ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal6m22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009427.1| Triticum aestivum clone wlmk1.pk0030.f2:fis, full... 367 2e-98
2gb|AY108254.1| Zea mays PCO078069 mRNA sequence 44 0.32
3gb|AY363103.1|AY363102S2 Mus musculus diadenosine triphosphate h... 42 1.2
4gb|AC102431.7| Mus musculus chromosome 14, clone RP24-106J1, com... 42 1.2
5dbj|AK125860.1| Homo sapiens cDNA FLJ43872 fis, clone TESTI4008417 42 1.2
6gb|AC037459.16| Homo sapiens chromosome 8, clone RP11-582J16, co... 42 1.2
7gb|AC009257.3|AC009257 Drosophila melanogaster, chromosome 2R, r... 40 4.9
8gb|AE003460.2| Drosophila melanogaster chromosome 2R, section 68... 40 4.9

>gb|BT009427.1| Triticum aestivum clone wlmk1.pk0030.f2:fis, full insert mRNA
            sequence
          Length = 1973

 Score =  367 bits (185), Expect = 2e-98
 Identities = 271/299 (90%), Gaps = 5/299 (1%)
 Strand = Plus / Minus

                                                                        
Query: 77   caaaactatcgctgccatttcattggtaaatgatatggtggctgatctccaaaatttnat 136
            ||||||| |||||| |||||||||||||||||||||||||||||| ||||||||| | ||
Sbjct: 1973 caaaactttcgctgtcatttcattggtaaatgatatggtggctgacctccaaaatatcat 1914

                                                                        
Query: 137  acagatgtacatatggaa---tggagaacgaactacacatagggcttcgagcaatacagg 193
            ||||||||||| ||||||   ||||||||| |||||||||| |||||| |||||||||||
Sbjct: 1913 acagatgtacagatggaactatggagaacgtactacacatacggcttccagcaatacagg 1854

                                                                        
Query: 194  taaaggggtacgaccatggcctcccctgatgatccgatggtacatacatt--cagataaa 251
            ||||||| |||  |||||||||||||||| ||||| |||||||||  |||  ||||||||
Sbjct: 1853 taaagggttacagccatggcctcccctgacgatccaatggtacatggattttcagataaa 1794

                                                                        
Query: 252  ttnggaggcttgcaatagatcatggggcttcagaaggcactccatggtatgcaacagatg 311
             | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 1793 cttggaggcttgcaatagatcatggggcttccgaaggcactccatggtatgcaacagacg 1734

                                                                       
Query: 312  agtggtccgaagtggatggaacagcgttgtactgaccatatccagnatatacccccaca 370
            ||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||
Sbjct: 1733 agtggtccgaagtagatggaacagcgttgtactgaccatatccagcatatactcccaca 1675



to top

>gb|AY108254.1| Zea mays PCO078069 mRNA sequence
          Length = 1295

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                       
Query: 266 atagatcatggggcttcagaaggcactccatggtatgcaacagatgagtggtccgaagtg 325
           |||| ||||| |||||||||||| |  ||||||||  ||| ||  ||||| || ||  ||
Sbjct: 972 atagctcatgcggcttcagaaggaatgccatggtaaccaatagtagagtgttctgagctg 913

                                     
Query: 326 gatggaacagcgttgtactgaccata 351
           || |||||||| ||||||||||||||
Sbjct: 912 gaaggaacagcattgtactgaccata 887



to top

>gb|AY363103.1|AY363102S2 Mus musculus diadenosine triphosphate hydrolase (Fhit) gene, exons 6
              through 10 and partial cds
          Length = 688489

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 4      agctttaatcgtgacttccaagctt 28
              ||||||||| |||||||||||||||
Sbjct: 257974 agctttaatggtgacttccaagctt 257950



to top

>gb|AC102431.7| Mus musculus chromosome 14, clone RP24-106J1, complete sequence
          Length = 157923

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 4     agctttaatcgtgacttccaagctt 28
             ||||||||| |||||||||||||||
Sbjct: 53051 agctttaatggtgacttccaagctt 53075



to top

>dbj|AK125860.1| Homo sapiens cDNA FLJ43872 fis, clone TESTI4008417
          Length = 4078

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 109 atatggtggctgatctccaaaattt 133
           ||||||| |||||||||||||||||
Sbjct: 579 atatggtagctgatctccaaaattt 555



to top

>gb|AC037459.16| Homo sapiens chromosome 8, clone RP11-582J16, complete sequence
          Length = 174888

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 109   atatggtggctgatctccaaaattt 133
             ||||||| |||||||||||||||||
Sbjct: 65144 atatggtagctgatctccaaaattt 65168



to top

>gb|AC009257.3|AC009257 Drosophila melanogaster, chromosome 2R, region 59D-59E, BAC clone
             BACR25I01, complete sequence
          Length = 218565

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 76    acaaaactatcgctgccatt 95
             ||||||||||||||||||||
Sbjct: 76644 acaaaactatcgctgccatt 76625



to top

>gb|AE003460.2| Drosophila melanogaster chromosome 2R, section 68 of 73 of the complete
              sequence
          Length = 299331

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 76     acaaaactatcgctgccatt 95
              ||||||||||||||||||||
Sbjct: 264761 acaaaactatcgctgccatt 264742


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,415,867
Number of Sequences: 3902068
Number of extensions: 2415867
Number of successful extensions: 43508
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43485
Number of HSP's gapped (non-prelim): 20
length of query: 370
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 348
effective length of database: 17,147,199,772
effective search space: 5967225520656
effective search space used: 5967225520656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top