>emb|BX571952.13| Zebrafish DNA sequence from clone DKEY-35E8 in linkage group 11, complete
              sequence
          Length = 175925

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 79     gatttatgacatgttttgttg 99
              |||||||||||||||||||||
Sbjct: 115906 gatttatgacatgttttgttg 115886

>emb|BX936464.7| Zebrafish DNA sequence from clone DKEY-246O4 in linkage group 18,
             complete sequence
          Length = 167114

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 79    gatttatgacatgttttgttg 99
             |||||||||||||||||||||
Sbjct: 59935 gatttatgacatgttttgttg 59955

>emb|BX004819.11| Zebrafish DNA sequence from clone CH211-208B16 in linkage group 8,
              complete sequence
          Length = 234864

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 79     gatttatgacatgttttgttg 99
              |||||||||||||||||||||
Sbjct: 213157 gatttatgacatgttttgttg 213177

>ref|NM_111058.3| Arabidopsis thaliana unknown protein AT3G01920 mRNA, complete cds
          Length = 1672

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 ttgactgcaagcaaggaact 289
           ||||||||||||||||||||
Sbjct: 540 ttgactgcaagcaaggaact 559

>gb|AC004227.1| Homo sapiens chromosome 5, P1 clone 356a8 (LBNL H32), complete
            sequence
          Length = 72941

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 31   ccaacattgtgaaagtgcatctct 54
            |||||||||||||||| |||||||
Sbjct: 6171 ccaacattgtgaaagtccatctct 6148

>gb|AC144706.2| Danio rerio clone CH211-164M18, complete sequence
          Length = 149960

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    gatttatgacatgttttgttgcca 102
             ||||||||||| ||||||||||||
Sbjct: 80278 gatttatgacaagttttgttgcca 80301

>gb|AC011664.10|ATAC011664 Arabidopsis thaliana chromosome III BAC F1C9 genomic sequence, complete
             sequence
          Length = 103960

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 270   ttgactgcaagcaaggaact 289
             ||||||||||||||||||||
Sbjct: 90983 ttgactgcaagcaaggaact 90964

>gb|AC010797.4|ATAC010797 Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence,
             complete sequence
          Length = 89154

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 270   ttgactgcaagcaaggaact 289
             ||||||||||||||||||||
Sbjct: 63051 ttgactgcaagcaaggaact 63070

>emb|AL772400.3| Human DNA sequence from clone RP11-540N4 on chromosome X Contains the
             3' end of the PRPS1 gene for phosphoribosyl pyrophosphate
             synthetase 1 (PRSI), complete sequence
          Length = 74714

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 31    ccaacattgtgaaagtgcatctct 54
             |||||||||||||| |||||||||
Sbjct: 66095 ccaacattgtgaaactgcatctct 66072

>emb|AL590708.18| Human DNA sequence from clone RP11-395P17 on chromosome 9 Contains the
             PCSCL gene for likely ortholog of rat peroxisomal
             Ca-dependent solute carrier-like protein (KIAA1896), the
             PTGES2 gene for prostaglandin E synthase 2 (GBF1, GBF-1,
             C9orf15, FLJ14038), the LCN2 gene for lipocalin 2
             (oncogene 24p3) (NGAL), the C9orf16 gene for chromosome 9
             open reading frame 16 (MGC4639, EST00098, FLJ12823), the
             CIZ1 gene for Cip1-interacting zinc finger protein
             (LSFR1), the DNM1 gene for dynamin 1 (DNM), the GOLGA2
             gene for golgi autoantigen, golgin subfamily a, 2 (GM130,
             MGC20672), the gene for a novel protein and seven CpG
             islands, complete sequence
          Length = 194056

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 31    ccaacattgtgaaagtgcatctct 54
             ||||||| ||||||||||||||||
Sbjct: 44396 ccaacatggtgaaagtgcatctct 44419

>gb|AY143853.1| Arabidopsis thaliana At3g1920/F28J7.25 mRNA, complete cds
          Length = 924

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 ttgactgcaagcaaggaact 289
           ||||||||||||||||||||
Sbjct: 523 ttgactgcaagcaaggaact 542

>emb|AL121782.9|HSJ585I14 Human DNA sequence from clone RP4-585I14 on chromosome 20 Contains the
             3' end of the C20orf13 gene for chromosome 20 open reading
             frame 13 and the GAPDP2 gene for
             glyceraldehyde-3-phosphate dehydrogenase pseudogene 2,
             complete sequence
          Length = 144781

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   actccacatcacttggtctt 306
             ||||||||||||||||||||
Sbjct: 74781 actccacatcacttggtctt 74762

>emb|AL928938.3| Zebrafish DNA sequence from clone BUSM1-64D20 in linkage group 12
             Contains the zebrafish nog3 gene for noggin 3, two novel
             genes for protein with a type I
             phosphodiesterase/nucleotide pyrophosphatase domain and a
             CpG island, complete sequence
          Length = 96976

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    gatttatgacatgttttgttgcca 102
             ||||||||||| ||||||||||||
Sbjct: 96611 gatttatgacaagttttgttgcca 96634

>gb|DQ077554.1| Uncultured bacterium MedeBAC49C08 clone MedeBAC49C08, partial sequence
          Length = 67716

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cagcttccaacattgtgaaa 44
             ||||||||||||||||||||
Sbjct: 40711 cagcttccaacattgtgaaa 40730

>gb|AY079025.1| Arabidopsis thaliana At3g1920/F28J7.25 mRNA, complete cds
          Length = 1049

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 ttgactgcaagcaaggaact 289
           ||||||||||||||||||||
Sbjct: 528 ttgactgcaagcaaggaact 547

>gb|AC147286.3| Pan troglodytes BAC clone RP43-75F15 from chromosome 7, complete
             sequence
          Length = 167461

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 259   ctctggtgatattgactgcaagca 282
             ||||||||||||| ||||||||||
Sbjct: 66593 ctctggtgatatttactgcaagca 66616

>gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete genome
          Length = 1308759

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 80      atttatgacatgttttgttg 99
               ||||||||||||||||||||
Sbjct: 1176573 atttatgacatgttttgttg 1176554

>emb|BX511178.6| Zebrafish DNA sequence from clone DKEY-221H15 in linkage group 20,
              complete sequence
          Length = 187362

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 76     gacgatttatgacatgttttgttg 99
              |||||||||||||| |||||||||
Sbjct: 136024 gacgatttatgacaagttttgttg 136001

>emb|BX470069.10| Zebrafish DNA sequence from clone RP71-22K7 in linkage group 12,
             complete sequence
          Length = 169641

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    gatttatgacatgttttgttgcca 102
             ||||||||||| ||||||||||||
Sbjct: 60061 gatttatgacaagttttgttgcca 60084

>emb|AL935268.6| Zebrafish DNA sequence from clone CH211-199H23 in linkage group 12,
             complete sequence
          Length = 206438

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    gatttatgacatgttttgttgcca 102
             ||||||||||| ||||||||||||
Sbjct: 89116 gatttatgacaagttttgttgcca 89139

>gb|AC134445.3| Mus musculus BAC clone RP24-170M15 from 6, complete sequence
          Length = 165568

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 28    cttccaacattgtgaaagtg 47
             ||||||||||||||||||||
Sbjct: 27363 cttccaacattgtgaaagtg 27382

>gb|AC133599.3| Mus musculus BAC clone RP24-390N10 from 6, complete sequence
          Length = 185830

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 28   cttccaacattgtgaaagtg 47
            ||||||||||||||||||||
Sbjct: 4309 cttccaacattgtgaaagtg 4290

>gb|L77060.1|HUM32DC97Z Homo sapiens (subclone 2_b2 from P1 H32) DNA sequence
          Length = 4573

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 31   ccaacattgtgaaagtgcatctct 54
            |||||||||||||||| |||||||
Sbjct: 2317 ccaacattgtgaaagtccatctct 2294


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,608,602
Number of Sequences: 3902068
Number of extensions: 2608602
Number of successful extensions: 107596
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 107549
Number of HSP's gapped (non-prelim): 47
length of query: 309
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 287
effective length of database: 17,147,199,772
effective search space: 4921246334564
effective search space used: 4921246334564
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)