>gb|AF216582.1|AF216582 Avena sativa fructose 1,6-bisphosphate aldolase precursor, mRNA,
            complete cds; nuclear gene for chloroplast product
          Length = 1577

 Score = 97.6 bits (49), Expect = 7e-18
 Identities = 54/56 (96%)
 Strand = Plus / Minus

                                                                    
Query: 2    gacacactggctggctaaggtgccctcaagctgctcaaggcgctactagcnctctc 57
            ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1356 gacacactgcctggctaaggtgccctcaagctgctcaaggcgctactagcactctc 1301

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 22      tgccctcaagctgctcaagg 41
               ||||||||||||||||||||
Sbjct: 2164719 tgccctcaagctgctcaagg 2164738

>ref|XM_865473.1| PREDICTED: Bos taurus similar to zinc finger and BTB domain
           containing 36 (LOC614110), mRNA
          Length = 1938

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 8   ctggctggctaaggtgccc 26
           |||||||||||||||||||
Sbjct: 226 ctggctggctaaggtgccc 208

>gb|AC074257.5| Homo sapiens BAC clone RP11-796I2 from 7, complete sequence
          Length = 186047

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     actggctggctaaggtgcc 25
             |||||||||||||||||||
Sbjct: 29128 actggctggctaaggtgcc 29146

>gb|AC093583.3| Homo sapiens BAC clone RP13-452N2 from 7, complete sequence
          Length = 178471

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     actggctggctaaggtgcc 25
             |||||||||||||||||||
Sbjct: 75769 actggctggctaaggtgcc 75787

>gb|AC164087.5| Mus musculus BAC clone RP23-408K7 from chromosome 9, complete sequence
          Length = 211783

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 2      gacacactggctggctaag 20
              |||||||||||||||||||
Sbjct: 199117 gacacactggctggctaag 199099

>emb|AJ242630.1|MSP242630 Methylobacterium dichloromethanicum polA gene for DNA polymerase I,
            strain DM4
          Length = 4500

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 23   gccctcaagctgctcaaggcgct 45
            |||||||||||||||||| ||||
Sbjct: 2669 gccctcaagctgctcaagccgct 2691

>emb|AJ721067.1| Gallus gallus mRNA for hypothetical protein, clone 33p3
          Length = 997

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  tcaagctgctcaaggcgct 45
           |||||||||||||||||||
Sbjct: 439 tcaagctgctcaaggcgct 421

>ref|NM_001039313.1| Gallus gallus clathrin, light polypeptide (Lca) (CLTA), mRNA
          Length = 997

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  tcaagctgctcaaggcgct 45
           |||||||||||||||||||
Sbjct: 439 tcaagctgctcaaggcgct 421

>gb|AC154434.2| Mus musculus BAC clone RP24-185H5 from chromosome 9, complete sequence
          Length = 192358

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      gacacactggctggctaag 20
              |||||||||||||||||||
Sbjct: 104335 gacacactggctggctaag 104353

>gb|L39976.1|BWYCP9A Beet western yellows luteovirus (strain bwyv-1, isolate 9) coat
           protein RNA, complete cds
          Length = 1052

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 392 taggtagattatgtagata 374

>gb|L39975.1|BWYCP8A Beet western yellows luteovirus (strain bwyv-1, isolate 8) coat
           protein RNA, complete cds
          Length = 877

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 216 taggtagattatgtagata 198

>gb|L39974.1|BWYCP7A Beet western yellows luteovirus (strain bwyv-1, isolate 7) coat
           protein RNA, complete cds
          Length = 877

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 216 taggtagattatgtagata 198

>gb|L39973.1|BWYCP6A Beet western yellows luteovirus (strain bwyv-1, isolate 6) coat
           protein RNA, complete cds
          Length = 877

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 216 taggtagattatgtagata 198

>gb|L39986.1|BWYCP5A Beet western yellows luteovirus (strain bwyv-1, isolate 5) coat
           protein RNA, complete cds
          Length = 877

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 216 taggtagattatgtagata 198

>gb|L39972.1|BWYCP4B Beet western yellows luteovirus (strain bwyv-1, isolate 4b) coat
           protein RNA fragment
          Length = 219

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 188 taggtagattatgtagata 170

>gb|L39971.1|BWYCP4A Beet western yellows luteovirus (strain bwyv-1, isolate 4a) coat
           protein RNA, complete cds
          Length = 1053

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 392 taggtagattatgtagata 374

>gb|L39982.1|BWYCP31A Beet western yellows luteovirus (strain bwyv-1, isolate 31) coat
           protein RNA fragment
          Length = 220

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 189 taggtagattatgtagata 171

>gb|L39981.1|BWYCP15A Beet western yellows luteovirus (strain bwyv-1, isolate 15) coat
           protein RNA, complete cds
          Length = 1168

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 507 taggtagattatgtagata 489

>gb|L39979.1|BWYCP14A Beet western yellows luteovirus (strain bwyv-1, isolate 14) coat
           protein RNA, complete cds
          Length = 878

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 217 taggtagattatgtagata 199

>gb|L39980.1|BWYCP13A Beet western yellows luteovirus (strain bwyv-1, isolate 13) coat
           protein RNA, complete cds
          Length = 878

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 217 taggtagattatgtagata 199

>gb|L39978.1|BWYCP12B Beet western yellows luteovirus (strain bwyv-1, isolate 12b) coat
           protein RNA, 5' end
          Length = 631

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 217 taggtagattatgtagata 199

>gb|L39977.1|BWYCP12A Beet western yellows luteovirus (strain bwyv-1, isolate 12a) coat
           protein RNA, complete cds
          Length = 1167

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 506 taggtagattatgtagata 488

>gb|L39987.1|BWYCP11A Beet western yellows luteovirus (strain bwyv-1, isolate 11) coat
           protein RNA, 5' end
          Length = 512

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 217 taggtagattatgtagata 199

>gb|L40017.1|BWYCOATI Beet western yellows virus coat protein
          Length = 878

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 217 taggtagattatgtagata 199

>gb|L40016.1|BWYCOATH Beet western yellows virus coat protein
          Length = 878

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 217 taggtagattatgtagata 199

>gb|L40015.1|BWYCOATG Beet western yellows virus coat protein
          Length = 878

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 217 taggtagattatgtagata 199

>gb|L40014.1|BWYCOATF Beet western yellows virus coat protein
          Length = 878

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 217 taggtagattatgtagata 199

>gb|L40013.1|BWYCOATE Beet western yellows virus coat protein
          Length = 878

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 217 taggtagattatgtagata 199

>gb|L40012.1|BWYCOATD Beet western yellows virus coat protein
          Length = 877

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 216 taggtagattatgtagata 198

>gb|L40011.1|BWYCOATC Beet western yellows virus coat protein
          Length = 878

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  taggtagattatgtagata 82
           |||||||||||||||||||
Sbjct: 217 taggtagattatgtagata 199


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 438,490
Number of Sequences: 3902068
Number of extensions: 438490
Number of successful extensions: 30652
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30584
Number of HSP's gapped (non-prelim): 68
length of query: 117
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 96
effective length of database: 17,151,101,840
effective search space: 1646505776640
effective search space used: 1646505776640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)