ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal6n20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ234562.1|HVU234562 Hordeum vulgare genomic DNA fragment; c... 1035 0.0
2emb|AJ234450.1|HVU234450 Hordeum vulgare partial mRNA; clone cMW... 1011 0.0
3ref|XM_450593.1| Oryza sativa (japonica cultivar-group), mRNA 145 2e-31
4dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 145 2e-31
5dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic D... 145 2e-31
6dbj|AK071395.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 2e-31
7gb|BT018115.1| Zea mays clone EL01N0553H03.c mRNA sequence 111 2e-21
8gb|AY107736.1| Zea mays PCO090313 mRNA sequence 103 6e-19
9ref|XM_546550.2| PREDICTED: Canis familiaris similar to Matrilys... 44 0.46
10gb|AC012470.16| Homo sapiens chromosome 10 clone RP11-506P9, com... 44 0.46
11emb|AL732567.8| Zebrafish DNA sequence from clone CH211-263A23 i... 44 0.46
12ref|XM_507654.1| PREDICTED: Pan troglodytes similar to enoyl Coe... 42 1.8
13gb|BC001091.1| Homo sapiens enoyl Coenzyme A hydratase domain co... 42 1.8
14ref|NM_024693.2| Homo sapiens enoyl Coenzyme A hydratase domain ... 42 1.8
15emb|AL138898.19| Human DNA sequence from clone RP11-401F24 on ch... 42 1.8
16emb|BX294152.1| Pirellula sp. strain 1 complete genome; segment ... 42 1.8
17gb|AC135995.7| Homo sapiens chromosome 15, clone RP13-608F4, com... 42 1.8
18gb|BC009617.1| Homo sapiens enoyl Coenzyme A hydratase domain co... 42 1.8
19gb|AC126605.4| Homo sapiens chromosome 15, clone RP11-606M5, com... 42 1.8
20emb|CR624346.1| full-length cDNA clone CS0DC010YB03 of Neuroblas... 42 1.8
21emb|CR621986.1| full-length cDNA clone CS0DI005YJ06 of Placenta ... 42 1.8
22emb|CR614444.1| full-length cDNA clone CS0DK012YK14 of HeLa cell... 42 1.8
23emb|CR612555.1| full-length cDNA clone CS0DA002YJ22 of Neuroblas... 42 1.8
24gb|AC110291.6| Homo sapiens chromosome 15, clone RP11-379H8, com... 42 1.8
25emb|CR601232.1| full-length cDNA clone CS0DD007YE07 of Neuroblas... 42 1.8
26emb|CR599557.1| full-length cDNA clone CS0DI068YK20 of Placenta ... 42 1.8
27gb|AF275677.1|AF275677 Homo sapiens PP1494 protein mRNA, complet... 42 1.8
28gb|AF289604.1|AF289604 Homo sapiens clone pp8332 unknown mRNA 42 1.8
29gb|AC010724.6|AC010724 Homo sapiens BAC clone RP11-152F13 from 1... 42 1.8
30dbj|AK222511.1| Homo sapiens mRNA for enoyl Coenzyme A hydratase... 42 1.8
31dbj|AK024562.1| Homo sapiens cDNA: FLJ20909 fis, clone ADSE00425 42 1.8
32emb|CR450834.5| Zebrafish DNA sequence from clone CH211-237B9 in... 42 1.8
33gb|M18000.1|HUMRPS17A Human ribosomal protein S17 gene, complete... 42 1.8
34gb|AC122789.8| Mus musculus chromosome 5, clone RP24-258A20, com... 40 7.1
35gb|AC168091.3| Mus musculus BAC clone RP23-163F18 from chromosom... 40 7.1
36gb|AC137942.6| Mus musculus chromosome 10, clone RP24-502K6, com... 40 7.1
37gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl... 40 7.1
38emb|AL356127.8| Human DNA sequence from clone RP11-368P1 on chro... 40 7.1
39emb|AL159151.56| Human DNA sequence from clone RP11-156O2 on chr... 40 7.1
40emb|AL034451.26|HS191E19 Human DNA sequence from clone RP1-191E1... 40 7.1
41emb|X58831.1|CSGDHANC C.sorokiniana gdhANC gene for NADP-specifi... 40 7.1
42emb|BX571721.8| Zebrafish DNA sequence from clone DKEY-250L23 in... 40 7.1
43gb|AC164315.2| Mus musculus BAC clone RP23-18J12 from chromosome... 40 7.1
44gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete s... 40 7.1
45gb|AC022039.7| Homo sapiens chromosome 8, clone RP11-3G21, compl... 40 7.1
46gb|AC022150.6| Homo sapiens chromosome 19 clone CTD-3099C6, comp... 40 7.1
47gb|AC009898.6| Homo sapiens chromosome 8, clone RP11-138H14, com... 40 7.1
48gb|AF306554.1|AF306554 Orseolia oryzae mitotype 2 12S ribosomal ... 40 7.1
49gb|AC092405.2| Papio anubis clone RP41-170F23, complete sequence 40 7.1
50dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome 40 7.1
51emb|BX321870.12| Zebrafish DNA sequence from clone RP71-42A14 in... 40 7.1
52emb|BX005018.8| Zebrafish DNA sequence from clone DKEY-209K18, c... 40 7.1
53dbj|AP001303.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 7.1
54emb|BX255891.5| Zebrafish DNA sequence from clone DKEY-263P20 in... 40 7.1
55gb|AC006571.12|AC006571 Homo sapiens, clone hRPK.23_A_1, complet... 40 7.1
56emb|BX294008.8| Mouse DNA sequence from clone RP23-28K9 on chrom... 40 7.1
57gb|AC153964.3| Mus musculus 10 BAC RP24-399H20 (Roswell Park Can... 40 7.1

>emb|AJ234562.1|HVU234562 Hordeum vulgare genomic DNA fragment; clone MWG0803
          Length = 598

 Score = 1035 bits (522), Expect = 0.0
 Identities = 524/526 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   acacttgacaacagaccgacagtaatatgcacagataaataaagttttacaattttaccc 60
           |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||
Sbjct: 544 acacttgacaacagaccgacagkaatatgcacagataaawaaagttttacaattttaccc 485

                                                                       
Query: 61  agaagaaaacacaggcccacaaaggttacacagtatcttgacaaagcaacagactaagca 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 484 agaagaaaacacaggcccacaaaggttacacagtatcttgacaaagcaacagactaagca 425

                                                                       
Query: 121 ggagaggagtgacaaacataagacattgcttatagcatataacaggctatggagggtggg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 424 ggagaggagtgacaaacataagacattgcttatagcatataacaggctatggagggtggg 365

                                                                       
Query: 181 ggttaaattgaatagtcctacttgatcggtgacgacagccatctcgcggccagttctttc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 364 ggttaaattgaatagtcctacttgatcggtgacgacagccatctcgcggccagttctttc 305

                                                                       
Query: 241 tttcactggatatgctgttcttccagtttgtcccttcactggatgtgcatgctgttcttc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 304 tttcactggatatgctgttcttccagtttgtcccttcactggatgtgcatgctgttcttc 245

                                                                       
Query: 301 catctctgtgtagcagcactgctcaggaggagtcgtgagctgggctgtccgaatgcatgt 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 244 catctctgtgtagcagcactgctcaggaggagtcgtgagctgggctgtccgaatgcatgt 185

                                                                       
Query: 361 ccatggatgagtcgtttgaagccgtgggattcggctcgcgggccaagccgttcgcaaagt 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 184 ccatggatgagtcgtttgaagccgtgggattcggctcgcgggccaagccgttcgcaaagt 125

                                                                       
Query: 421 agcctgcatccccaccctgatccagatggtatggttgcaggccccggcgcacggggctgg 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124 agcctgcatccccaccctgatccagatggtatggttgcaggccccggcgcacggggctgg 65

                                                         
Query: 481 atagtgcgttggaaaagaccgccgagttcttgggctgcgtcaaccc 526
           ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 64  atagtgcgttggaaaagaccgccgagttcttgggctgcgtcaaccc 19



to top

>emb|AJ234450.1|HVU234450 Hordeum vulgare partial mRNA; clone cMWG0770
          Length = 594

 Score = 1011 bits (510), Expect = 0.0
 Identities = 525/528 (99%), Gaps = 2/528 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   acacttgacaacagaccgacagtaatatgcacagataaataaagttttacaattttaccc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 540 acacttgacaacagaccgacagtaatatgcacagataaataaagttttacaattttaccc 481

                                                                       
Query: 61  agaagaaaacacaggcccacaaaggttacacagtatcttgacaaagcaacagactaagca 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 480 agaagaaaacacaggcccacaaaggttacacagtatcttgacaaagcaacagactaagca 421

                                                                       
Query: 121 ggagaggagtgacaaacataagacattgcttatagcatataacaggctatggagggtggg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 420 ggagaggagtgacaaacataagacattgcttatagcatataacaggctatggagggtggg 361

                                                                       
Query: 181 ggttaaattgaatagtcctacttgatcggtgacga-cagccatctcgcggccagttcttt 239
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 360 ggttaaattgaatagtcctacttgatcggtgacgaacagccatctcgcggccagttcttt 301

                                                                       
Query: 240 cttt-cactggatatgctgttcttccagtttgtcccttcactggatgtgcatgctgttct 298
           |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 300 cttttcactggatatgctgtkcttccagtttgtcccttcactggatgtgcatgctgttct 241

                                                                       
Query: 299 tccatctctgtgtagcagcactgctcaggaggagtcgtgagctgggctgtccgaatgcat 358
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 240 tccatctctgtgtagcagcactgctcaggaggagtcgtgagctgggctgtccgaatgcat 181

                                                                       
Query: 359 gtccatggatgagtcgtttgaagccgtgggattcggctcgcgggccaagccgttcgcaaa 418
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 180 gtccatggatgagtcgtttgaagccgtgggattcggctcgcgggccaagccgttcgcaaa 121

                                                                       
Query: 419 gtagcctgcatccccaccctgatccagatggtatggttgcaggccccggcgcacggggct 478
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 120 gtagcctgcatccccaccctgatccagatggtatggttgcaggccccggcgcacggggct 61

                                                           
Query: 479 ggatagtgcgttggaaaagaccgccgagttcttgggctgcgtcaaccc 526
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 60  ggatagtgcgttggaaaagaccgccgagttcttgggctgcgtcaaccc 13



to top

>ref|XM_450593.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1102

 Score =  145 bits (73), Expect = 2e-31
 Identities = 160/189 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 gagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttgaagccgtggga 389
           ||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||| |  
Sbjct: 771 gagtcatgagctgggctgtctgaatgcatgtccatggatgaatcgttcgaagccgtcgag 712

                                                                       
Query: 390 ttcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccctgatccagatgg 449
           ||  | ||||||   | |||||| || ||||| || ||||| |||||||| ||||| |||
Sbjct: 711 ttttgatcgcggttaacgccgtttgcgaagtaccccgcatcgccaccctgctccaggtgg 652

                                                                       
Query: 450 tatggttgcaggccccggcgcacggggctggatagtgcgttggaaaagaccgccgagttc 509
            |||||||||||| |||||| |||||||| |||||||| || ||||||||||| ||||||
Sbjct: 651 aatggttgcaggctccggcgaacggggctagatagtgcatttgaaaagaccgctgagttc 592

                    
Query: 510 ttgggctgc 518
           |||| ||||
Sbjct: 591 ttggactgc 583



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 178 gggggttaaattgaatagtcctac 201
           ||||||||||||||||||||||||
Sbjct: 881 gggggttaaattgaatagtcctac 858



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  145 bits (73), Expect = 2e-31
 Identities = 160/189 (84%)
 Strand = Plus / Minus

                                                                            
Query: 330      gagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttgaagccgtggga 389
                ||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||| |  
Sbjct: 11686135 gagtcatgagctgggctgtctgaatgcatgtccatggatgaatcgttcgaagccgtcgag 11686076

                                                                            
Query: 390      ttcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccctgatccagatgg 449
                ||  | ||||||   | |||||| || ||||| || ||||| |||||||| ||||| |||
Sbjct: 11686075 ttttgatcgcggttaacgccgtttgcgaagtaccccgcatcgccaccctgctccaggtgg 11686016

                                                                            
Query: 450      tatggttgcaggccccggcgcacggggctggatagtgcgttggaaaagaccgccgagttc 509
                 |||||||||||| |||||| |||||||| |||||||| || ||||||||||| ||||||
Sbjct: 11686015 aatggttgcaggctccggcgaacggggctagatagtgcatttgaaaagaccgctgagttc 11685956

                         
Query: 510      ttgggctgc 518
                |||| ||||
Sbjct: 11685955 ttggactgc 11685947



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 178      gggggttaaattgaatagtcctac 201
                ||||||||||||||||||||||||
Sbjct: 11686245 gggggttaaattgaatagtcctac 11686222



to top

>dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0711F01
          Length = 193091

 Score =  145 bits (73), Expect = 2e-31
 Identities = 160/189 (84%)
 Strand = Plus / Minus

                                                                          
Query: 330    gagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttgaagccgtggga 389
              ||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||| |  
Sbjct: 120769 gagtcatgagctgggctgtctgaatgcatgtccatggatgaatcgttcgaagccgtcgag 120710

                                                                          
Query: 390    ttcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccctgatccagatgg 449
              ||  | ||||||   | |||||| || ||||| || ||||| |||||||| ||||| |||
Sbjct: 120709 ttttgatcgcggttaacgccgtttgcgaagtaccccgcatcgccaccctgctccaggtgg 120650

                                                                          
Query: 450    tatggttgcaggccccggcgcacggggctggatagtgcgttggaaaagaccgccgagttc 509
               |||||||||||| |||||| |||||||| |||||||| || ||||||||||| ||||||
Sbjct: 120649 aatggttgcaggctccggcgaacggggctagatagtgcatttgaaaagaccgctgagttc 120590

                       
Query: 510    ttgggctgc 518
              |||| ||||
Sbjct: 120589 ttggactgc 120581



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 178    gggggttaaattgaatagtcctac 201
              ||||||||||||||||||||||||
Sbjct: 120879 gggggttaaattgaatagtcctac 120856



to top

>dbj|AK071395.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023095O09, full
           insert sequence
          Length = 1102

 Score =  145 bits (73), Expect = 2e-31
 Identities = 160/189 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 gagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttgaagccgtggga 389
           ||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||| |  
Sbjct: 771 gagtcatgagctgggctgtctgaatgcatgtccatggatgaatcgttcgaagccgtcgag 712

                                                                       
Query: 390 ttcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccctgatccagatgg 449
           ||  | ||||||   | |||||| || ||||| || ||||| |||||||| ||||| |||
Sbjct: 711 ttttgatcgcggttaacgccgtttgcgaagtaccccgcatcgccaccctgctccaggtgg 652

                                                                       
Query: 450 tatggttgcaggccccggcgcacggggctggatagtgcgttggaaaagaccgccgagttc 509
            |||||||||||| |||||| |||||||| |||||||| || ||||||||||| ||||||
Sbjct: 651 aatggttgcaggctccggcgaacggggctagatagtgcatttgaaaagaccgctgagttc 592

                    
Query: 510 ttgggctgc 518
           |||| ||||
Sbjct: 591 ttggactgc 583



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 178 gggggttaaattgaatagtcctac 201
           ||||||||||||||||||||||||
Sbjct: 881 gggggttaaattgaatagtcctac 858



to top

>gb|BT018115.1| Zea mays clone EL01N0553H03.c mRNA sequence
          Length = 1357

 Score =  111 bits (56), Expect = 2e-21
 Identities = 170/208 (81%)
 Strand = Plus / Minus

                                                                        
Query: 319  ctgctcaggaggagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttg 378
            |||||||| ||||||| ||||||||||||||||| |||||||||||||| || || || |
Sbjct: 1120 ctgctcagtaggagtcatgagctgggctgtccgagtgcatgtccatggacgaatcattcg 1061

                                                                        
Query: 379  aagccgtgggattcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccct 438
            |||||||||| |||   ||||||      |||||||| ||||| |||||||||||  |||
Sbjct: 1060 aagccgtggggttcacatcgcggcttgcaccgttcgcgaagtaccctgcatccccgtcct 1001

                                                                        
Query: 439  gatccagatggtatggttgcaggccccggcgcacggggctggatagtgcgttggaaaaga 498
            | || || ||||| |||||||||| ||| || | ||||||||||| |||| | |||||||
Sbjct: 1000 gctctaggtggtaaggttgcaggctccgccggatggggctggataatgcgcttgaaaaga 941

                                        
Query: 499  ccgccgagttcttgggctgcgtcaaccc 526
            ||   || ||||||| ||| ||||||||
Sbjct: 940  ccatggaattcttggactgtgtcaaccc 913



to top

>gb|AY107736.1| Zea mays PCO090313 mRNA sequence
          Length = 1090

 Score =  103 bits (52), Expect = 6e-19
 Identities = 169/208 (81%)
 Strand = Plus / Minus

                                                                       
Query: 319 ctgctcaggaggagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttg 378
           |||||||| ||||||| ||||||||||||||||| |||||||||||||| || || || |
Sbjct: 828 ctgctcagtaggagtcatgagctgggctgtccgagtgcatgtccatggacgaatcattcg 769

                                                                       
Query: 379 aagccgtgggattcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccct 438
           |||||||||| |||   ||||||      |||||||| ||||| |||||||||||  |||
Sbjct: 768 aagccgtggggttcacatcgcggcttgcaccgttcgcgaagtaccctgcatccccgtcct 709

                                                                       
Query: 439 gatccagatggtatggttgcaggccccggcgcacggggctggatagtgcgttggaaaaga 498
           | || || ||||| ||| |||||| ||| || | ||||||||||| |||| | |||||||
Sbjct: 708 gctctaggtggtaaggtggcaggctccgccggatggggctggataatgcgcttgaaaaga 649

                                       
Query: 499 ccgccgagttcttgggctgcgtcaaccc 526
           ||   || ||||||| ||| ||||||||
Sbjct: 648 ccatggaattcttggactgtgtcaaccc 621



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 20   cagtaatatgcacagataaat 40
            |||||||||||||||||||||
Sbjct: 1064 cagtaatatgcacagataaat 1044



to top

>ref|XM_546550.2| PREDICTED: Canis familiaris similar to Matrilysin precursor (Pump-1
            protease) (Uterine metalloproteinase) (Matrix
            metalloproteinase-7) (MMP-7) (Matrin) (LOC489432), mRNA
          Length = 1045

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 27   atgcacagataaataaagtttt 48
            ||||||||||||||||||||||
Sbjct: 1015 atgcacagataaataaagtttt 1036



to top

>gb|AC012470.16| Homo sapiens chromosome 10 clone RP11-506P9, complete sequence
          Length = 122543

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 67    aaacacaggcccacaaaggtta 88
             ||||||||||||||||||||||
Sbjct: 31975 aaacacaggcccacaaaggtta 31996



to top

>emb|AL732567.8| Zebrafish DNA sequence from clone CH211-263A23 in linkage group 6,
             complete sequence
          Length = 152840

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 47    ttacaattttacccagaagaaa 68
             ||||||||||||||||||||||
Sbjct: 60018 ttacaattttacccagaagaaa 59997



to top

>ref|XM_507654.1| PREDICTED: Pan troglodytes similar to enoyl Coenzyme A hydratase
           domain containing 3 (LOC450300), mRNA
          Length = 1401

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 858 cccagaagaaaacacaggccc 838



to top

>gb|BC001091.1| Homo sapiens enoyl Coenzyme A hydratase domain containing 3, mRNA
           (cDNA clone IMAGE:3505013), partial cds
          Length = 1407

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 271 cccagaagaaaacacaggccc 251



to top

>ref|NM_024693.2| Homo sapiens enoyl Coenzyme A hydratase domain containing 3
           (ECHDC3), mRNA
          Length = 1648

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 512 cccagaagaaaacacaggccc 492



to top

>emb|AL138898.19| Human DNA sequence from clone RP11-401F24 on chromosome 10 Contains
             gene FLJ20909, the gene for a novel protein (MGC35403), a
             novel gene (LOC219731), the 3' end of the UPF2 gene for
             UPF2 regulator of nonsense transcripts homolog (yeast)
             (FLJ38872) and four CpG islands, complete sequence
          Length = 206587

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    cccagaagaaaacacaggccc 78
             |||||||||||||||||||||
Sbjct: 26307 cccagaagaaaacacaggccc 26287



to top

>emb|BX294152.1| Pirellula sp. strain 1 complete genome; segment 20/24
          Length = 304250

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 199    tacttgatcggtgacgacagc 219
              |||||||||||||||||||||
Sbjct: 301986 tacttgatcggtgacgacagc 301966



to top

>gb|AC135995.7| Homo sapiens chromosome 15, clone RP13-608F4, complete sequence
          Length = 157246

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 58   cccagaagaaaacacaggccc 78
            |||||||||||||||||||||
Sbjct: 8301 cccagaagaaaacacaggccc 8281



to top

>gb|BC009617.1| Homo sapiens enoyl Coenzyme A hydratase domain containing 3, mRNA
           (cDNA clone MGC:16831 IMAGE:3893103), complete cds
          Length = 1609

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 460 cccagaagaaaacacaggccc 440



to top

>gb|AC126605.4| Homo sapiens chromosome 15, clone RP11-606M5, complete sequence
          Length = 169125

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    cccagaagaaaacacaggccc 78
             |||||||||||||||||||||
Sbjct: 79871 cccagaagaaaacacaggccc 79851



to top

>emb|CR624346.1| full-length cDNA clone CS0DC010YB03 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1597

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 509 cccagaagaaaacacaggccc 489



to top

>emb|CR621986.1| full-length cDNA clone CS0DI005YJ06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1569

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 479 cccagaagaaaacacaggccc 459



to top

>emb|CR614444.1| full-length cDNA clone CS0DK012YK14 of HeLa cells Cot
          25-normalized of Homo sapiens (human)
          Length = 1065

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 58 cccagaagaaaacacaggccc 78
          |||||||||||||||||||||
Sbjct: 25 cccagaagaaaacacaggccc 5



to top

>emb|CR612555.1| full-length cDNA clone CS0DA002YJ22 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1877

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 58   cccagaagaaaacacaggccc 78
            |||||||||||||||||||||
Sbjct: 1703 cccagaagaaaacacaggccc 1683



to top

>gb|AC110291.6| Homo sapiens chromosome 15, clone RP11-379H8, complete sequence
          Length = 186812

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    cccagaagaaaacacaggccc 78
             |||||||||||||||||||||
Sbjct: 81974 cccagaagaaaacacaggccc 81994



to top

>emb|CR601232.1| full-length cDNA clone CS0DD007YE07 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1540

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 458 cccagaagaaaacacaggccc 438



to top

>emb|CR599557.1| full-length cDNA clone CS0DI068YK20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1545

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 462 cccagaagaaaacacaggccc 442



to top

>gb|AF275677.1|AF275677 Homo sapiens PP1494 protein mRNA, complete cds
          Length = 1648

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 512 cccagaagaaaacacaggccc 492



to top

>gb|AF289604.1|AF289604 Homo sapiens clone pp8332 unknown mRNA
          Length = 1771

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 494 cccagaagaaaacacaggccc 474



to top

>gb|AC010724.6|AC010724 Homo sapiens BAC clone RP11-152F13 from 15, complete sequence
          Length = 157200

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    cccagaagaaaacacaggccc 78
             |||||||||||||||||||||
Sbjct: 21464 cccagaagaaaacacaggccc 21444



to top

>dbj|AK222511.1| Homo sapiens mRNA for enoyl Coenzyme A hydratase domain containing
           3 variant, clone: adSE01048
          Length = 1615

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 477 cccagaagaaaacacaggccc 457



to top

>dbj|AK024562.1| Homo sapiens cDNA: FLJ20909 fis, clone ADSE00425
          Length = 1588

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cccagaagaaaacacaggccc 78
           |||||||||||||||||||||
Sbjct: 451 cccagaagaaaacacaggccc 431



to top

>emb|CR450834.5| Zebrafish DNA sequence from clone CH211-237B9 in linkage group 11,
             complete sequence
          Length = 137302

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 41    aaagttttacaattttaccca 61
             |||||||||||||||||||||
Sbjct: 65499 aaagttttacaattttaccca 65519



to top

>gb|M18000.1|HUMRPS17A Human ribosomal protein S17 gene, complete cds
          Length = 4029

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 58   cccagaagaaaacacaggccc 78
            |||||||||||||||||||||
Sbjct: 3662 cccagaagaaaacacaggccc 3642



to top

>gb|AC122789.8| Mus musculus chromosome 5, clone RP24-258A20, complete sequence
          Length = 182866

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 298    ttccatctctgtgtagcagc 317
              ||||||||||||||||||||
Sbjct: 128746 ttccatctctgtgtagcagc 128727



to top

>gb|AC168091.3| Mus musculus BAC clone RP23-163F18 from chromosome 14, complete sequence
          Length = 227936

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 99     tgacaaagcaacagactaagcagg 122
              ||||||||||||||| ||||||||
Sbjct: 192176 tgacaaagcaacagaataagcagg 192199



to top

>gb|AC137942.6| Mus musculus chromosome 10, clone RP24-502K6, complete sequence
          Length = 173848

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 234   ttctttctttcactggatat 253
             ||||||||||||||||||||
Sbjct: 43543 ttctttctttcactggatat 43562



to top

>gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, complete sequence
          Length = 1471779

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 451    atggttgcaggccccggcgcacgg 474
              |||| |||||||||||||||||||
Sbjct: 715507 atgggtgcaggccccggcgcacgg 715484



to top

>emb|AL356127.8| Human DNA sequence from clone RP11-368P1 on chromosome 6, complete
             sequence
          Length = 139086

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 40    taaagttttacaattttacc 59
             ||||||||||||||||||||
Sbjct: 44423 taaagttttacaattttacc 44442



to top

>emb|AL159151.56| Human DNA sequence from clone RP11-156O2 on chromosome 13, complete
             sequence
          Length = 59116

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 292   ctgttcttccatctctgtgt 311
             ||||||||||||||||||||
Sbjct: 45267 ctgttcttccatctctgtgt 45286



to top

>emb|AL034451.26|HS191E19 Human DNA sequence from clone RP1-191E19 on chromosome 6q23.2-24.2,
            complete sequence
          Length = 110885

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 35   ataaataaagttttacaattttac 58
            |||||||||| |||||||||||||
Sbjct: 2492 ataaataaagctttacaattttac 2515



to top

>emb|X58831.1|CSGDHANC C.sorokiniana gdhANC gene for NADP-specific glutamate dehydrogenase
            (ANC=Ammonium-inducible, Nuclear encoded, Chloroplastic
            isoenzyme)
          Length = 9872

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 355  gcatgtccatggatgagtcg 374
            ||||||||||||||||||||
Sbjct: 9356 gcatgtccatggatgagtcg 9375



to top

>emb|BX571721.8| Zebrafish DNA sequence from clone DKEY-250L23 in linkage group 8,
             complete sequence
          Length = 168402

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    aaataaagttttacaatttt 56
             ||||||||||||||||||||
Sbjct: 39721 aaataaagttttacaatttt 39702



to top

>gb|AC164315.2| Mus musculus BAC clone RP23-18J12 from chromosome 14, complete sequence
          Length = 204011

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 99     tgacaaagcaacagactaagcagg 122
              ||||||||||||||| ||||||||
Sbjct: 136596 tgacaaagcaacagaataagcagg 136573



to top

>gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete sequence
          Length = 104879

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   tgggggttaaattgaatagt 196
             ||||||||||||||||||||
Sbjct: 88195 tgggggttaaattgaatagt 88214



to top

>gb|AC022039.7| Homo sapiens chromosome 8, clone RP11-3G21, complete sequence
          Length = 176815

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    acataagacattgcttatag 155
              ||||||||||||||||||||
Sbjct: 155089 acataagacattgcttatag 155070



to top

>gb|AC022150.6| Homo sapiens chromosome 19 clone CTD-3099C6, complete sequence
          Length = 228156

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 272   cccttcactggatgtgcatg 291
             ||||||||||||||||||||
Sbjct: 29161 cccttcactggatgtgcatg 29142



to top

>gb|AC009898.6| Homo sapiens chromosome 8, clone RP11-138H14, complete sequence
          Length = 168539

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 136   acataagacattgcttatag 155
             ||||||||||||||||||||
Sbjct: 22008 acataagacattgcttatag 21989



to top

>gb|AF306554.1|AF306554 Orseolia oryzae mitotype 2 12S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 414

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 36  taaataaagttttacaattt 55
           ||||||||||||||||||||
Sbjct: 302 taaataaagttttacaattt 283



to top

>gb|AC092405.2| Papio anubis clone RP41-170F23, complete sequence
          Length = 182902

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 113   actaagcaggagaggagtga 132
             ||||||||||||||||||||
Sbjct: 14739 actaagcaggagaggagtga 14720



to top

>dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome
          Length = 1738505

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 25      atatgcacagataaataaagtttt 48
               ||||||||||||| ||||||||||
Sbjct: 1104352 atatgcacagatatataaagtttt 1104329



to top

>emb|BX321870.12| Zebrafish DNA sequence from clone RP71-42A14 in linkage group 22,
            complete sequence
          Length = 165445

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   gataaataaagttttacaat 53
            ||||||||||||||||||||
Sbjct: 3625 gataaataaagttttacaat 3644



to top

>emb|BX005018.8| Zebrafish DNA sequence from clone DKEY-209K18, complete sequence
          Length = 183614

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    aaataaagttttacaatttt 56
             ||||||||||||||||||||
Sbjct: 19006 aaataaagttttacaatttt 18987



to top

>dbj|AP001303.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K24M9
          Length = 45292

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 257   gttcttccagtttgtccctt 276
             ||||||||||||||||||||
Sbjct: 17465 gttcttccagtttgtccctt 17446



to top

>emb|BX255891.5| Zebrafish DNA sequence from clone DKEY-263P20 in linkage group 20,
             complete sequence
          Length = 104855

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    aataaagttttacaatttta 57
             ||||||||||||||||||||
Sbjct: 25058 aataaagttttacaatttta 25039



to top

>gb|AC006571.12|AC006571 Homo sapiens, clone hRPK.23_A_1, complete sequence
          Length = 134896

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 35    ataaataaagttttacaattttac 58
             |||||||||| |||||||||||||
Sbjct: 83539 ataaataaagctttacaattttac 83562



to top

>emb|BX294008.8| Mouse DNA sequence from clone RP23-28K9 on chromosome X, complete
             sequence
          Length = 136485

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 229   gccagttctttctttcactg 248
             ||||||||||||||||||||
Sbjct: 27867 gccagttctttctttcactg 27848



to top

>gb|AC153964.3| Mus musculus 10 BAC RP24-399H20 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 173453

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 234    ttctttctttcactggatat 253
              ||||||||||||||||||||
Sbjct: 123254 ttctttctttcactggatat 123273


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,005,895
Number of Sequences: 3902068
Number of extensions: 6005895
Number of successful extensions: 99071
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 98934
Number of HSP's gapped (non-prelim): 131
length of query: 526
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 503
effective length of database: 17,143,297,704
effective search space: 8623078745112
effective search space used: 8623078745112
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top