ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal16n06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 68 4e-08
2dbj|AP004765.3| Oryza sativa (japonica cultivar-group) genomic D... 68 4e-08
3ref|XM_483319.1| Oryza sativa (japonica cultivar-group), mRNA 64 7e-07
4gb|BT018570.1| Zea mays clone EL01N0442G09.d mRNA sequence 44 0.62
5gb|AY106602.1| Zea mays PCO121275 mRNA sequence 44 0.62
6ref|XM_709908.1| Candida albicans SC5314 hypothetical protein (C... 42 2.5
7ref|XM_709845.1| Candida albicans SC5314 hypothetical protein (C... 42 2.5
8gb|AC099710.8| Mus musculus, clone RP23-366C6, complete sequence 42 2.5
9gb|AC148607.16| Medicago truncatula clone mth2-43g15, complete s... 42 2.5
10emb|AL133259.24| Human DNA sequence from clone RP1-258E1 on chro... 42 2.5
11gb|AC106807.2| Homo sapiens chromosome 5 clone RP11-513C4, compl... 42 2.5
12emb|BX323555.10| Zebrafish DNA sequence from clone DKEY-163M14 i... 42 2.5
13gb|AC067738.17| Homo sapiens 3 BAC RP11-381H1 (Roswell Park Canc... 42 2.5
14gb|AC078847.2|AC078847 Homo sapiens chromosome 7 clone RP11-3M15... 42 2.5
15gb|AC009276.9|AC009276 Homo sapiens chromosome 7 clone RP11-239G... 42 2.5
16gb|AC004264.1|AC004264 Homo sapiens PAC clone RP1-102K2 from 22q... 42 2.5
17gb|J03261.1|HUMLIFM Human myeloid leukemia-inhibitory factor, 3'... 42 2.5
18emb|AL671908.8| Mouse DNA sequence from clone RP23-307G22 on chr... 42 2.5
19gb|M27053.1|HUMDSF02 Human differentiation-stimulating factor (D... 42 2.5
20gb|M63420.1|HUMALIFA Human leukemia inhibitory factor (LIF) gene... 42 2.5
21gb|AC154279.2| Mus musculus BAC clone RP24-271E12 from chromosom... 40 9.7
22gb|AC127361.4| Mus musculus BAC clone RP23-125M8 from chromosome... 40 9.7
23gb|AC000121.1| Homo sapiens BAC clone CTA-249A12 from 7, complet... 40 9.7
24gb|AC104396.7| Mus musculus BAC clone RP23-413J8 from chromosome... 40 9.7
25ref|XM_735560.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 9.7
26emb|AL392086.14| Human DNA sequence from clone RP11-799O21 on ch... 40 9.7
27emb|AL359076.16| Human DNA sequence from clone RP11-264I13 on ch... 40 9.7
28emb|AL353680.8| Human DNA sequence from clone RP11-252M21 on chr... 40 9.7
29emb|AL121974.16|HSJ417L20 Human DNA sequence from clone RP3-417L... 40 9.7
30emb|AL049694.9|HSDJ99E18 Human DNA sequence from clone RP1-99E18... 40 9.7
31emb|Y15173.1|HPVY15173 Human papillomavirus type 75 E6, E7, E1, ... 40 9.7
32emb|AL512585.12| Mouse DNA sequence from clone RP23-236A12 on ch... 40 9.7
33gb|AC125282.1| Homo sapiens chromosome 2 clone RP11-97B21, compl... 40 9.7
34emb|BX511256.9| Zebrafish DNA sequence from clone DKEY-58M10 in ... 40 9.7
35gb|AC084758.3| Homo sapiens chromosome 15 clone RP11-348A14 map ... 40 9.7
36dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.7
37gb|AC073964.3|AC073964 Homo sapiens chromosome 15 clone RP11-394... 40 9.7
38gb|AY593834.1| Foot-and-mouth disease virus O isolate orey-iran ... 40 9.7
39gb|AY593800.1| Foot-and-mouth disease virus Asia 1 isolate asia1... 40 9.7
40gb|AY593799.1| Foot-and-mouth disease virus Asia 1 isolate asia1... 40 9.7
41gb|AY593798.1| Foot-and-mouth disease virus Asia 1 isolate asia1... 40 9.7
42gb|AC023355.5|AC023355 Homo sapiens chromosome 15 clone RP11-154... 40 9.7
43gb|AC113607.3| Homo sapiens BAC clone RP11-97B21 from 2, complet... 40 9.7
44gb|AC073257.6| Homo sapiens BAC clone RP11-213H22 from 2, comple... 40 9.7
45gb|AC116609.6| Homo sapiens BAC clone RP13-539J13 from 2, comple... 40 9.7
46dbj|AP005650.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.7
47dbj|AP001312.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 9.7
48dbj|AB025611.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 9.7
49ref|XM_312777.2| Anopheles gambiae str. PEST ENSANGP00000020334 ... 40 9.7
50emb|BX537270.4| Zebrafish DNA sequence from clone DKEY-278E24 in... 40 9.7
51emb|BX510652.6| Zebrafish DNA sequence from clone CH211-107N23 i... 40 9.7
52gb|AC076974.33| Mus musculus strain C57BL/6J chromosome 8 clone ... 40 9.7
53gb|AC126803.4| Mus musculus BAC clone RP24-549B23 from 3, comple... 40 9.7
54gb|AC147562.5| Mus musculus BAC clone RP23-239A13 from 3, comple... 40 9.7
55emb|AL928966.3| Mouse DNA sequence from clone RP24-388A9 on chro... 40 9.7
56gb|M19149.1|HUMPGK2P Human phosphoglycerate kinase-2 retroposon ... 40 9.7 
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                            
Query: 368      aaaatcaggaggattgaggacaatatatgctctagaattggtgtaactgtcctcggaagc 427
                |||||| ||||||||||||||||||||||||| | ||||| |||| | |||||| |||||
Sbjct: 25433058 aaaatctggaggattgaggacaatatatgctccacaattgttgtaccggtcctctgaagc 25432999

                  
Query: 428      ct 429
                ||
Sbjct: 25432998 ct 25432997
to top
>dbj|AP004765.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0711H09
          Length = 185858

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                         
Query: 368   aaaatcaggaggattgaggacaatatatgctctagaattggtgtaactgtcctcggaagc 427
             |||||| ||||||||||||||||||||||||| | ||||| |||| | |||||| |||||
Sbjct: 64374 aaaatctggaggattgaggacaatatatgctccacaattgttgtaccggtcctctgaagc 64315

               
Query: 428   ct 429
             ||
Sbjct: 64314 ct 64313
to top
>ref|XM_483319.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1287

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 368  aaaatcaggaggattgaggacaatatatgctctagaattggtgtaactgtcctcggaagc 427
            |||||| ||||||||||||||||||||||||| | ||||| |||| | |||||| |||||
Sbjct: 1149 aaaatctggaggattgaggacaatatatgctccacaattgttgtaccggtcctctgaagc 1090
to top
>gb|BT018570.1| Zea mays clone EL01N0442G09.d mRNA sequence
          Length = 1221

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 362 ggtaggaaaatcaggaggattgaggacaatatatgctc 399
           ||||| ||||||||| ||| | ||||||||||||||||
Sbjct: 836 ggtagcaaaatcaggtggactaaggacaatatatgctc 799
to top
>gb|AY106602.1| Zea mays PCO121275 mRNA sequence
          Length = 892

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 362 ggtaggaaaatcaggaggattgaggacaatatatgctc 399
           ||||| ||||||||| ||| | ||||||||||||||||
Sbjct: 744 ggtagcaaaatcaggtggactaaggacaatatatgctc 707
to top
>ref|XM_709908.1| Candida albicans SC5314 hypothetical protein (CaO19.11063), mRNA
          Length = 702

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 627 aatttttgttttaattcaaat 647
           |||||||||||||||||||||
Sbjct: 506 aatttttgttttaattcaaat 486
to top
>ref|XM_709845.1| Candida albicans SC5314 hypothetical protein (CaO19.3579), mRNA
          Length = 702

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 627 aatttttgttttaattcaaat 647
           |||||||||||||||||||||
Sbjct: 506 aatttttgttttaattcaaat 486
to top
>gb|AC099710.8| Mus musculus, clone RP23-366C6, complete sequence
          Length = 225122

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 556    atggatggctcatactctatt 576
              |||||||||||||||||||||
Sbjct: 120639 atggatggctcatactctatt 120659
to top
>gb|AC148607.16| Medicago truncatula clone mth2-43g15, complete sequence
          Length = 148291

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 629   tttttgttttaattcaaatca 649
             |||||||||||||||||||||
Sbjct: 47158 tttttgttttaattcaaatca 47138
to top
>emb|AL133259.24| Human DNA sequence from clone RP1-258E1 on chromosome 6 Contains the 3'
             end of the CD83 gene for CD83 antigen (activated B
             lymphocytes, immunoglobulin superfamily), complete
             sequence
          Length = 72979

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 124   atccttcaaaaatgatcaaga 144
             |||||||||||||||||||||
Sbjct: 48286 atccttcaaaaatgatcaaga 48306
to top
>gb|AC106807.2| Homo sapiens chromosome 5 clone RP11-513C4, complete sequence
          Length = 176040

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 624    cagaatttttgttttaattca 644
              |||||||||||||||||||||
Sbjct: 136797 cagaatttttgttttaattca 136777
to top
>emb|BX323555.10| Zebrafish DNA sequence from clone DKEY-163M14 in linkage group 21,
             complete sequence
          Length = 180416

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 619   caccacagaatttttgttttaattcaaat 647
             ||||||||||||||| || ||||||||||
Sbjct: 15592 caccacagaatttttcttataattcaaat 15620
to top
>gb|AC067738.17| Homo sapiens 3 BAC RP11-381H1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 82883

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 624   cagaatttttgttttaattcaaatc 648
             ||||||||||||||||||| |||||
Sbjct: 30753 cagaatttttgttttaattaaaatc 30777
to top
>gb|AC078847.2|AC078847 Homo sapiens chromosome 7 clone RP11-3M15, complete sequence
          Length = 170919

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 69    aaccaacatttattgagagtgtact 93
             ||||||||| |||||||||||||||
Sbjct: 22159 aaccaacatgtattgagagtgtact 22135
to top
>gb|AC009276.9|AC009276 Homo sapiens chromosome 7 clone RP11-239G19, complete sequence
          Length = 163631

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 69    aaccaacatttattgagagtgtact 93
             ||||||||| |||||||||||||||
Sbjct: 56391 aaccaacatgtattgagagtgtact 56415
to top
>gb|AC004264.1|AC004264 Homo sapiens PAC clone RP1-102K2 from 22q12.1-qter, complete sequence
          Length = 47188

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 440  aatttgttttggctctcatgacaat 464
            |||| ||||||||||||||||||||
Sbjct: 8927 aattagttttggctctcatgacaat 8903
to top
>gb|J03261.1|HUMLIFM Human myeloid leukemia-inhibitory factor, 3' end
          Length = 1297

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 440 aatttgttttggctctcatgacaat 464
           |||| ||||||||||||||||||||
Sbjct: 717 aattagttttggctctcatgacaat 741
to top
>emb|AL671908.8| Mouse DNA sequence from clone RP23-307G22 on chromosome X, complete
             sequence
          Length = 205224

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 556   atggatggctcatactctatt 576
             |||||||||||||||||||||
Sbjct: 30627 atggatggctcatactctatt 30647
to top
>gb|M27053.1|HUMDSF02 Human differentiation-stimulating factor (D-factor) gene, exon 1
          Length = 2144

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 440 aatttgttttggctctcatgacaat 464
           |||| ||||||||||||||||||||
Sbjct: 839 aattagttttggctctcatgacaat 863
to top
>gb|M63420.1|HUMALIFA Human leukemia inhibitory factor (LIF) gene, complete cds
          Length = 7614

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 440  aatttgttttggctctcatgacaat 464
            |||| ||||||||||||||||||||
Sbjct: 3180 aattagttttggctctcatgacaat 3204
to top
>gb|AC154279.2| Mus musculus BAC clone RP24-271E12 from chromosome 17, complete sequence
          Length = 173729

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 688    tggatgggaggctgacactg 707
              ||||||||||||||||||||
Sbjct: 125955 tggatgggaggctgacactg 125974
to top
>gb|AC127361.4| Mus musculus BAC clone RP23-125M8 from chromosome 17, complete sequence
          Length = 201331

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 558   ggatggctcatactctattcatta 581
             |||||||||| |||||||||||||
Sbjct: 88401 ggatggctcaaactctattcatta 88378
to top
>gb|AC000121.1| Homo sapiens BAC clone CTA-249A12 from 7, complete sequence
          Length = 93163

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 67   gaaaccaacatttattgaga 86
            ||||||||||||||||||||
Sbjct: 6479 gaaaccaacatttattgaga 6460
to top
>gb|AC104396.7| Mus musculus BAC clone RP23-413J8 from chromosome 3, complete sequence
          Length = 195860

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 348   actatggaaatgatggtaggaaaa 371
             |||||| |||||||||||||||||
Sbjct: 89771 actatgtaaatgatggtaggaaaa 89794
to top
>ref|XM_735560.1| Plasmodium chabaudi chabaudi hypothetical protein (PC001412.02.0)
           partial mRNA
          Length = 303

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 627 aatttttgttttaattcaaa 646
           ||||||||||||||||||||
Sbjct: 154 aatttttgttttaattcaaa 173
to top
>emb|AL392086.14| Human DNA sequence from clone RP11-799O21 on chromosome 10 Contains the
              3' end of a novel gene and a novel gene, complete sequence
          Length = 220225

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 348    actatggaaatgatggtaggaaaa 371
              ||||||||||||||||||| ||||
Sbjct: 217711 actatggaaatgatggtagcaaaa 217734
to top
>emb|AL359076.16| Human DNA sequence from clone RP11-264I13 on chromosome 9 Contains the 5'
              end of the SMARCA2 gene for SWI/SNF related matrix
              associated actin dependent regulator of chromatin subfamily
              a member 2 (SNF2LA), a novel gene and two CpG islands,
              complete sequence
          Length = 138859

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 57     taattcctcagaaaccaaca 76
              ||||||||||||||||||||
Sbjct: 111156 taattcctcagaaaccaaca 111137
to top
>emb|AL353680.8| Human DNA sequence from clone RP11-252M21 on chromosome 13 Contains a
              novel FLJ31073 containing gene, six novel genes and a CpG
              island, complete sequence
          Length = 176930

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 430    tttcagtggaaatttgtttt 449
              ||||||||||||||||||||
Sbjct: 110634 tttcagtggaaatttgtttt 110653
to top
>emb|AL121974.16|HSJ417L20 Human DNA sequence from clone RP3-417L20 on chromosome 6p12-21.3
             Contains the 5' end of the gene for specific granule
             protein (28 kDa) (SGP28) and the PGK2 gene for
             phosphoglycerate kinase 2, parts of 2 novel genes,
             complete sequence
          Length = 90901

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 147   atatgctccagacattttgggaaa 170
             ||||||| ||||||||||||||||
Sbjct: 59002 atatgctacagacattttgggaaa 59025
to top
>emb|AL049694.9|HSDJ99E18 Human DNA sequence from clone RP1-99E18 on chromosome 6q25.1-26
             Contains part of the gene for a novel protein similar to
             C1-tetrahydrofolate synthases (contains DKFZP586G1517
             protein and FLJ21145, contains a tetrahydrofolate
             dehydrogenase/cyclohydrolase domain) and an
             ADP-riboslyation factor-like 4 (ARL4) pseudogene, complete
             sequence
          Length = 123296

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 623   acagaatttttgttttaatt 642
             ||||||||||||||||||||
Sbjct: 75163 acagaatttttgttttaatt 75182
to top
>emb|Y15173.1|HPVY15173 Human papillomavirus type 75 E6, E7, E1, E2, E4, L2, and L1 genes
          Length = 7537

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 309  ttcagttagatccacaggcc 328
            ||||||||||||||||||||
Sbjct: 7162 ttcagttagatccacaggcc 7143
to top
>emb|AL512585.12| Mouse DNA sequence from clone RP23-236A12 on chromosome 4, complete
             sequence
          Length = 217400

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 139   tcaagatgatatgctccaga 158
             ||||||||||||||||||||
Sbjct: 65797 tcaagatgatatgctccaga 65816
to top
>gb|AC125282.1| Homo sapiens chromosome 2 clone RP11-97B21, complete sequence
          Length = 150925

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 348   actatggaaatgatggtaggaaaa 371
             ||||||||||||||| ||||||||
Sbjct: 17827 actatggaaatgatgttaggaaaa 17804
to top
>emb|BX511256.9| Zebrafish DNA sequence from clone DKEY-58M10 in linkage group 1, complete
              sequence
          Length = 232496

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 628    atttttgttttaattcaaat 647
              ||||||||||||||||||||
Sbjct: 187885 atttttgttttaattcaaat 187904
to top
>gb|AC084758.3| Homo sapiens chromosome 15 clone RP11-348A14 map 15q21.1, complete
             sequence
          Length = 192074

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 70    accaacatttattgagagtgtact 93
             ||||||||||||||||||| ||||
Sbjct: 10809 accaacatttattgagagtttact 10786
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 221      taattactggatgaaatatt 240
                ||||||||||||||||||||
Sbjct: 15466165 taattactggatgaaatatt 15466146
to top
>gb|AC073964.3|AC073964 Homo sapiens chromosome 15 clone RP11-394B5 map 15q21.2, complete
             sequence
          Length = 189796

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 237   tattttgtctcatggttatg 256
             ||||||||||||||||||||
Sbjct: 62957 tattttgtctcatggttatg 62938
to top
>gb|AY593834.1| Foot-and-mouth disease virus O isolate orey-iran iso53, complete
            genome
          Length = 8198

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 645  aatcacctcctgtacgagtt 664
            ||||||||||||||||||||
Sbjct: 5316 aatcacctcctgtacgagtt 5297
to top
>gb|AY593800.1| Foot-and-mouth disease virus Asia 1 isolate asia1leb83 iso28,
            complete genome
          Length = 8196

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 645  aatcacctcctgtacgagtt 664
            ||||||||||||||||||||
Sbjct: 5311 aatcacctcctgtacgagtt 5292
to top
>gb|AY593799.1| Foot-and-mouth disease virus Asia 1 isolate asia1leb4 iso4, complete
            genome
          Length = 8196

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 645  aatcacctcctgtacgagtt 664
            ||||||||||||||||||||
Sbjct: 5311 aatcacctcctgtacgagtt 5292
to top
>gb|AY593798.1| Foot-and-mouth disease virus Asia 1 isolate asia1leb-89 iso89,
            complete genome
          Length = 8196

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 645  aatcacctcctgtacgagtt 664
            ||||||||||||||||||||
Sbjct: 5311 aatcacctcctgtacgagtt 5292
to top
>gb|AC023355.5|AC023355 Homo sapiens chromosome 15 clone RP11-154J22 map 15q21.1, complete
             sequence
          Length = 154738

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 70    accaacatttattgagagtgtact 93
             ||||||||||||||||||| ||||
Sbjct: 64472 accaacatttattgagagtttact 64449
to top
>gb|AC113607.3| Homo sapiens BAC clone RP11-97B21 from 2, complete sequence
          Length = 150925

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 348   actatggaaatgatggtaggaaaa 371
             ||||||||||||||| ||||||||
Sbjct: 17827 actatggaaatgatgttaggaaaa 17804
to top
>gb|AC073257.6| Homo sapiens BAC clone RP11-213H22 from 2, complete sequence
          Length = 120488

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   agacattttgggaaatgaag 175
             ||||||||||||||||||||
Sbjct: 89733 agacattttgggaaatgaag 89752
to top
>gb|AC116609.6| Homo sapiens BAC clone RP13-539J13 from 2, complete sequence
          Length = 131423

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 348   actatggaaatgatggtaggaaaa 371
             ||||||||||||||| ||||||||
Sbjct: 63603 actatggaaatgatgttaggaaaa 63580
to top
>dbj|AP005650.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0078K05
          Length = 162901

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 221    taattactggatgaaatatt 240
              ||||||||||||||||||||
Sbjct: 136947 taattactggatgaaatatt 136928
to top
>dbj|AP001312.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MYF5
          Length = 29176

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 629  tttttgttttaattcaaatcacct 652
            ||||||||||| ||||||||||||
Sbjct: 6152 tttttgttttatttcaaatcacct 6175
to top
>dbj|AB025611.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21B8
          Length = 50015

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 629   tttttgttttaattcaaatcacct 652
             ||||||||||| ||||||||||||
Sbjct: 42476 tttttgttttatttcaaatcacct 42453
to top
>ref|XM_312777.2| Anopheles gambiae str. PEST ENSANGP00000020334
           (ENSANGG00000017845), partial mRNA
          Length = 3660

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 229 ggatgaaatattttgtctca 248
           ||||||||||||||||||||
Sbjct: 21  ggatgaaatattttgtctca 40
to top
>emb|BX537270.4| Zebrafish DNA sequence from clone DKEY-278E24 in linkage group 4,
             complete sequence
          Length = 175518

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 627   aatttttgttttaattcaaa 646
             ||||||||||||||||||||
Sbjct: 91339 aatttttgttttaattcaaa 91358
to top
>emb|BX510652.6| Zebrafish DNA sequence from clone CH211-107N23 in linkage group 4,
             complete sequence
          Length = 165746

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 627   aatttttgttttaattcaaa 646
             ||||||||||||||||||||
Sbjct: 35359 aatttttgttttaattcaaa 35378
to top
>gb|AC076974.33| Mus musculus strain C57BL/6J chromosome 8 clone rp23-267j18, complete
             sequence
          Length = 211075

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 692   tgggaggctgacactgagca 711
             ||||||||||||||||||||
Sbjct: 24336 tgggaggctgacactgagca 24317
to top
>gb|AC126803.4| Mus musculus BAC clone RP24-549B23 from 3, complete sequence
          Length = 140864

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 139   tcaagatgatatgctccaga 158
             ||||||||||||||||||||
Sbjct: 76704 tcaagatgatatgctccaga 76685
to top
>gb|AC147562.5| Mus musculus BAC clone RP23-239A13 from 3, complete sequence
          Length = 167633

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 348    actatggaaatgatggtaggaaaa 371
              |||||| |||||||||||||||||
Sbjct: 145777 actatgtaaatgatggtaggaaaa 145800
to top
>emb|AL928966.3| Mouse DNA sequence from clone RP24-388A9 on chromosome 2, complete
              sequence
          Length = 173369

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 139    tcaagatgatatgctccaga 158
              ||||||||||||||||||||
Sbjct: 166237 tcaagatgatatgctccaga 166218
to top
>gb|M19149.1|HUMPGK2P Human phosphoglycerate kinase-2 retroposon promoter region
          Length = 1435

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 147 atatgctccagacattttgggaaa 170
           ||||||| ||||||||||||||||
Sbjct: 89  atatgctacagacattttgggaaa 66


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,284,788
Number of Sequences: 3902068
Number of extensions: 8284788
Number of successful extensions: 152517
Number of sequences better than 10.0: 56
Number of HSP's better than 10.0 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 152332
Number of HSP's gapped (non-prelim): 185
length of query: 712
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 689
effective length of database: 17,143,297,704
effective search space: 11811732118056
effective search space used: 11811732118056
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top