| Clone Name | rbaal14g24 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AY813878.1| Schistosoma japonicum SJCHGC09037 protein mRNA, c... | 44 | 0.22 | 2 | gb|AC092576.3| Homo sapiens BAC clone RP11-7N16 from 2, complete... | 42 | 0.85 | 3 | gb|AC161579.4| Mus musculus chromosome 19, clone RP23-298M4, com... | 40 | 3.4 | 4 | gb|DP000025.1| Gorilla gorilla gorilla target 1 genomic scaffold | 40 | 3.4 |
|---|
>gb|AY813878.1| Schistosoma japonicum SJCHGC09037 protein mRNA, complete cds Length = 1019 Score = 44.1 bits (22), Expect = 0.22 Identities = 22/22 (100%) Strand = Plus / Plus Query: 132 aaacgagcacatgcagaaaaag 153 |||||||||||||||||||||| Sbjct: 80 aaacgagcacatgcagaaaaag 101
>gb|AC092576.3| Homo sapiens BAC clone RP11-7N16 from 2, complete sequence Length = 152747 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Plus Query: 144 gcagaaaaaggcagcaaaatc 164 ||||||||||||||||||||| Sbjct: 97590 gcagaaaaaggcagcaaaatc 97610
>gb|AC161579.4| Mus musculus chromosome 19, clone RP23-298M4, complete sequence Length = 188366 Score = 40.1 bits (20), Expect = 3.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 aaatcttccgagtaggttcccctt 183 ||||||||| |||||||||||||| Sbjct: 19859 aaatcttcccagtaggttcccctt 19882
>gb|DP000025.1| Gorilla gorilla gorilla target 1 genomic scaffold Length = 1787293 Score = 40.1 bits (20), Expect = 3.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 gagcacatgcagaaaaaggcagca 159 |||||||||||||||||| ||||| Sbjct: 5862 gagcacatgcagaaaaagacagca 5839 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,579,895 Number of Sequences: 3902068 Number of extensions: 1579895 Number of successful extensions: 29331 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 29324 Number of HSP's gapped (non-prelim): 7 length of query: 260 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 238 effective length of database: 17,147,199,772 effective search space: 4081033545736 effective search space used: 4081033545736 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)