>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 216     tgctcagtgctcactaaccttg 237
               ||||||||||||||||||||||
Sbjct: 7484795 tgctcagtgctcactaaccttg 7484816

>gb|AC136136.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBb0071C04, from chromosome 3, complete sequence
          Length = 126078

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 216    tgctcagtgctcactaaccttg 237
              ||||||||||||||||||||||
Sbjct: 123350 tgctcagtgctcactaaccttg 123371

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 216     tgctcagtgctcactaaccttg 237
               ||||||||||||||||||||||
Sbjct: 7482630 tgctcagtgctcactaaccttg 7482651

>gb|AC134239.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0042A11, complete sequence
          Length = 113049

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 216   tgctcagtgctcactaaccttg 237
             ||||||||||||||||||||||
Sbjct: 13691 tgctcagtgctcactaaccttg 13712

>emb|AL772312.6| Mouse DNA sequence from clone RP23-91D16 on chromosome 4, complete
             sequence
          Length = 183630

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 109   acaaactaaagtacacactaacagatca 136
             ||||||||||| ||||||| ||||||||
Sbjct: 19181 acaaactaaagaacacactcacagatca 19154


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,967,135
Number of Sequences: 3902068
Number of extensions: 1967135
Number of successful extensions: 37762
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37707
Number of HSP's gapped (non-prelim): 55
length of query: 238
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 216
effective length of database: 17,147,199,772
effective search space: 3703795150752
effective search space used: 3703795150752
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)