 248 Query: 429 gagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatatggagc 486 |||| | ||| || || |||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 247 gagctctcttgtctttaccaaccttcaaaagctcagtgatcctcttctcatagggagc 190
>gb|AY133624.1| Arabidopsis thaliana AT5g02450/T22P11_40 mRNA, complete cds Length = 327 Score = 95.6 bits (48), Expect = 2e-16 Identities = 146/178 (82%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 312 acttcttcttctcggtt---ccagtaccagcagatctcatcttcctgaggacactggaca 368 ||||||||||||||| | |||| |||| |||| |||||||| | ||| |||||||||| Sbjct: 325 acttcttcttctcggatgcaccagcaccaccagacctcatcttgcggagaacactggaca 266 Query: 369 tctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgccaccttca 428 ||||||||||||| || || |||||||| || |||||||||||||| || || || | Sbjct: 265 tctcctctctctttcgtttagctctcttgtgagttcccaactttcgcttggcaactttaa 206 Query: 429 gagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatatggagc 486 |||| | ||| || || |||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 205 gagctctcttgtctttaccaaccttcaaaagctcagtgatcctcttctcatagggagc 148
>gb|AY057706.1| Arabidopsis thaliana AT5g02450/T22P11_40 mRNA, complete cds Length = 504 Score = 95.6 bits (48), Expect = 2e-16 Identities = 146/178 (82%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 312 acttcttcttctcggtt---ccagtaccagcagatctcatcttcctgaggacactggaca 368 ||||||||||||||| | |||| |||| |||| |||||||| | ||| |||||||||| Sbjct: 367 acttcttcttctcggatgcaccagcaccaccagacctcatcttgcggagaacactggaca 308 Query: 369 tctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgccaccttca 428 ||||||||||||| || || |||||||| || |||||||||||||| || || || | Sbjct: 307 tctcctctctctttcgtttagctctcttgtgagttcccaactttcgcttggcaactttaa 248 Query: 429 gagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatatggagc 486 |||| | ||| || || |||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 247 gagctctcttgtctttaccaaccttcaaaagctcagtgatcctcttctcatagggagc 190
>gb|AF324687.2|AF324687 Arabidopsis thaliana AT5g02450 (AT5g02450/T22P11_40) mRNA, complete cds Length = 512 Score = 95.6 bits (48), Expect = 2e-16 Identities = 146/178 (82%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 312 acttcttcttctcggtt---ccagtaccagcagatctcatcttcctgaggacactggaca 368 ||||||||||||||| | |||| |||| |||| |||||||| | ||| |||||||||| Sbjct: 367 acttcttcttctcggatgcaccagcaccaccagacctcatcttgcggagaacactggaca 308 Query: 369 tctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgccaccttca 428 ||||||||||||| || || |||||||| || |||||||||||||| || || || | Sbjct: 307 tctcctctctctttcgtttagctctcttgtgagttcccaactttcgcttggcaactttaa 248 Query: 429 gagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatatggagc 486 |||| | ||| || || |||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 247 gagctctcttgtctttaccaaccttcaaaagctcagtgatcctcttctcatagggagc 190
>emb|BX833475.1|CNS09Z2B Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL58ZB10 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 597 Score = 95.6 bits (48), Expect = 2e-16 Identities = 146/178 (82%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 312 acttcttcttctcggtt---ccagtaccagcagatctcatcttcctgaggacactggaca 368 ||||||||||||||| | |||| |||| |||| |||||||| | ||| |||||||||| Sbjct: 333 acttcttcttctcggatgcaccagcaccaccagacctcatcttgcggagaacactggaca 274 Query: 369 tctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgccaccttca 428 ||||||||||||| || || |||||||| || |||||||||||||| || || || | Sbjct: 273 tctcctctctctttcgtttagctctcttgtgagttcccaactttcgcttggcaactttaa 214 Query: 429 gagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatatggagc 486 |||| | ||| || || |||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 213 gagctctcttgtctttaccaaccttcaaaagctcagtgatcctcttctcatagggagc 156
>emb|BX830576.1|CNS09YOA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB91ZA02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 537 Score = 95.6 bits (48), Expect = 2e-16 Identities = 146/178 (82%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 312 acttcttcttctcggtt---ccagtaccagcagatctcatcttcctgaggacactggaca 368 ||||||||||||||| | |||| |||| |||| |||||||| | ||| |||||||||| Sbjct: 333 acttcttcttctcggatgcaccagcaccaccagacctcatcttgcggagaacactggaca 274 Query: 369 tctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgccaccttca 428 ||||||||||||| || || |||||||| || |||||||||||||| || || || | Sbjct: 273 tctcctctctctttcgtttagctctcttgtgagttcccaactttcgcttggcaactttaa 214 Query: 429 gagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatatggagc 486 |||| | ||| || || |||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 213 gagctctcttgtctttaccaaccttcaaaagctcagtgatcctcttctcatagggagc 156
>gb|AY087041.1| Arabidopsis thaliana clone 30903 mRNA, complete sequence Length = 541 Score = 87.7 bits (44), Expect = 4e-14 Identities = 145/178 (81%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 312 acttcttcttctcggtt---ccagtaccagcagatctcatcttcctgaggacactggaca 368 ||||||||||||||| | |||| |||| |||| |||||||| | ||| ||||| |||| Sbjct: 405 acttcttcttctcggatgcaccagcaccaccagacctcatcttgcggagaacactagaca 346 Query: 369 tctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgccaccttca 428 ||||||||||||| || || |||||||| || |||||||||||||| || || || | Sbjct: 345 tctcctctctctttcgtttagctctcttgtgagttcccaactttcgcttggcaactttaa 286 Query: 429 gagcacgcttatccttgccaaccttgagaagctcagtgatacgcttctcatatggagc 486 |||| | ||| || || |||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 285 gagctctcttgtctttaccaaccttcaaaagctcagtgatcctcttctcatagggagc 228
>emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, BAC clone T22P11 (ESSA project) Length = 96424 Score = 85.7 bits (43), Expect = 2e-13 Identities = 118/143 (82%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||||||||||||||||||||| || || |||||||| || Sbjct: 15168 ctcatcttgcggagaacactggacatctcctctctctttcgtttagctctcttgtgagtt 15109 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||||||||| || || || ||||| | ||| || || |||||||| | ||||||| Sbjct: 15108 cccaactttcgcttggcaactttaagagctctcttgtctttaccaaccttcaaaagctca 15049 Query: 464 gtgatacgcttctcatatggagc 486 ||||| | ||||||||| ||||| Sbjct: 15048 gtgatcctcttctcatagggagc 15026
>emb|AL162874.1|ATT1E22 Arabidopsis thaliana DNA chromosome 5, BAC clone T1E22 (ESSA project) Length = 96575 Score = 85.7 bits (43), Expect = 2e-13 Identities = 118/143 (82%) Strand = Plus / Minus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 |||||||| | ||| ||||||||||||||||||||||| || || |||||||| || Sbjct: 83187 ctcatcttgcggagaacactggacatctcctctctctttcgtttagctctcttgtgagtt 83128 Query: 404 cccaactttcgcttcgccaccttcagagcacgcttatccttgccaaccttgagaagctca 463 |||||||||||||| || || || ||||| | ||| || || |||||||| | ||||||| Sbjct: 83127 cccaactttcgcttggcaactttaagagctctcttgtctttaccaaccttcaaaagctca 83068 Query: 464 gtgatacgcttctcatatggagc 486 ||||| | ||||||||| ||||| Sbjct: 83067 gtgatcctcttctcatagggagc 83045
>dbj|AK111268.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-180-F09, full insert sequence Length = 724 Score = 81.8 bits (41), Expect = 2e-12 Identities = 44/45 (97%) Strand = Plus / Minus Query: 544 ccccttgcggtcggacgggcgcggcggcagctcgcgcttggtgac 588 ||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 259 ccccttgcggtcggacgggcgaggcggcagctcgcgcttggtgac 215
>gb|DQ207665.1| Zea mays cultivar inbred line Mo17 IDP177 marker Length = 607 Score = 77.8 bits (39), Expect = 4e-11 Identities = 81/95 (85%) Strand = Plus / Plus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtgggtg 403 ||||||||||||||||| | | ||||||||||||||||||||| ||||||||||| || Sbjct: 512 ctcatcttcctgaggacgcccgccatctcctctctcttcttctttgccctcttgtgagtt 571 Query: 404 cccaactttcgcttcgccaccttcagagcacgctt 438 || | ||||| ||| || | |||||| |||||||| Sbjct: 572 ccaagctttctcttagcaagcttcagggcacgctt 606
>ref|NM_115234.2| Arabidopsis thaliana structural constituent of ribosome AT3G53740 transcript variant AT3G53740.1 mRNA, complete cds Length = 557 Score = 75.8 bits (38), Expect = 1e-10 Identities = 77/90 (85%) Strand = Plus / Minus Query: 339 cagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgt 398 |||| |||||||| | ||| ||||||||||||||||||||||| |||||| ||||||| Sbjct: 346 cagacctcatcttgcggagaacactggacatctcctctctctttcgcttggctctcttgt 287 Query: 399 gggtgcccaactttcgcttcgccaccttca 428 |||| |||||||| | ||| || ||||||| Sbjct: 286 gggttcccaacttcctcttagcaaccttca 257 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 447 caaccttgagaagctcagtgatacgcttctcatatggagc 486 ||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 265 caaccttcaaaagctcagtgattctcttctcatagggagc 226
>gb|AY086677.1| Arabidopsis thaliana clone 267357 mRNA, complete sequence Length = 546 Score = 75.8 bits (38), Expect = 1e-10 Identities = 77/90 (85%) Strand = Plus / Minus Query: 339 cagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgt 398 |||| |||||||| | ||| ||||||||||||||||||||||| |||||| ||||||| Sbjct: 347 cagacctcatcttgcggagaacactggacatctcctctctctttcgcttggctctcttgt 288 Query: 399 gggtgcccaactttcgcttcgccaccttca 428 |||| |||||||| | ||| || ||||||| Sbjct: 287 gggttcccaacttcctcttagcaaccttca 258 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 447 caaccttgagaagctcagtgatacgcttctcatatggagc 486 ||||||| | |||||||||||| | ||||||||| ||||| Sbjct: 266 caaccttcaaaagctcagtgattctcttctcatagggagc 227
>gb|DQ207664.1| Zea mays cultivar B73 IDP177 marker Length = 777 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Plus Query: 344 ctcatcttcctgaggacactggacatctcctctctcttcttcttggccctcttgtg 399 ||||||||||||||||| | | ||||||||||||||||||||| ||||||||||| Sbjct: 686 ctcatcttcctgaggacgcccgccatctcctctctcttcttctttgccctcttgtg 741
>dbj|AB083110.1| Allium cepa L36 mRNA for 60S ribosomal protein L36 homolog, complete cds Length = 438 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 334 accagcagatctcatcttcctgaggacactggacatctcctctctcttcttcttggccct 393 ||||||||| |||||||| | |||||| | ||||||||||| |||||| |||| || || Sbjct: 213 accagcagacctcatctttcgaaggacatttgacatctcctccctcttcctcttagctct 154 Query: 394 cttgtgggtgcccaactttc 413 ||||||||| |||||||||| Sbjct: 153 cttgtgggttcccaactttc 134
>dbj|AP006671.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT39I14, TM0368c, complete sequence Length = 71495 Score = 63.9 bits (32), Expect = 6e-07 Identities = 80/96 (83%) Strand = Plus / Minus Query: 436 cttatccttgccaaccttgagaagctcagtgatacgcttctcatatggagcaaacccagc 495 |||||| || |||||||| || | |||||| |||||||||||||| || ||||||||||| Sbjct: 9708 cttatcttttccaaccttcagcaactcagttatacgcttctcataaggtgcaaacccagc 9649 Query: 496 aacctccctgatcaagctcctaacgaaatgcaccct 531 ||| || | ||| | |||||| || || |||||||| Sbjct: 9648 aacttcacggatgaggctccttacaaagtgcaccct 9613
>dbj|AB045113.1| Enteromorpha compressa EcRL36 mRNA for ribosomal protein L36, complete cds Length = 555 Score = 54.0 bits (27), Expect = 5e-04 Identities = 72/87 (82%) Strand = Plus / Minus Query: 367 catctcctctctcttcttcttggccctcttgtgggtgcccaactttcgcttcgccacctt 426 ||||||||| |||||||||||| | | | |||| |||||||| || ||||| || ||| Sbjct: 276 catctcctccctcttcttcttgccgcgcatgtgtgtgcccaatttgcgcttgcacatctt 217 Query: 427 cagagcacgcttatccttgccaacctt 453 || ||||||||| ||||| |||||||| Sbjct: 216 caaagcacgcttgtccttaccaacctt 190
>ref|XM_531768.2| PREDICTED: Canis familiaris similar to RAN-binding protein 2-like 1 isoform 1 (LOC474539), mRNA Length = 6708 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 102 aagctaacagataatgaaaaag 123 |||||||||||||||||||||| Sbjct: 5173 aagctaacagataatgaaaaag 5194
>emb|AJ427420.1|CGI427420 Crassostrea gigas partial mRNA for bone morphogenic protein type 2 receptor (BMP-R2 gene) Length = 4426 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Minus Query: 386 ttggccctcttgtgggtgccca 407 |||||||||||||||||||||| Sbjct: 856 ttggccctcttgtgggtgccca 835
>gb|AE005968.1| Caulobacter crescentus CB15 section 294 of 359 of the complete genome Length = 11996 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Minus Query: 545 cccttgcggtcggacgggcgcg 566 |||||||||||||||||||||| Sbjct: 7636 cccttgcggtcggacgggcgcg 7615
>gb|AY155563.1| Aedes polynesiensis late trypsin gene, complete cds Length = 4397 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Minus Query: 369 tctcctctctcttcttcttggc 390 |||||||||||||||||||||| Sbjct: 1444 tctcctctctcttcttcttggc 1423
>gb|AC136522.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0037H03, complete sequence Length = 185881 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 560 gggcgcggcggcagctcgcgc 580 ||||||||||||||||||||| Sbjct: 148928 gggcgcggcggcagctcgcgc 148908
>emb|CR848666.4| Zebrafish DNA sequence from clone DKEY-56F14 in linkage group 16, complete sequence Length = 106065 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 279 attgccattaacttcacgagc 299 ||||||||||||||||||||| Sbjct: 90301 attgccattaacttcacgagc 90321
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence Length = 2331000 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 560 gggcgcggcggcagctcgcgc 580 ||||||||||||||||||||| Sbjct: 1788935 gggcgcggcggcagctcgcgc 1788915
>gb|AC102133.27| Mus musculus chromosome 1, clone RP23-241J21, complete sequence Length = 203349 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 371 tcctctctcttcttcttggcc 391 ||||||||||||||||||||| Sbjct: 75970 tcctctctcttcttcttggcc 75950
>gb|AC162170.5| Mus musculus chromosome 1, clone RP23-240G10, complete sequence Length = 159806 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 371 tcctctctcttcttcttggcc 391 ||||||||||||||||||||| Sbjct: 9734 tcctctctcttcttcttggcc 9754
>emb|AL645570.13| Mouse DNA sequence from clone RP23-377H12 on chromosome 11 Contains two novel genes, the 3' end of the Meis1 gene for myeloid ecotropic viral integration site 1 and two CpG islands, complete sequence Length = 190198 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 116 tgaaaaagcaaaccaagaaaa 136 ||||||||||||||||||||| Sbjct: 168078 tgaaaaagcaaaccaagaaaa 168098
>gb|AY736122.1| Triticum aestivum chloroplast inositol phosphatase-like protein mRNA, complete cds; nuclear gene for chloroplast product Length = 909 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 369 tctcctctctcttcttcttggccctcttg 397 ||||||||||||||||||| |||||||| Sbjct: 830 tctcctctctcttcttcttttccctcttg 802
>gb|AC122147.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAb0072F04, complete sequence Length = 137724 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 560 gggcgcggcggcagctcgcgc 580 ||||||||||||||||||||| Sbjct: 7388 gggcgcggcggcagctcgcgc 7368
>gb|AC092553.4| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBb0072F04, complete sequence Length = 133121 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 560 gggcgcggcggcagctcgcgc 580 ||||||||||||||||||||| Sbjct: 40509 gggcgcggcggcagctcgcgc 40489
>gb|AY895166.1| Gallus gallus BAC bW108010 chemokine-like ligand 1, SCYA4, chemokine K203, and chemokine ah294 genes, complete cds Length = 112034 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 gacactggacatctcctctct 378 ||||||||||||||||||||| Sbjct: 100063 gacactggacatctcctctct 100083
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 560 gggcgcggcggcagctcgcgc 580 ||||||||||||||||||||| Sbjct: 1788935 gggcgcggcggcagctcgcgc 1788915
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 560 gggcgcggcggcagctcgcgc 580 ||||||||||||||||||||| Sbjct: 1788886 gggcgcggcggcagctcgcgc 1788866
>ref|NM_138854.1| Rattus norvegicus solute carrier family 38, member 5 (Slc38a5), mRNA Length = 1891 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 tcttcttcttggccctcttg 397 |||||||||||||||||||| Sbjct: 357 tcttcttcttggccctcttg 376
>gb|BC040274.1| Mus musculus coagulation factor XIII, A1 subunit, mRNA (cDNA clone MGC:7202 IMAGE:3482233), complete cds Length = 3871 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 374 tctctcttcttcttggccctcttg 397 |||||||||||||||||| ||||| Sbjct: 1560 tctctcttcttcttggccttcttg 1537
>gb|BC011073.1| Mus musculus coagulation factor XIII, A1 subunit, mRNA (cDNA clone IMAGE:4013001), containing frame-shift errors Length = 2988 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 374 tctctcttcttcttggccctcttg 397 |||||||||||||||||| ||||| Sbjct: 650 tctctcttcttcttggccttcttg 627
>ref|XM_361587.1| Magnaporthe grisea 70-15 hypothetical protein (MG04061.4) partial mRNA Length = 5295 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 495 caacctccctgatcaagctc 514 |||||||||||||||||||| Sbjct: 825 caacctccctgatcaagctc 844
>ref|NM_028784.2| Mus musculus coagulation factor XIII, A1 subunit (F13a1), mRNA Length = 3871 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 374 tctctcttcttcttggccctcttg 397 |||||||||||||||||| ||||| Sbjct: 1560 tctctcttcttcttggccttcttg 1537
>gb|AC138026.4| Mus musculus BAC clone RP24-501L6 from chromosome 10, complete sequence Length = 183477 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcttcctgaggacactgg 365 |||||||||||||||||||| Sbjct: 150420 catcttcctgaggacactgg 150401
>gb|AC132395.3| Mus musculus BAC clone RP23-391F17 from chromosome 18, complete sequence Length = 212786 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 21 tcttaaccaggagcctacag 40 |||||||||||||||||||| Sbjct: 44647 tcttaaccaggagcctacag 44628
>gb|AC146704.8| Medicago truncatula clone mth2-107f11, complete sequence Length = 116591 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 gaaaaagcaaaccaagaaaa 136 |||||||||||||||||||| Sbjct: 58425 gaaaaagcaaaccaagaaaa 58406
>emb|AL583861.9| Human DNA sequence from clone RP11-314E19 on chromosome 6, complete sequence Length = 72356 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 aaggtgaaagccaggctttg 157 |||||||||||||||||||| Sbjct: 53347 aaggtgaaagccaggctttg 53328
>emb|AL031667.21|HS620E11 Human DNA sequence from clone RP4-620E11 on chromosome 20q11.2-12 Contains the 3' end of the LPIN3 gene for lipin 3, the C20orf130 gene, a novel pseudogene, the 3' end of the CHD6 gene for chromodomain helicase DNA binding protein 6, a lymphocyte antigen 6 complex locus H (LY6H) pseudogene and a CpG island, complete sequence Length = 142520 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 376 tctcttcttcttggccctct 395 |||||||||||||||||||| Sbjct: 141360 tctcttcttcttggccctct 141379
>emb|BX000351.17| Mouse DNA sequence from clone RP23-313I4 on chromosome 11, complete sequence Length = 215123 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 439 atccttgccaaccttgagaa 458 |||||||||||||||||||| Sbjct: 22098 atccttgccaaccttgagaa 22079
>emb|AL669816.3| Mouse DNA sequence from clone RP23-266C4 on chromosome 11 Contains the 3' end of a novel gene, complete sequence Length = 203827 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 108 acagataatgaaaaagcaaa 127 |||||||||||||||||||| Sbjct: 121188 acagataatgaaaaagcaaa 121169
>dbj|AB225632.1| Aspergillus oryzae cDNA, contig sequence: AoEST2487 Length = 1178 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 84 ggcaatgaatgccacatgaa 103 |||||||||||||||||||| Sbjct: 812 ggcaatgaatgccacatgaa 831
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 Length = 4429080 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 84 ggcaatgaatgccacatgaa 103 |||||||||||||||||||| Sbjct: 3391834 ggcaatgaatgccacatgaa 3391853
>gb|AF276870.1| Rattus norvegicus amino acid transporter system N2 mRNA, complete cds Length = 1891 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 tcttcttcttggccctcttg 397 |||||||||||||||||||| Sbjct: 357 tcttcttcttggccctcttg 376
>dbj|AK165311.1| Mus musculus 6 days neonate spleen cDNA, RIKEN full-length enriched library, clone:F430012A13 product:coagulation factor XIII, alpha subunit, full insert sequence Length = 3206 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 374 tctctcttcttcttggccctcttg 397 |||||||||||||||||| ||||| Sbjct: 1570 tctctcttcttcttggccttcttg 1547
>dbj|AK036403.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched library, clone:9830005M20 product:FACTOR XIIIA homolog [Rattus norvegicus], full insert sequence Length = 3206 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 374 tctctcttcttcttggccctcttg 397 |||||||||||||||||| ||||| Sbjct: 1570 tctctcttcttcttggccttcttg 1547
>dbj|AK049092.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230098E01 product:FACTOR XIIIA homolog [Rattus norvegicus], full insert sequence Length = 3521 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 374 tctctcttcttcttggccctcttg 397 |||||||||||||||||| ||||| Sbjct: 1570 tctctcttcttcttggccttcttg 1547
>dbj|AK030914.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5830453E21 product:coagulation factor XIII, alpha subunit, full insert sequence Length = 3855 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 374 tctctcttcttcttggccctcttg 397 |||||||||||||||||| ||||| Sbjct: 1544 tctctcttcttcttggccttcttg 1521
>dbj|AK004764.1| Mus musculus adult male lung cDNA, RIKEN full-length enriched library, clone:1200014I03 product:similar to BA525O21.1 (COAGULATION FACTOR XIII, A1 POLYPEPTIDE) (FRAGMENT) [Homo sapiens], full insert sequence Length = 2791 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 374 tctctcttcttcttggccctcttg 397 |||||||||||||||||| ||||| Sbjct: 491 tctctcttcttcttggccttcttg 468
>gb|AC097110.1| Homo sapiens BAC clone RP11-51P8 from 4, complete sequence Length = 153480 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 116 tgaaaaagcaaaccaagaaaacaa 139 ||||||| |||||||||||||||| Sbjct: 91182 tgaaaaaacaaaccaagaaaacaa 91205
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 565 cggcggcagctcgcgcttgg 584 |||||||||||||||||||| Sbjct: 5402053 cggcggcagctcgcgcttgg 5402072
>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib Length = 2013089 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 410 tttcgcttcgccaccttcag 429 |||||||||||||||||||| Sbjct: 654672 tttcgcttcgccaccttcag 654653
>dbj|AP003559.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-794G24, complete sequence Length = 181439 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 369 tctcctctctcttcttcttggccctctt 396 ||||||||||| |||||||||| ||||| Sbjct: 57872 tctcctctctcctcttcttggctctctt 57899
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 565 cggcggcagctcgcgcttgg 584 |||||||||||||||||||| Sbjct: 5726570 cggcggcagctcgcgcttgg 5726589
>dbj|AP001994.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-215D10, complete sequence Length = 167376 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcctacaggatggaaattaa 52 |||||||||||||||||||| Sbjct: 100410 gcctacaggatggaaattaa 100391
>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome Length = 3184243 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 554 tcggacgggcgcggcggcag 573 |||||||||||||||||||| Sbjct: 1474319 tcggacgggcgcggcggcag 1474338
>dbj|AP003108.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-286N22, complete sequence Length = 209572 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 369 tctcctctctcttcttcttggccctctt 396 ||||||||||| |||||||||| ||||| Sbjct: 136206 tctcctctctcctcttcttggctctctt 136233 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,383,969 Number of Sequences: 3902068 Number of extensions: 6383969 Number of successful extensions: 123171 Number of sequences better than 10.0: 92 Number of HSP's better than 10.0 without gapping: 93 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 122680 Number of HSP's gapped (non-prelim): 468 length of query: 589 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 566 effective length of database: 17,143,297,704 effective search space: 9703106500464 effective search space used: 9703106500464 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)