ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal17l08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 147 5e-32
2dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 147 5e-32
3gb|AC091532.13| Oryza sativa chromosome 3 BAC OSJNBa0078A17 geno... 147 5e-32
4dbj|AK060709.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 5e-32
5ref|XM_469566.1| Oryza sativa (japonica cultivar-group), mRNA 141 3e-30
6dbj|AB206392.1| Zea mays ZmHK1b1' mRNA for histidine kinase, com... 137 5e-29
7dbj|AB206391.1| Zea mays ZmHK1b1 mRNA for histidine kinase, comp... 137 5e-29
8dbj|AB206393.1| Zea mays ZmHK1b2 mRNA for histidine kinase, comp... 98 4e-17
9ref|XM_467688.1| Oryza sativa (japonica cultivar-group), mRNA 66 2e-07
10dbj|AB206390.1| Zea mays ZmHK1a2 mRNA for histidine kinase, comp... 66 2e-07
11dbj|AB042270.1| Zea mays ZmHK1 mRNA for histidine kinase 1, comp... 62 2e-06
12gb|AY108856.1| Zea mays PCO066747 mRNA sequence 62 2e-06
13emb|AJ630372.1| Cucurbita maxima mRNA for putative histidine kin... 60 1e-05
14emb|AJ628045.1| Cucurbita maxima mRNA for putative histidine kinase 60 1e-05
15gb|DQ424897.1| Striga asiatica histidine kinase SHK278 mRNA, com... 58 4e-05
16ref|NM_126244.2| Arabidopsis thaliana WOL (CYTOKININ RESPONSE 1)... 50 0.009
17ref|NM_179594.1| Arabidopsis thaliana WOL (CYTOKININ RESPONSE 1)... 50 0.009
18ref|NM_201667.1| Arabidopsis thaliana WOL (CYTOKININ RESPONSE 1)... 50 0.009
19emb|AJ278530.1|ATH278530 Arabidopsis thaliana mRNA for putative ... 50 0.009
20emb|AJ278529.1|ATH278529 Arabidopsis thaliana mRNA for putative ... 50 0.009
21emb|AJ278528.1|ATH278528 Arabidopsis thaliana mRNA for putative ... 50 0.009
22gb|DQ232601.1| Receiver Vector p415-CYC1-CRE1a-TR-SSRE-GFP, comp... 50 0.009
23gb|DQ232600.1| Receiver Vector p415-CYC1-CRE1a-SSRE-GFP, complet... 50 0.009
24dbj|AB046871.1| Arabidopsis thaliana AHK4 mRNA for histidine kin... 50 0.009
25dbj|AB049935.1| Arabidopsis thaliana mRNA for cytokinin receptor... 50 0.009
26dbj|AB049934.1| Arabidopsis thaliana mRNA for cytokinin receptor... 50 0.009
27gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome 46 0.14
28ref|NM_196042.1| Oryza sativa (japonica cultivar-group) putative... 46 0.14
29gb|AE017128.1| Yersinia pestis biovar Medievalis str. 91001 sect... 46 0.14
30gb|AE009952.1| Yersinia pestis KIM, complete genome 46 0.14
31gb|AC141922.19| Medicago truncatula clone mth2-9n11, complete se... 46 0.14
32gb|AC144931.29| Medicago truncatula clone mth2-22b18, complete s... 46 0.14
33gb|U00096.2| Escherichia coli K-12 MG1655, complete genome 46 0.14
34emb|CR932957.2| Medicago truncatula chromosome 5 clone mth2-58c3... 46 0.14
35emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 46 0.14
36emb|AJ414156.1| Yersinia pestis strain CO92 complete genome; seg... 46 0.14
37gb|AY092025.1| Catharanthus roseus cytokinin receptor (CKR1) mRN... 46 0.14
38dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome 46 0.14
39gb|AC170800.5| Medicago truncatula clone mth2-32n7, complete seq... 46 0.14
40gb|AC146785.12| Medicago truncatula clone mth2-4h4, complete seq... 46 0.14
41gb|AC142094.12| Medicago truncatula clone mth2-34h6, complete se... 46 0.14
42gb|AC007069.6| Arabidopsis thaliana chromosome 2 clone T23K3 map... 46 0.14
43dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
44gb|AY216909.1| Vibrio parahaemolyticus opa operon, complete sequ... 46 0.14
45gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome 46 0.14
46dbj|AP005112.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
47emb|AJ298990.1|FSY298990 Fagus sylvatica partial mRNA for histid... 46 0.14
48gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 46 0.14
49dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 46 0.14
50gb|CP000034.1| Shigella dysenteriae Sd197, complete genome 46 0.14
51gb|CP000036.1| Shigella boydii Sb227, complete genome 46 0.14
52gb|CP000038.1| Shigella sonnei Ss046, complete genome 46 0.14
53dbj|D10888.1|ECOBARA E.coli barA gene for sensor-regulator protein 46 0.14
54gb|AE004291.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 44 0.57
55dbj|BA000038.2| Vibrio vulnificus YJ016 DNA, chromosome II, comp... 44 0.57
56gb|DQ381152.1| Bos taurus BTA17 39037 genomic sequence contig co... 44 0.57
57gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chr... 44 0.57
58gb|AE016796.1| Vibrio vulnificus CMCP6 chromosome II, complete s... 44 0.57
59gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F... 44 0.57
60ref|XM_637136.1| Dictyostelium discoideum histidine kinase (DDB0... 42 2.2
61gb|AC146611.2| Mus musculus BAC clone RP23-57A17 from chromosome... 42 2.2
62emb|CR812847.5| Zebrafish DNA sequence from clone DKEY-9I15 in l... 42 2.2
63ref|XM_447508.1| Candida glabrata CBS138 hypothetical protein (C... 42 2.2
64gb|CP000302.1| Shewanella denitrificans OS217, complete genome 42 2.2
65emb|CR380955.1| Candida glabrata strain CBS138 chromosome I comp... 42 2.2
66gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 42 2.2
67gb|AC151956.5| Medicago truncatula clone mth2-52p17, complete se... 42 2.2
68gb|CP000282.1| Saccharophagus degradans 2-40, complete genome 42 2.2
69gb|AC129342.5| Rattus norvegicus BAC CH230-229B21 (Children's H... 42 2.2
70gb|AF024654.1|AF024654 Dictyostelium discoideum hybrid histidine... 42 2.2
71gb|AC129600.4| Mus musculus BAC clone RP23-361D7 from chromosome... 42 2.2
72dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 42 2.2
73ref|XM_345899.2| PREDICTED: Rattus norvegicus melatonin receptor... 42 2.2
74dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete... 42 2.2
75emb|BX005228.7| Zebrafish DNA sequence from clone CH211-163M17 i... 42 2.2
76gb|AY600439.1| Lycopersicon esculentum ethylene receptor neverri... 40 8.9
77ref|XM_639569.1| Dictyostelium discoideum histidine kinase (DDB0... 40 8.9
78ref|XM_639498.1| Dictyostelium discoideum histidine kinase DhkI ... 40 8.9
79gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ... 40 8.9
80ref|XR_001629.1| PREDICTED: Mus musculus cDNA sequence BC067074 ... 40 8.9
81ref|XR_004508.1| PREDICTED: Mus musculus cDNA sequence BC067074 ... 40 8.9
82gb|AC124494.4| Mus musculus BAC clone RP23-464P12 from chromosom... 40 8.9
83gb|AC112157.4| Mus musculus BAC clone RP24-103F14 from chromosom... 40 8.9
84gb|AC122337.4| Mus musculus BAC clone RP23-351M10 from chromosom... 40 8.9
85gb|AC123714.6| Mus musculus chromosome 9, clone RP23-393E20, com... 40 8.9
86gb|AE014075.1| Escherichia coli CFT073, complete genome 40 8.9
87gb|CP000243.1| Escherichia coli UTI89, complete genome 40 8.9
88gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 40 8.9
89emb|BX571865.1| Photorhabdus luminescens subsp. laumondii TTO1 c... 40 8.9
90dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 40 8.9
91gb|AC157474.2| Mus musculus BAC clone RP24-565B5 from chromosome... 40 8.9
92gb|AF362371.1|AF362371 Dictyostelium discoideum histidine kinase... 40 8.9
93gb|AC116330.2| Dictyostelium discoideum chromosome 2 map 3191214... 40 8.9
94gb|AC137517.6| Homo sapiens 3 BAC RP11-671N3 (Roswell Park Cance... 40 8.9
95gb|AC063943.23| Homo sapiens 12 BAC RP11-18C24 (Roswell Park Can... 40 8.9
96gb|AE014299.1| Shewanella oneidensis MR-1, complete genome 40 8.9
97gb|AF118844.1|AF118844 Lycopersicon esculentum ethylene receptor... 40 8.9
98emb|BX537644.1|HSM806477 Homo sapiens mRNA; cDNA DKFZp686M1498 (... 40 8.9

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  147 bits (74), Expect = 5e-32
 Identities = 134/154 (87%)
 Strand = Plus / Minus

                                                                            
Query: 321      ggttgttgtcagctggatgcgctaggtcccaagaacttctgcactgccttgaacaactgc 380
                ||||| |||||||||||  |||  || |||||||||||||| ||||||| ||| | ||||
Sbjct: 28763082 ggttggtgtcagctggaaacgcatgggcccaagaacttctgtactgcctggaagagctgc 28763023

                                                                            
Query: 381      ttctcctcgaagggtttcgagacgtagccgtccattccattctttgtgcattcctcatgg 440
                |||||||| ||||| |||||||||||||| ||||| ||   ||||||||||||||| |||
Sbjct: 28763022 ttctcctcaaagggcttcgagacgtagccatccatcccgcactttgtgcattcctcgtgg 28762963

                                                  
Query: 441      gtggcctggatgacatcggcagtcattgccagga 474
                ||||||||||||||||| || |||||||||||||
Sbjct: 28762962 gtggcctggatgacatcagcggtcattgccagga 28762929



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                    
Query: 577      acccatccatctctggcatttgaatatccattagacagagatcaaacttgtg 628
                ||||||||||||| ||||| ||||| ||||| ||||| ||||||||||||||
Sbjct: 28762197 acccatccatctccggcatctgaatgtccatgagacacagatcaaacttgtg 28762146



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 536      tgccttcgcttcaattgcccgtatttgccgggttgcctcaaa 577
                ||||||| |||| ||||| ||||||||||| |||||||||||
Sbjct: 28762858 tgccttcccttccattgctcgtatttgccgagttgcctcaaa 28762817



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  147 bits (74), Expect = 5e-32
 Identities = 134/154 (87%)
 Strand = Plus / Minus

                                                                            
Query: 321      ggttgttgtcagctggatgcgctaggtcccaagaacttctgcactgccttgaacaactgc 380
                ||||| |||||||||||  |||  || |||||||||||||| ||||||| ||| | ||||
Sbjct: 28854406 ggttggtgtcagctggaaacgcatgggcccaagaacttctgtactgcctggaagagctgc 28854347

                                                                            
Query: 381      ttctcctcgaagggtttcgagacgtagccgtccattccattctttgtgcattcctcatgg 440
                |||||||| ||||| |||||||||||||| ||||| ||   ||||||||||||||| |||
Sbjct: 28854346 ttctcctcaaagggcttcgagacgtagccatccatcccgcactttgtgcattcctcgtgg 28854287

                                                  
Query: 441      gtggcctggatgacatcggcagtcattgccagga 474
                ||||||||||||||||| || |||||||||||||
Sbjct: 28854286 gtggcctggatgacatcagcggtcattgccagga 28854253



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                    
Query: 577      acccatccatctctggcatttgaatatccattagacagagatcaaacttgtg 628
                ||||||||||||| ||||| ||||| ||||| ||||| ||||||||||||||
Sbjct: 28853521 acccatccatctccggcatctgaatgtccatgagacacagatcaaacttgtg 28853470



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 536      tgccttcgcttcaattgcccgtatttgccgggttgcctcaaa 577
                ||||||| |||| ||||| ||||||||||| |||||||||||
Sbjct: 28854182 tgccttcccttccattgctcgtatttgccgagttgcctcaaa 28854141



to top

>gb|AC091532.13| Oryza sativa chromosome 3 BAC OSJNBa0078A17 genomic sequence, complete
             sequence
          Length = 147344

 Score =  147 bits (74), Expect = 5e-32
 Identities = 134/154 (87%)
 Strand = Plus / Minus

                                                                         
Query: 321   ggttgttgtcagctggatgcgctaggtcccaagaacttctgcactgccttgaacaactgc 380
             ||||| |||||||||||  |||  || |||||||||||||| ||||||| ||| | ||||
Sbjct: 70063 ggttggtgtcagctggaaacgcatgggcccaagaacttctgtactgcctggaagagctgc 70004

                                                                         
Query: 381   ttctcctcgaagggtttcgagacgtagccgtccattccattctttgtgcattcctcatgg 440
             |||||||| ||||| |||||||||||||| ||||| ||   ||||||||||||||| |||
Sbjct: 70003 ttctcctcaaagggcttcgagacgtagccatccatcccgcactttgtgcattcctcgtgg 69944

                                               
Query: 441   gtggcctggatgacatcggcagtcattgccagga 474
             ||||||||||||||||| || |||||||||||||
Sbjct: 69943 gtggcctggatgacatcagcggtcattgccagga 69910



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                 
Query: 577   acccatccatctctggcatttgaatatccattagacagagatcaaacttgtg 628
             ||||||||||||| ||||| ||||| ||||| ||||| ||||||||||||||
Sbjct: 69178 acccatccatctccggcatctgaatgtccatgagacacagatcaaacttgtg 69127



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 536   tgccttcgcttcaattgcccgtatttgccgggttgcctcaaa 577
             ||||||| |||| ||||| ||||||||||| |||||||||||
Sbjct: 69839 tgccttcccttccattgctcgtatttgccgagttgcctcaaa 69798



to top

>dbj|AK060709.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-030-H10, full
           insert sequence
          Length = 1432

 Score =  147 bits (74), Expect = 5e-32
 Identities = 134/154 (87%)
 Strand = Plus / Minus

                                                                       
Query: 321 ggttgttgtcagctggatgcgctaggtcccaagaacttctgcactgccttgaacaactgc 380
           ||||| |||||||||||  |||  || |||||||||||||| ||||||| ||| | ||||
Sbjct: 879 ggttggtgtcagctggaaacgcatgggcccaagaacttctgtactgcctggaagagctgc 820

                                                                       
Query: 381 ttctcctcgaagggtttcgagacgtagccgtccattccattctttgtgcattcctcatgg 440
           |||||||| ||||| |||||||||||||| ||||| ||   ||||||||||||||| |||
Sbjct: 819 ttctcctcaaagggcttcgagacgtagccatccatcccgcactttgtgcattcctcgtgg 760

                                             
Query: 441 gtggcctggatgacatcggcagtcattgccagga 474
           ||||||||||||||||| || |||||||||||||
Sbjct: 759 gtggcctggatgacatcagcggtcattgccagga 726



 Score =  105 bits (53), Expect = 2e-19
 Identities = 83/93 (89%)
 Strand = Plus / Minus

                                                                       
Query: 536 tgccttcgcttcaattgcccgtatttgccgggttgcctcaaacccatccatctctggcat 595
           ||||||| |||| ||||| ||||||||||| ||||||||||| ||||||||||| |||||
Sbjct: 655 tgccttcccttccattgctcgtatttgccgagttgcctcaaatccatccatctccggcat 596

                                            
Query: 596 ttgaatatccattagacagagatcaaacttgtg 628
            ||||| ||||| ||||| ||||||||||||||
Sbjct: 595 ctgaatgtccatgagacacagatcaaacttgtg 563



to top

>ref|XM_469566.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3042

 Score =  141 bits (71), Expect = 3e-30
 Identities = 113/127 (88%)
 Strand = Plus / Minus

                                                                        
Query: 348  cccaagaacttctgcactgccttgaacaactgcttctcctcgaagggtttcgagacgtag 407
            |||||||||||||| ||||||| ||| | |||||||||||| ||||| ||||||||||||
Sbjct: 3023 cccaagaacttctgtactgcctggaagagctgcttctcctcaaagggcttcgagacgtag 2964

                                                                        
Query: 408  ccgtccattccattctttgtgcattcctcatgggtggcctggatgacatcggcagtcatt 467
            || ||||| ||   ||||||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 2963 ccatccatcccgcactttgtgcattcctcgtgggtggcctggatgacatcagcggtcatt 2904

                   
Query: 468  gccagga 474
            |||||||
Sbjct: 2903 gccagga 2897



 Score =  105 bits (53), Expect = 2e-19
 Identities = 83/93 (89%)
 Strand = Plus / Minus

                                                                        
Query: 536  tgccttcgcttcaattgcccgtatttgccgggttgcctcaaacccatccatctctggcat 595
            ||||||| |||| ||||| ||||||||||| ||||||||||| ||||||||||| |||||
Sbjct: 2826 tgccttcccttccattgctcgtatttgccgagttgcctcaaatccatccatctccggcat 2767

                                             
Query: 596  ttgaatatccattagacagagatcaaacttgtg 628
             ||||| ||||| ||||| ||||||||||||||
Sbjct: 2766 ctgaatgtccatgagacacagatcaaacttgtg 2734



to top

>dbj|AB206392.1| Zea mays ZmHK1b1' mRNA for histidine kinase, complete cds
          Length = 3046

 Score =  137 bits (69), Expect = 5e-29
 Identities = 123/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 349  ccaagaacttctgcactgccttgaacaactgcttctcctcgaagggtttcgagacgtagc 408
            |||||||||||||||  |||| ||| | |||||||||||||||||| |||| |||||| |
Sbjct: 2983 ccaagaacttctgcagcgcctggaagagctgcttctcctcgaagggcttcgtgacgtacc 2924

                                                                        
Query: 409  cgtccattccattctttgtgcattcctcatgggtggcctggatgacatcggcagtcattg 468
            | ||||| || | ||||||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 2923 catccatcccgtactttgtgcactcctcatgggtggcctggatgacatcggcggtcattg 2864

                                 
Query: 469  ccaggaccggtagatgccatc 489
            | ||||| || || |||||||
Sbjct: 2863 caaggacaggcaggtgccatc 2843



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                        
Query: 536  tgccttcgcttcaattgcccgtatttgccgggttgcctcaaacccatccatctctggcat 595
            |||||||||||| ||||||| |||||||  ||| ||||| ||||||||||| || |||||
Sbjct: 2784 tgccttcgcttccattgcccttatttgcttggtggcctcgaacccatccatttcgggcat 2725

                                                
Query: 596  ttgaatatccattagacagagatcaaacttgtgtgg 631
             ||||| ||||| ||||| ||||  ||||| |||||
Sbjct: 2724 ctgaatgtccatgagacaaagatggaacttatgtgg 2689



to top

>dbj|AB206391.1| Zea mays ZmHK1b1 mRNA for histidine kinase, complete cds
          Length = 3046

 Score =  137 bits (69), Expect = 5e-29
 Identities = 123/141 (87%)
 Strand = Plus / Minus

                                                                        
Query: 349  ccaagaacttctgcactgccttgaacaactgcttctcctcgaagggtttcgagacgtagc 408
            |||||||||||||||  |||| ||| | |||||||||||||||||| |||| |||||| |
Sbjct: 2983 ccaagaacttctgcagcgcctggaagagctgcttctcctcgaagggcttcgtgacgtacc 2924

                                                                        
Query: 409  cgtccattccattctttgtgcattcctcatgggtggcctggatgacatcggcagtcattg 468
            ||||||| || | ||| ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 2923 cgtccatcccgtacttcgtgcactcctcatgggtggcctggatgacatcggcggtcattg 2864

                                 
Query: 469  ccaggaccggtagatgccatc 489
            | ||||| || || |||||||
Sbjct: 2863 caaggacaggcaggtgccatc 2843



to top

>dbj|AB206393.1| Zea mays ZmHK1b2 mRNA for histidine kinase, complete cds
          Length = 3033

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 103/121 (85%)
 Strand = Plus / Minus

                                                                        
Query: 349  ccaagaacttctgcactgccttgaacaactgcttctcctcgaagggtttcgagacgtagc 408
            |||||||||||||||  |||| ||| | |||||||||||||||||| || | |||||| |
Sbjct: 2986 ccaagaacttctgcaacgcctggaagagctgcttctcctcgaagggctttgtgacgtacc 2927

                                                                        
Query: 409  cgtccattccattctttgtgcattcctcatgggtggcctggatgacatcggcagtcattg 468
            | ||||| ||   ||| ||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 2926 catccataccgcacttcgtgcactcttcatgggtggcctggatgacatcggcggtcattg 2867

             
Query: 469  c 469
            |
Sbjct: 2866 c 2866



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                        
Query: 536  tgccttcgcttcaattgcccgtatttgccgggttgcctcaaacccatccatctctggcat 595
            |||||||||||| ||||||| |||||||  ||| ||||||||||||||||| || |||||
Sbjct: 2787 tgccttcgcttccattgcccttatttgcttggtagcctcaaacccatccatttcgggcat 2728

                                          
Query: 596  ttgaatatccattagacagagatcaaactt 625
             ||||| ||||| ||||| |||| ||||||
Sbjct: 2727 ctgaatgtccatgagacaaagatgaaactt 2698



to top

>ref|XM_467688.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2955

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2708 gttgcctcaaacccatccatctctggcatctgaacatccat 2668



to top

>dbj|AB206390.1| Zea mays ZmHK1a2 mRNA for histidine kinase, complete cds
          Length = 2972

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||||||||||||||||||||||||||| |||| ||||||
Sbjct: 2687 gttgcctcaaacccatccatctctggcatctgaacatccat 2647



to top

>dbj|AB042270.1| Zea mays ZmHK1 mRNA for histidine kinase 1, complete cds
          Length = 3041

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 557  tatttgccgggttgcctcaaacccatccatctctggcatttgaatatccat 607
            |||||| | ||||||||||||||| |||||||||||||| |||| ||||||
Sbjct: 2761 tatttgtccggttgcctcaaacccgtccatctctggcatctgaacatccat 2711



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 444  gcctggatgacatcggcagtcattgccag 472
            |||||||| |||||||| |||||||||||
Sbjct: 2880 gcctggataacatcggctgtcattgccag 2852



to top

>gb|AY108856.1| Zea mays PCO066747 mRNA sequence
          Length = 936

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 557 tatttgccgggttgcctcaaacccatccatctctggcatttgaatatccat 607
           |||||| | ||||||||||||||| |||||||||||||| |||| ||||||
Sbjct: 561 tatttgtccggttgcctcaaacccgtccatctctggcatctgaacatccat 511



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 444 gcctggatgacatcggcagtcattgccag 472
           |||||||| |||||||| |||||||||||
Sbjct: 680 gcctggataacatcggctgtcattgccag 652



to top

>emb|AJ630372.1| Cucurbita maxima mRNA for putative histidine kinase, frame shifted
            splice variant
          Length = 4063

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 570  gcctcaaacccatccatctctggcatttgaatatccat 607
            ||||||||||||||||| || |||||||||||||||||
Sbjct: 3456 gcctcaaacccatccatttcaggcatttgaatatccat 3419



to top

>emb|AJ628045.1| Cucurbita maxima mRNA for putative histidine kinase
          Length = 3926

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 570  gcctcaaacccatccatctctggcatttgaatatccat 607
            ||||||||||||||||| || |||||||||||||||||
Sbjct: 3319 gcctcaaacccatccatttcaggcatttgaatatccat 3282



to top

>gb|DQ424897.1| Striga asiatica histidine kinase SHK278 mRNA, complete cds
          Length = 3009

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| |||||||| |||||||| |||||||||||||||||
Sbjct: 2747 gttgcttcaaacccgtccatctccggcatttgaatatccat 2707



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 444  gcctggatgacatcggcagtcattgccag 472
            |||||||||||||| |||||||| |||||
Sbjct: 2879 gcctggatgacatcagcagtcatggccag 2851



to top

>ref|NM_126244.2| Arabidopsis thaliana WOL (CYTOKININ RESPONSE 1) AT2G01830 (WOL)
            transcript variant AT2G01830.1 mRNA, complete cds
          Length = 3637

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 3088 gttgcttcaaatccgtccatctgtggcatttgaatatccat 3048



to top

>ref|NM_179594.1| Arabidopsis thaliana WOL (CYTOKININ RESPONSE 1) AT2G01830 (WOL)
            transcript variant AT2G01830.2 mRNA, complete cds
          Length = 3658

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 3089 gttgcttcaaatccgtccatctgtggcatttgaatatccat 3049



to top

>ref|NM_201667.1| Arabidopsis thaliana WOL (CYTOKININ RESPONSE 1) AT2G01830 (WOL)
            transcript variant AT2G01830.3 mRNA, complete cds
          Length = 3654

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 3085 gttgcttcaaatccgtccatctgtggcatttgaatatccat 3045



to top

>emb|AJ278530.1|ATH278530 Arabidopsis thaliana mRNA for putative histidine kinase receptor (wol
            gene), splice variant 3
          Length = 3612

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 3085 gttgcttcaaatccgtccatctgtggcatttgaatatccat 3045



to top

>emb|AJ278529.1|ATH278529 Arabidopsis thaliana mRNA for putative histidine kinase receptor (wol
            gene), splice variant 2
          Length = 3503

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 2976 gttgcttcaaatccgtccatctgtggcatttgaatatccat 2936



to top

>emb|AJ278528.1|ATH278528 Arabidopsis thaliana mRNA for putative histidine kinase receptor (wol
            gene), splice variant 1
          Length = 3620

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 3093 gttgcttcaaatccgtccatctgtggcatttgaatatccat 3053



to top

>gb|DQ232601.1| Receiver Vector p415-CYC1-CRE1a-TR-SSRE-GFP, complete sequence
          Length = 11482

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 2350 gttgcttcaaatccgtccatctgtggcatttgaatatccat 2390



to top

>gb|DQ232600.1| Receiver Vector p415-CYC1-CRE1a-SSRE-GFP, complete sequence
          Length = 11442

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 2310 gttgcttcaaatccgtccatctgtggcatttgaatatccat 2350



to top

>dbj|AB046871.1| Arabidopsis thaliana AHK4 mRNA for histidine kinase, complete cds
          Length = 3243

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 3023 gttgcttcaaatccgtccatctgtggcatttgaatatccat 2983



to top

>dbj|AB049935.1| Arabidopsis thaliana mRNA for cytokinin receptor CRE1b, complete cds
          Length = 3694

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 3091 gttgcttcaaatccgtccatctgtggcatttgaatatccat 3051



to top

>dbj|AB049934.1| Arabidopsis thaliana mRNA for cytokinin receptor CRE1a, complete cds
          Length = 3649

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 567  gttgcctcaaacccatccatctctggcatttgaatatccat 607
            ||||| ||||| || ||||||| ||||||||||||||||||
Sbjct: 3054 gttgcttcaaatccgtccatctgtggcatttgaatatccat 3014



to top

>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 579     ccatccatctctggcatttgaatatccatta 609
               |||||||| || |||||||||||||||||||
Sbjct: 2876219 ccatccatgtccggcatttgaatatccatta 2876189



to top

>ref|NM_196042.1| Oryza sativa (japonica cultivar-group) putative histidine kinase
            (OSJNBa0073L01.1), mRNA
          Length = 3161

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 573  tcaaacccatccatctctggcatttgaatatccat 607
            ||||||||||||||||| ||||| |||| ||||||
Sbjct: 2567 tcaaacccatccatctcaggcatctgaacatccat 2533



to top

>gb|AE017128.1| Yersinia pestis biovar Medievalis str. 91001 section 2 of 16 of the
             complete genome
          Length = 290803

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 579   ccatccatctctggcatttgaatatccatta 609
             ||||| || ||||||||||||||||||||||
Sbjct: 27649 ccatcgatttctggcatttgaatatccatta 27679



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 579    ccatccatctctggcatttgaatatccatta 609
              ||||| || ||||||||||||||||||||||
Sbjct: 904988 ccatcgatttctggcatttgaatatccatta 905018



to top

>gb|AC141922.19| Medicago truncatula clone mth2-9n11, complete sequence
          Length = 107448

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 577   acccatccatctctggcatttgaatatccat 607
             |||| ||||| ||||||||||||||||||||
Sbjct: 53589 acccgtccatttctggcatttgaatatccat 53559



to top

>gb|AC144931.29| Medicago truncatula clone mth2-22b18, complete sequence
          Length = 122819

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 577   acccatccatctctggcatttgaatatccat 607
             |||| ||||| ||||||||||||||||||||
Sbjct: 25124 acccgtccatttctggcatttgaatatccat 25094



to top

>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 579     ccatccatctctggcatttgaatatccatta 609
               |||||||| || |||||||||||||||||||
Sbjct: 2915255 ccatccatgtccggcatttgaatatccatta 2915225



to top

>emb|CR932957.2| Medicago truncatula chromosome 5 clone mth2-58c3, COMPLETE SEQUENCE
          Length = 136080

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 577  acccatccatctctggcatttgaatatccat 607
            |||||||||| |||||||||||||| |||||
Sbjct: 4270 acccatccatttctggcatttgaatgtccat 4300



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 579    ccatccatctctggcatttgaatatccatta 609
              ||||| || ||||||||||||||||||||||
Sbjct: 902585 ccatcgatttctggcatttgaatatccatta 902615



to top

>emb|AJ414156.1| Yersinia pestis strain CO92 complete genome; segment 16/20
          Length = 220050

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 579    ccatccatctctggcatttgaatatccatta 609
              ||||| || ||||||||||||||||||||||
Sbjct: 193562 ccatcgatttctggcatttgaatatccatta 193532



to top

>gb|AY092025.1| Catharanthus roseus cytokinin receptor (CKR1) mRNA, complete cds
          Length = 4040

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 573  tcaaacccatccatctctggcatttgaatatccat 607
            |||||||| ||||| ||||||||||||| ||||||
Sbjct: 2933 tcaaacccgtccatttctggcatttgaagatccat 2899



to top

>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 579     ccatccatctctggcatttgaatatccatta 609
               |||||||| || |||||||||||||||||||
Sbjct: 2915889 ccatccatgtccggcatttgaatatccatta 2915859



to top

>gb|AC170800.5| Medicago truncatula clone mth2-32n7, complete sequence
          Length = 99712

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 577   acccatccatctctggcatttgaatatccat 607
             |||| ||||| ||||||||||||||||||||
Sbjct: 43107 acccgtccatttctggcatttgaatatccat 43077



to top

>gb|AC146785.12| Medicago truncatula clone mth2-4h4, complete sequence
          Length = 149005

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 577  acccatccatctctggcatttgaatatccat 607
            |||||||||| |||||||||||||| |||||
Sbjct: 8426 acccatccatttctggcatttgaatgtccat 8396



to top

>gb|AC142094.12| Medicago truncatula clone mth2-34h6, complete sequence
          Length = 151594

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 577    acccatccatctctggcatttgaatatccat 607
              |||| ||||| ||||||||||||||||||||
Sbjct: 126471 acccgtccatttctggcatttgaatatccat 126501



to top

>gb|AC007069.6| Arabidopsis thaliana chromosome 2 clone T23K3 map mi320, complete
            sequence
          Length = 73009

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 577  acccatccatctctggcatttgaatatccat 607
            |||| ||||||| ||||||||||||||||||
Sbjct: 9848 acccgtccatctgtggcatttgaatatccat 9878



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 577      acccatccatctctggcatttgaatatccat 607
                ||||||||||||||||||| |||| ||||||
Sbjct: 30847100 acccatccatctctggcatctgaacatccat 30847070



to top

>gb|AY216909.1| Vibrio parahaemolyticus opa operon, complete sequence
          Length = 5083

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 573  tcaaacccatccatctctggcatttgaatatccat 607
            |||||||||| |||| |||||||||||| ||||||
Sbjct: 4176 tcaaacccattcatcactggcatttgaacatccat 4142



to top

>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 579     ccatccatctctggcatttgaatatccatta 609
               |||||||| || |||||||||||||||||||
Sbjct: 2870923 ccatccatgtccggcatttgaatatccatta 2870893



to top

>dbj|AP005112.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0684F11
          Length = 147731

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 577   acccatccatctctggcatttgaatatccat 607
             ||||||||||||||||||| |||| ||||||
Sbjct: 30677 acccatccatctctggcatctgaacatccat 30647



to top

>emb|AJ298990.1|FSY298990 Fagus sylvatica partial mRNA for histidine kinase receptor (hkf1
           gene), clone FsHKf1
          Length = 744

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 573 tcaaacccatccatctctggcatttgaatatccat 607
           |||||||||||||| || |||||||| ||||||||
Sbjct: 612 tcaaacccatccatttccggcatttggatatccat 578



to top

>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 579     ccatccatctctggcatttgaatatccatta 609
               |||||||| || |||||||||||||||||||
Sbjct: 3706930 ccatccatgtcaggcatttgaatatccatta 3706900



to top

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 579     ccatccatctctggcatttgaatatccatta 609
               |||||||| || |||||||||||||||||||
Sbjct: 3639632 ccatccatgtcaggcatttgaatatccatta 3639602



to top

>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 579     ccatccatctctggcatttgaatatccatta 609
               |||||||| || |||||||||||||||||||
Sbjct: 2773208 ccatccatgtccggcatttgaatatccatta 2773178



to top

>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 579     ccatccatctctggcatttgaatatccatta 609
               |||||||| || |||||||||||||||||||
Sbjct: 2673946 ccatccatgtccggcatttgaatatccatta 2673916



to top

>gb|CP000038.1| Shigella sonnei Ss046, complete genome
          Length = 4825265

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 579     ccatccatctctggcatttgaatatccatta 609
               |||||||| || |||||||||||||||||||
Sbjct: 3086960 ccatccatgtcaggcatttgaatatccatta 3086930



to top

>dbj|D10888.1|ECOBARA E.coli barA gene for sensor-regulator protein
          Length = 3060

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 579  ccatccatctctggcatttgaatatccatta 609
            |||||||| || |||||||||||||||||||
Sbjct: 2290 ccatccatgtccggcatttgaatatccatta 2260



to top

>gb|AE004291.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 199
            of 251 of the complete chromosome
          Length = 10563

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 579  ccatccatctctggcatttgaatatc 604
            ||||||||||||||||||| ||||||
Sbjct: 8902 ccatccatctctggcatttcaatatc 8927



to top

>dbj|BA000038.2| Vibrio vulnificus YJ016 DNA, chromosome II, complete sequence
          Length = 1857073

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 579    ccatccatctctggcatttgaatatc 604
              ||||||||||||||||| ||||||||
Sbjct: 725766 ccatccatctctggcatatgaatatc 725741



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 579     ccatccatctctggcatttgaatatccat 607
               ||||||||| ||||||||||||| |||||
Sbjct: 1576259 ccatccatcactggcatttgaatgtccat 1576231



to top

>gb|DQ381152.1| Bos taurus BTA17 39037 genomic sequence contig containing highly
             polymorphic single nucleotide sites
          Length = 67848

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 282   gtttctcccagtcaatgtacac 303
             ||||||||||||||||||||||
Sbjct: 20785 gtttctcccagtcaatgtacac 20764



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 282   gtttctcccagtcaatgtacac 303
             ||||||||||||||||||||||
Sbjct: 20740 gtttctcccagtcaatgtacac 20719



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 282   gtttctcccagtcaatgtacac 303
             ||||||||||||||||||||||
Sbjct: 20695 gtttctcccagtcaatgtacac 20674



to top

>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete
               sequence
          Length = 4332241

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 577     acccatccatctctggcatttg 598
               ||||||||||||||||||||||
Sbjct: 1737781 acccatccatctctggcatttg 1737760



to top

>gb|AE016796.1| Vibrio vulnificus CMCP6 chromosome II, complete sequence
          Length = 1844853

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 579    ccatccatctctggcatttgaatatc 604
              ||||||||||||||||| ||||||||
Sbjct: 147122 ccatccatctctggcatatgaatatc 147097



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 579     ccatccatctctggcatttgaatatccat 607
               ||||||||| ||||||||||||| |||||
Sbjct: 1009280 ccatccatcactggcatttgaatgtccat 1009252



to top

>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome
               I, complete sequence
          Length = 4277185

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 577     acccatccatctctggcatttg 598
               ||||||||||||||||||||||
Sbjct: 2492406 acccatccatctctggcatttg 2492427



to top

>ref|XM_637136.1| Dictyostelium discoideum histidine kinase (DDB0215358), partial mRNA
          Length = 5910

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 573  tcaaacccatccatctctggcatttgaatatccatta 609
            ||||| |||||||| ||||||||||||  ||||||||
Sbjct: 5696 tcaaatccatccatttctggcatttgacaatccatta 5660



to top

>gb|AC146611.2| Mus musculus BAC clone RP23-57A17 from chromosome 5, complete sequence
          Length = 194487

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 573   tcaaacccatccatctctggc 593
             |||||||||||||||||||||
Sbjct: 57903 tcaaacccatccatctctggc 57883



to top

>emb|CR812847.5| Zebrafish DNA sequence from clone DKEY-9I15 in linkage group 14, complete
              sequence
          Length = 230522

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 351    aagaacttctgcactgccttg 371
              |||||||||||||||||||||
Sbjct: 168938 aagaacttctgcactgccttg 168918



to top

>ref|XM_447508.1| Candida glabrata CBS138 hypothetical protein (CAGL0I05940g) partial
           mRNA
          Length = 882

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 350 caagaacttctgcactgccttgaacaact 378
           |||||||||||||||  ||||||||||||
Sbjct: 435 caagaacttctgcacatccttgaacaact 407



to top

>gb|CP000302.1| Shewanella denitrificans OS217, complete genome
          Length = 4545906

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 579    ccatccatctctggcatttgaatatccat 607
              ||||||||| ||||||||||||| |||||
Sbjct: 612527 ccatccatcactggcatttgaatgtccat 612499



to top

>emb|CR380955.1| Candida glabrata strain CBS138 chromosome I complete sequence
          Length = 1089401

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 350    caagaacttctgcactgccttgaacaact 378
              |||||||||||||||  ||||||||||||
Sbjct: 566291 caagaacttctgcacatccttgaacaact 566319



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 578    cccatccatctctggcatttgaatatcca 606
              |||||||| |||||||||||| |||||||
Sbjct: 519604 cccatccacctctggcatttgcatatcca 519632



to top

>gb|AC151956.5| Medicago truncatula clone mth2-52p17, complete sequence
          Length = 120704

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 567    gttgcctcaaacccatccatctctggcat 595
              |||||||||||||||||| || |||||||
Sbjct: 108782 gttgcctcaaacccatccttcactggcat 108810



to top

>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 591     ggcatttgaatatccattaga 611
               |||||||||||||||||||||
Sbjct: 2848152 ggcatttgaatatccattaga 2848132



to top

>gb|AC129342.5| Rattus norvegicus  BAC CH230-229B21 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 224257

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 626   gtgtggggcttgcagaagctc 646
             |||||||||||||||||||||
Sbjct: 92574 gtgtggggcttgcagaagctc 92594



to top

>gb|AF024654.1|AF024654 Dictyostelium discoideum hybrid histidine kinase DHKB (dhkB) gene,
            complete cds
          Length = 7133

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 573  tcaaacccatccatctctggcatttgaatatccatta 609
            ||||| |||||||| ||||||||||||  ||||||||
Sbjct: 6834 tcaaatccatccatttctggcatttgacaatccatta 6798



to top

>gb|AC129600.4| Mus musculus BAC clone RP23-361D7 from chromosome 5, complete sequence
          Length = 223491

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 573   tcaaacccatccatctctggc 593
             |||||||||||||||||||||
Sbjct: 88997 tcaaacccatccatctctggc 89017



to top

>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 567     gttgcctcaaacccatccatc 587
               |||||||||||||||||||||
Sbjct: 1872557 gttgcctcaaacccatccatc 1872537



to top

>ref|XM_345899.2| PREDICTED: Rattus norvegicus melatonin receptor 1B (Mtnr1b), mRNA
          Length = 1860

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 420 ttctttgtgcattcctcatgg 440
           |||||||||||||||||||||
Sbjct: 589 ttctttgtgcattcctcatgg 569



to top

>dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete genome
          Length = 2593857

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 579    ccatccatctctggcatttgaatatccat 607
              ||||||||||| |||||||| ||||||||
Sbjct: 890906 ccatccatctccggcatttgcatatccat 890934



to top

>emb|BX005228.7| Zebrafish DNA sequence from clone CH211-163M17 in linkage group 14,
             complete sequence
          Length = 171037

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 351   aagaacttctgcactgccttg 371
             |||||||||||||||||||||
Sbjct: 56003 aagaacttctgcactgccttg 56023



to top

>gb|AY600439.1| Lycopersicon esculentum ethylene receptor neverripe (ETR5) gene,
            complete cds
          Length = 5166

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 579  ccatccatctctggcatttgaatatcca 606
            |||||||| ||||||||||||| |||||
Sbjct: 4958 ccatccatttctggcatttgaagatcca 4931



to top

>ref|XM_639569.1| Dictyostelium discoideum histidine kinase (DDB0185039), partial mRNA
          Length = 5211

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 590  tggcatttgaatatccatta 609
            ||||||||||||||||||||
Sbjct: 4827 tggcatttgaatatccatta 4808



to top

>ref|XM_639498.1| Dictyostelium discoideum histidine kinase DhkI (DDB0217151), partial
            mRNA
          Length = 5211

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 590  tggcatttgaatatccatta 609
            ||||||||||||||||||||
Sbjct: 4827 tggcatttgaatatccatta 4808



to top

>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 518     tgaattatcaccattatgtgcctt 541
               ||||||||||||||||||| ||||
Sbjct: 3523741 tgaattatcaccattatgttcctt 3523764



to top

>ref|XR_001629.1| PREDICTED: Mus musculus cDNA sequence BC067074 (BC067074), misc RNA
          Length = 8162

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 435 tcatgggtggcctggatgac 454
           ||||||||||||||||||||
Sbjct: 971 tcatgggtggcctggatgac 990



to top

>ref|XR_004508.1| PREDICTED: Mus musculus cDNA sequence BC067074 (BC067074), misc RNA
          Length = 8042

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 435  tcatgggtggcctggatgac 454
            ||||||||||||||||||||
Sbjct: 1028 tcatgggtggcctggatgac 1047



to top

>gb|AC124494.4| Mus musculus BAC clone RP23-464P12 from chromosome 13, complete sequence
          Length = 204177

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 435    tcatgggtggcctggatgac 454
              ||||||||||||||||||||
Sbjct: 106620 tcatgggtggcctggatgac 106639



to top

>gb|AC112157.4| Mus musculus BAC clone RP24-103F14 from chromosome 13, complete sequence
          Length = 155757

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 435    tcatgggtggcctggatgac 454
              ||||||||||||||||||||
Sbjct: 148095 tcatgggtggcctggatgac 148076



to top

>gb|AC122337.4| Mus musculus BAC clone RP23-351M10 from chromosome 12, complete sequence
          Length = 196396

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 369    ttgaacaactgcttctcctc 388
              ||||||||||||||||||||
Sbjct: 110168 ttgaacaactgcttctcctc 110187



to top

>gb|AC123714.6| Mus musculus chromosome 9, clone RP23-393E20, complete sequence
          Length = 217860

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 584   catctctggcatttgaatat 603
             ||||||||||||||||||||
Sbjct: 29946 catctctggcatttgaatat 29965



to top

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 582     tccatctctggcatttgaatatccatta 609
               ||||| || |||||||||||||||||||
Sbjct: 3192048 tccatgtccggcatttgaatatccatta 3192021



to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 582     tccatctctggcatttgaatatccatta 609
               ||||| || |||||||||||||||||||
Sbjct: 3071687 tccatgtccggcatttgaatatccatta 3071660



to top

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 579     ccatccatctctggcatttgaatatcca 606
               |||||||| || ||||||||||||||||
Sbjct: 4720253 ccatccatttcgggcatttgaatatcca 4720280



to top

>emb|BX571865.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
             7/17
          Length = 348813

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 587   ctctggcatttgaatatcca 606
             ||||||||||||||||||||
Sbjct: 13853 ctctggcatttgaatatcca 13834



to top

>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete
             sequence
          Length = 1877212

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 575   aaacccatccatctctggcatttg 598
             ||||||||||||| ||||||||||
Sbjct: 10143 aaacccatccatcactggcatttg 10120



to top

>gb|AC157474.2| Mus musculus BAC clone RP24-565B5 from chromosome 9, complete sequence
          Length = 192701

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 584   catctctggcatttgaatat 603
             ||||||||||||||||||||
Sbjct: 93077 catctctggcatttgaatat 93058



to top

>gb|AF362371.1|AF362371 Dictyostelium discoideum histidine kinase DhkI (dhkI) gene, complete
            cds
          Length = 6074

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 590  tggcatttgaatatccatta 609
            ||||||||||||||||||||
Sbjct: 5066 tggcatttgaatatccatta 5047



to top

>gb|AC116330.2| Dictyostelium discoideum chromosome 2 map 3191214-3323468 strain AX4,
             complete sequence
          Length = 132254

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 590   tggcatttgaatatccatta 609
             ||||||||||||||||||||
Sbjct: 38774 tggcatttgaatatccatta 38793



to top

>gb|AC137517.6| Homo sapiens 3 BAC RP11-671N3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 105622

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 419   attctttgtgcattcctcatgggt 442
             ||||||||||| ||||||||||||
Sbjct: 58558 attctttgtgccttcctcatgggt 58535



to top

>gb|AC063943.23| Homo sapiens 12 BAC RP11-18C24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 137242

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 275   agtcagagtttctcccagtcaatg 298
             ||||||| ||||||||||||||||
Sbjct: 14817 agtcagattttctcccagtcaatg 14840



to top

>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome
          Length = 4969803

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 582    tccatctctggcatttgaatatccatta 609
              |||||| ||||||| |||||||||||||
Sbjct: 602742 tccatcactggcatctgaatatccatta 602715



to top

>gb|AF118844.1|AF118844 Lycopersicon esculentum ethylene receptor homolog (ETR5) mRNA,
            complete cds
          Length = 3370

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 579  ccatccatctctggcatttgaatatcca 606
            |||||||| ||||||||||||| |||||
Sbjct: 2776 ccatccatttctggcatttgaagatcca 2749



to top

>emb|BX537644.1|HSM806477 Homo sapiens mRNA; cDNA DKFZp686M1498 (from clone DKFZp686M1498)
          Length = 3587

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 275  agtcagagtttctcccagtcaatg 298
            ||||||| ||||||||||||||||
Sbjct: 1949 agtcagattttctcccagtcaatg 1926


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,894,126
Number of Sequences: 3902068
Number of extensions: 4894126
Number of successful extensions: 89588
Number of sequences better than 10.0: 98
Number of HSP's better than 10.0 without gapping: 98
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88810
Number of HSP's gapped (non-prelim): 778
length of query: 650
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 627
effective length of database: 17,143,297,704
effective search space: 10748847660408
effective search space used: 10748847660408
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top