>emb|AL606804.11| Human DNA sequence from clone RP11-978I15 on chromosome 1 Contains
the 3' end of the CIAS1 gene for cold autoinflammatory
syndrome 1, the gene for a novel 7 transmembrane receptor
(rhodopsin family) protein, a 7 transmembrane receptor
(rhodopsin family) pseudogene, two novel genes
(LOC148823, LOC148824), the OR2C3 gene for olfactory
receptor family 2 subfamily C member 3, the 3' end of a
novel gene, the OR2G2 for olfactory receptor family 2
subfamily G member 2, the OR2G3 for olfactory receptor
family 2 subfamily G member 3, the gene for a novel
protein similar to Olfactory receptor 5AV1 (LOC127617)
and three CpG islands, complete sequence
Length = 185467
Score = 42.1 bits (21), Expect = 2.3
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 370 gacagagtttgcaacagaatg 390
|||||||||||||||||||||
Sbjct: 7670 gacagagtttgcaacagaatg 7650
>emb|AL627402.10| Human DNA sequence from clone RP11-204C16 on chromosome X Contains part
of the CASK gene for calcium/calmodulin-dependent serine
protein kinase (MAGUK family), the GPR34 gene for G
protein-coupled receptor 34, the GPR82 gene for G
protein-coupled receptor 82, a tyrosine
3-monooxygenase/tryptophan 5-monooxygenase activation
protein, zeta polypeptide (YWHAZ) pseudogene and a CpG
island, complete sequence
Length = 132290
Score = 42.1 bits (21), Expect = 2.3
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 304 ggcatttataggtgaaattgg 324
|||||||||||||||||||||
Sbjct: 108665 ggcatttataggtgaaattgg 108645
>emb|Z85986.1|HS108K11 Human DNA sequence from clone RP1-108K11 on chromosome 6p21 Contains the
SFRS3 for splicing factor arginine/serine-rich (SRP20), the
STK38 gene for serine/threonine protein kinase (NDR), the
3' end of a gene for a novel protein (2410004NRIK) and a
CpG island, complete sequence
Length = 145616
Score = 40.1 bits (20), Expect = 8.9
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 634 aagtttcttgctgaaaacat 653
||||||||||||||||||||
Sbjct: 141536 aagtttcttgctgaaaacat 141555
>emb|BX664615.10| Human DNA sequence from clone RP11-104G3 on chromosome 9 Contains a
RAB28, member RAS oncogene family pseudogene (RAB28), a
pseudogene similar to part of recombining binding protein
suppressor of hairless (Drosophila) (RBPSUH), two novel
pseudogenes, a pseudogene similar to part of fibroblast
growth factor 7 (keratinocyte growth factor) (FGF7), the 3'
end of a novel gene and two CpG islands, complete sequence
Length = 163837
Score = 40.1 bits (20), Expect = 8.9
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 613 agtttcctctttgtcagcaa 632
||||||||||||||||||||
Sbjct: 139547 agtttcctctttgtcagcaa 139566
>emb|CR769767.5| Human DNA sequence from clone RP11-204M4 on chromosome 9 Contains the
5' end of a novel gene, a novel pseudogene and a
pseudogene similar to part of ribosomal protein L10
(RPL10), complete sequence
Length = 153630
Score = 40.1 bits (20), Expect = 8.9
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 613 agtttcctctttgtcagcaa 632
||||||||||||||||||||
Sbjct: 17560 agtttcctctttgtcagcaa 17579
>emb|AL512598.11| Human DNA sequence from clone RP11-165A20 on chromosome 10 Contains the
5' end of the gene for HHGP protein (HHGP) (FLJ11888), the
gene for a novel protein similar to secreted
frizzled-related protein 4 SFRP4 (FLJ37702), the gene for
a novel protein similar to threonine synthase, containing
FLJ2202 and FLJ37043 and two CpG islands, complete
sequence
Length = 139491
Score = 40.1 bits (20), Expect = 8.9
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 178 tgatcctgatccttctgaacctaa 201
||||| ||||||||||||||||||
Sbjct: 22109 tgatcatgatccttctgaacctaa 22132
>emb|AL391099.12| Human DNA sequence from clone RP11-178A10 on chromosome 10 Contains a
novel gene (FLJ34785 FLJ33470), a novel gene and a CpG
island, complete sequence
Length = 123083
Score = 40.1 bits (20), Expect = 8.9
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 62 tcagaaaaatcttctagaca 81
||||||||||||||||||||
Sbjct: 59881 tcagaaaaatcttctagaca 59900
>emb|AL354713.7| Human DNA sequence from clone RP11-498A13 on chromosome 1 Contains a
processed pseudogene for nuclear receptor binding factor 2
(NRBF2), a processed pseudogene similar to part of
olfactory receptor, family 11, subfamily H, member 6
(OR11H6) and the 5' end of the CD53 gene for CD53 antigen,
complete sequence
Length = 138370
Score = 40.1 bits (20), Expect = 8.9
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 60 cttcagaaaaatcttctagacaag 83
|||||||||||| |||||||||||
Sbjct: 14492 cttcagaaaaatattctagacaag 14515
>emb|AL136374.4| Human DNA sequence from clone RP1-244G5 on chromosome 1q24.3-25.3,
complete sequence
Length = 119853
Score = 40.1 bits (20), Expect = 8.9
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 60 cttcagaaaaatcttctagacaag 83
|||||||||||| |||||||||||
Sbjct: 50432 cttcagaaaaatattctagacaag 50455
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,790,336
Number of Sequences: 3902068
Number of extensions: 6790336
Number of successful extensions: 131661
Number of sequences better than 10.0: 50
Number of HSP's better than 10.0 without gapping: 50
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 131353
Number of HSP's gapped (non-prelim): 306
length of query: 654
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 631
effective length of database: 17,143,297,704
effective search space: 10817420851224
effective search space used: 10817420851224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)