Clone Name	rbaal13p11
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY123422.1| Triticum aestivum putative Rieske Fe-S precursor ...	1215	0.0
2	dbj|AK071634.1| Oryza sativa (japonica cultivar-group) cDNA clon...	561	e-156
3	gb|AF093631.1|AF093631 Oryza sativa Rieske Fe-S precursor protei...	561	e-156
4	gb|BT016255.1| Zea mays clone Contig88 mRNA sequence	549	e-153
5	gb|AY104934.1| Zea mays PCO071754 mRNA sequence	549	e-153
6	emb|AJ222783.1|HVJ222783 Hordeum vulgare mRNA for cytochrome b6/...	537	e-149
7	gb|AY581830.1| Cynodon dactylon putative Rieske Fe-S precursor p...	315	1e-82
8	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	194	3e-46
9	dbj|AP005125.3| Oryza sativa (japonica cultivar-group) genomic D...	194	3e-46
10	gb|DQ427777.1| Sorghum propinquum locus HHU30 genomic sequence	123	9e-25
11	gb|DQ427776.1| Sorghum bicolor voucher PI585454 locus HHU30 geno...	123	9e-25
12	gb|DQ427775.1| Sorghum bicolor voucher PI267539 locus HHU30 geno...	123	9e-25
13	gb|DQ427774.1| Sorghum bicolor voucher PI267408 locus HHU30 geno...	123	9e-25
14	gb|DQ427773.1| Sorghum bicolor voucher PI221607 locus HHU30 geno...	123	9e-25
15	gb|DQ427772.1| Sorghum bicolor voucher PI152702 locus HHU30 geno...	123	9e-25
16	gb|DQ427771.1| Sorghum bicolor voucher NSL92371 locus HHU30 geno...	123	9e-25
17	gb|DQ427770.1| Sorghum bicolor voucher NSL87902 locus HHU30 geno...	123	9e-25
18	gb|DQ427769.1| Sorghum bicolor voucher NSL87666 locus HHU30 geno...	123	9e-25
19	gb|DQ427768.1| Sorghum bicolor voucher NSL77217 locus HHU30 geno...	123	9e-25
20	gb|DQ427767.1| Sorghum bicolor voucher NSL77034 locus HHU30 geno...	123	9e-25
21	gb|DQ427766.1| Sorghum bicolor voucher NSL56174 locus HHU30 geno...	123	9e-25
22	gb|DQ427765.1| Sorghum bicolor voucher NSL56003 locus HHU30 geno...	123	9e-25
23	gb|DQ427764.1| Sorghum bicolor voucher NSL55243 locus HHU30 geno...	123	9e-25
24	gb|DQ427763.1| Sorghum bicolor voucher NSL51365 locus HHU30 geno...	123	9e-25
25	gb|DQ427762.1| Sorghum bicolor voucher NSL51030 locus HHU30 geno...	123	9e-25
26	gb|DQ427761.1| Sorghum bicolor voucher NSL50875 locus HHU30 geno...	123	9e-25
27	gb|DQ427760.1| Sorghum bicolor voucher BTx623 locus HHU30 genomi...	123	9e-25
28	gb|DQ122916.1| Chlamydomonas incerta chloroplast cytochrome B6/F...	90	1e-14
29	dbj|D32003.1| Chlamydomonas reinhardtii mRNA for chloroplast Rie...	90	1e-14
30	emb|AL731601.3|OSJN00245 Oryza sativa genomic DNA, chromosome 4,...	88	5e-14
31	gb|DQ384526.1| Panax ginseng clone PG6L-3 photosynthetic electro...	88	5e-14
32	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	88	5e-14
33	ref|NM_193963.1| Oryza sativa (japonica cultivar-group), predic...	82	3e-12
34	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	82	3e-12
35	gb|AY826845.1| Pavlova lutheri clone PLCB61 chloroplast cytochro...	82	3e-12
36	dbj|AP002870.1| Oryza sativa (japonica cultivar-group) genomic D...	82	3e-12
37	gb|AY300039.1| Solanum tuberosum putative Rieske Fe-S protein pr...	80	1e-11
38	gb|AC122543.1| Genomic sequence for Brassica oleracea, clone B21...	80	1e-11
39	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	80	1e-11
40	dbj|AP004875.3| Oryza sativa (japonica cultivar-group) genomic D...	80	1e-11
41	dbj|AP006844.2| Oryza sativa (japonica cultivar-group) genomic D...	80	1e-11
42	gb|AF037456.1|AF037456 Fritillaria agrestis cytochrome B6-F comp...	78	5e-11
43	ref|NM_116566.3| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECT...	76	2e-10
44	ref|NM_178964.1| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECT...	76	2e-10
45	gb|AC005275.1| Arabidopsis thaliana BAC F4C21 from chromosome IV...	76	2e-10
46	emb|AL161496.2|ATCHRIV8 Arabidopsis thaliana DNA chromosome 4, c...	76	2e-10
47	emb|AJ292972.1|ATH292972 Arabidopsis thaliana petC gene for Ries...	76	2e-10
48	emb|AJ243702.1|ATH243702 Arabidopsis thaliana mRNA for rieske ir...	76	2e-10
49	gb|AY093726.1| Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, com...	76	2e-10
50	gb|AF410296.1|AF410296 Arabidopsis thaliana AT4g03280/F4C21_21 m...	76	2e-10
51	gb|AF370566.1|AF370566 Arabidopsis thaliana putative component o...	76	2e-10
52	emb|BX827560.1|CNS0A2RQ Arabidopsis thaliana Full-length cDNA Co...	76	2e-10
53	emb|AJ784852.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur...	74	7e-10
54	dbj|AB025003.1| Cicer arietinum mRNA for plastoquinol-plastocyan...	74	7e-10
55	gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome...	70	1e-08
56	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	70	1e-08
57	dbj|AU066527.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro...	64	7e-07
58	emb|BX826362.1|CNS0A4FZ Arabidopsis thaliana Full-length cDNA Co...	60	1e-05
59	emb|X63605.1|PSPETC P.sativum petC mRNA for chloroplast Rieske F...	58	4e-05
60	gb|AY826843.1| Heterocapsa triquetra clone HTCB61 chloroplast cy...	54	7e-04
61	emb|AJ784853.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur...	52	0.003
62	emb|BX826457.1|CNS0A4G1 Arabidopsis thaliana Full-length cDNA Co...	52	0.003
63	emb|BX826302.1|CNS0A381 Arabidopsis thaliana Full-length cDNA Co...	52	0.003
64	emb|X06244.1|SORFES Spinach mRNA for Rieske FeS-precursor protein	52	0.003
65	gb|AF110783.1|AF110783 Volvox carteri f. nagariensis clone G9 ri...	50	0.010
66	gb|AY267656.1| Bigelowiella natans Fe-S subunit of cytochrome c6...	48	0.041
67	emb|X76299.1|CRPETC C.reinhardtii petC gene	48	0.041
68	emb|X66009.1|NTRFES1 N.tabacum mRNA for chloroplast Rieske FeS p...	46	0.16
69	emb|X64353.1|NTRFSCBFC N.tabacum mRNA for Rieske Fe/S protein of...	46	0.16
70	emb|BX572099.1| Prochlorococcus marinus MIT9313 complete genome;...	46	0.16
71	emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segmen...	46	0.16
72	gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence	44	0.64
73	dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g...	44	0.64
74	gb|AY826844.1| Isochrysis galbana clone ISCB61 chloroplast cytoc...	44	0.64
75	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	44	0.64
76	gb|AY487229.1| Mycobacterium fortuitum PgaE gene, partial cds; p...	44	0.64
77	gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome	44	0.64
78	dbj|AB070940.1| Streptomyces avermitilis oligomycin biosynthetic...	44	0.64
79	gb|AC093100.2| Drosophila melanogaster clone BACR05J04, complete...	42	2.5
80	gb|AC090377.15| Homo sapiens chromosome 18, clone RP11-866E20, c...	42	2.5
81	gb|AC107990.5| Homo sapiens chromosome 18, clone RP11-103A19, co...	42	2.5
82	ref|NM_135169.2| Drosophila melanogaster Pez CG9493-RA (Pez), mRNA	42	2.5
83	gb|AF217284.1|AF217284 Drosophila melanogaster protein tyrosine ...	42	2.5
84	gb|AE003613.4| Drosophila melanogaster chromosome 2L, section 22...	42	2.5
85	gb|AC005285.1|AC005285 Drosophila melanogaster DNA sequence (P1s...	42	2.5
86	ref|XM_529565.1| PREDICTED: Pan troglodytes LOC452570 (LOC452570...	40	9.9
87	ref|NM_018094.2| Homo sapiens G1 to S phase transition 2 (GSPT2)...	40	9.9
88	gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, co...	40	9.9
89	gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome	40	9.9
90	ref|XM_659574.1| Aspergillus nidulans FGSC A4 hypothetical prote...	40	9.9
91	gb|AC148476.4| Homo sapiens 12 BAC RP13-714J12 (Roswell Park Can...	40	9.9
92	ref|XM_754954.1| Ustilago maydis 521 hypothetical protein (UM039...	40	9.9
93	gb|AC124358.4| Mus musculus BAC clone RP24-491B24 from chromosom...	40	9.9
94	gb|AC125332.3| Mus musculus BAC clone RP23-113I20 from 3, comple...	40	9.9
95	gb|AC121928.2| Mus musculus BAC clone RP24-204F1 from 3, complet...	40	9.9
96	emb|AL929101.4| Human DNA sequence from clone RP11-22B10 on chro...	40	9.9
97	emb|AL662824.9| Human DNA sequence from clone XXbac-22I16 on chr...	40	9.9
98	emb|AL645931.7| Human DNA sequence from clone XXbac-138A21 on ch...	40	9.9
99	ref|XM_783177.1| PREDICTED: Strongylocentrotus purpuratus simila...	40	9.9
100	gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 ma...	40	9.9
101	gb|CP000088.1| Thermobifida fusca YX, complete genome	40	9.9
102	gb|BC036077.1| Homo sapiens G1 to S phase transition 2, mRNA (cD...	40	9.9
103	emb|AJ251548.1|HSA251548 Homo sapiens mRNA for polypeptide chain...	40	9.9
104	emb|CR759795.4| Human DNA sequence from clone DAMC-206D4 on chro...	40	9.9
105	emb|AL133055.1|HSM801326 Homo sapiens mRNA; cDNA DKFZp434J1015 (...	40	9.9
106	emb|CR861342.1| Pongo pygmaeus mRNA; cDNA DKFZp459J1511 (from cl...	40	9.9
107	gb|AC087892.16| Homo sapiens 12q BAC RP11-3L23 (Roswell Park Can...	40	9.9
108	gb|AE005819.1| Caulobacter crescentus CB15 section 145 of 359 of...	40	9.9
109	gb|AC098615.2| Homo sapiens chromosome 3 clone RP11-268I20, comp...	40	9.9
110	dbj|AK023155.1| Homo sapiens cDNA FLJ13093 fis, clone NT2RP30021...	40	9.9
111	dbj|AK001303.1| Homo sapiens cDNA FLJ10441 fis, clone NT2RP10007...	40	9.9
112	gb|CP000133.1| Rhizobium etli CFN 42, complete genome	40	9.9
113	ref|XM_498167.2| PREDICTED: Homo sapiens hypothetical protein DK...	40	9.9
114	gb|AC073343.6| Homo sapiens BAC clone RP11-611L7 from 7, complet...	40	9.9
115	gb|AC157941.4| Mus musculus BAC clone RP24-253I2 from chromosome...	40	9.9
116	gb|AF336983.1|AF336983 Vaucheria litorea cytochrome b6f complex ...	40	9.9
117	gb|AC012451.8| Homo sapiens BAC clone RP11-414K19 from 2, comple...	40	9.9
118	gb|AC055858.18| Homo sapiens chromosome 17, clone RP11-682M7, co...	40	9.9
119	dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome	40	9.9
120	gb|AE005063.1| Halobacterium sp. NRC-1 section 94 of 170 of the ...	40	9.9
121	gb|AF203698.1|AF203698 Rattus norvegicus T calcium channel alpha...	40	9.9
122	gb|U04283.1|SAPHSA Streptomyces antibioticus IMRU3720 phenoxazin...	40	9.9

---

>gb|AY123422.1| Triticum aestivum putative Rieske Fe-S precursor protein mRNA,
           complete cds
          Length = 866

 Score = 1215 bits (613), Expect = 0.0
 Identities = 682/704 (96%), Gaps = 2/704 (0%)
 Strand = Plus / Minus

                                                                       
Query: 23  tagactgtatacatataactggatacaagaaacaggtgcatttatagcaggagtactctt 82
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 857 tagactgtatacatataactggatacaagaaacaggtgcatttatagcaggagtagtctt 798

                                                                       
Query: 83  at--agcagcgttcttaggactggcaggaggcttaacatatcacacgagtgagctttgct 140
           ||  ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 797 atgtagcagcgttcttaggactggcaggaggcttaacatatcacaggagtgagcattgct 738

                                                                       
Query: 141 gccggagcttgtgtcgcttatttccaccacgggttctcgccggtcctgaagtcggtctcc 200
           ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 737 gccggagcttgcgtcgcttatttccaccacgggttgtcgccggtcctgaagtcggtctcc 678

                                                                       
Query: 201 acccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 260
           ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 677 acccacggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaaccagggccagcgac 618

                                                                       
Query: 261 agaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaaggg 320
           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 617 agaggtgcaggcccacggacaaccttgccctggttgttgtactgggatccatggcagggg 558

                                                                       
Query: 321 cagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacg 380
           ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||
Sbjct: 557 cagaggaacttgttctcggcggcgttccacggcacgacgcatccaagatgcgtgcacacg 498

                                                                       
Query: 381 gcgttgatcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatca 440
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 497 gcgttgatcccgtaggtggcaagggtcttgtcggactccaccacaaggtaggtaggatca 438

                                                                       
Query: 441 cccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcg 500
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 437 cccttgagcccctgggccagcgtgcggtcgttggggccgtgcgtcttgagccagtcctcg 378

                                                                       
Query: 501 acgaggatgtcgttgccgagcttgtccttggcggcgacccctccggcgttgctcccggag 560
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 377 acgaggatgtcgttgccgagcttgtccttggcggcgacccctccggcgttgctcccggag 318

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 317 ccggcggggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 258

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 257 gcgcccagcaggagcaggttcatcagctccctcttgctcatgtccggcacgcggtccgcg 198

                                                       
Query: 681 gagatgctgccggccatgcatgtgatgttcctcgggatgcgctc 724
           |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 197 gagatgctgccggccatgcaggtgatgttcctcgggatgcgctc 154

---

>dbj|AK071634.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100K03, full
           insert sequence
          Length = 1082

 Score =  561 bits (283), Expect = e-156
 Identities = 466/527 (88%)
 Strand = Plus / Minus

                                                                       
Query: 164 ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 223
           |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 725 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 666

                                                                       
Query: 224 gccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaac 283
           ||||||||||||||||||||| || |  ||||||||||| || |||||||||||||| ||
Sbjct: 665 gccgtcgtcgacgtcggcgtgcaccaatgccagcgacaggggagcaggtccacggacgac 606

                                                                       
Query: 284 cttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggc 343
           | ||||||||||||||||||| || || ||||| ||||||| ||||||||||||||||||
Sbjct: 605 cctgccctggttgttgtactgcgagccgtggcaggggcagatgaacttgttctcggcggc 546

                                                                       
Query: 344 gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgag 403
           |||||| ||||||||||| ||||| |||||||| ||||||||||||||||| ||||| ||
Sbjct: 545 gttccacggcacgacgcacccaaggtgcgtgcacacggcgttgatcccgtacgtggccag 486

                                                                       
Query: 404 ggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagcgt 463
            |||||||||| |||||| || ||||| || || ||||||||||||||||||| ||| ||
Sbjct: 485 cgtcttgtcggcctccacgacgaggtacgtcgggtcacccttgagcccctgggtgagggt 426

                                                                       
Query: 464 gcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagctt 523
           |||||||||||||||||| ||||||||||| |||||| |||| | |||||||||||||||
Sbjct: 425 gcggtcgttggggccgtgtgtcttgagccactcctcggcgagcacgtcgttgccgagctt 366

                                                                       
Query: 524 gtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggagcc 583
           |||||||||| |   ||| ||| ||  | ||||||| ||||| |||| || ||||| |||
Sbjct: 365 gtccttggcgacctgcccgccgccggcgttcccggacccggcggggatgaagaaggcgcc 306

                                                                       
Query: 584 gtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcaggaggttcat 643
           |||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||
Sbjct: 305 gtaggggacgagcatgccgacggtggggagcgagatggcgccgagcaggaggaggttcat 246

                                                          
Query: 644 cagctccctcttgctcatgtccgggacgcggtccgcggagatgctgc 690
           |||||  | ||||| |||||||||||||||||| || | ||||||||
Sbjct: 245 cagctggcgcttgcccatgtccgggacgcggtcggccgggatgctgc 199

---

>gb|AF093631.1|AF093631 Oryza sativa Rieske Fe-S precursor protein (RISP) mRNA, complete
           cds
          Length = 919

 Score =  561 bits (283), Expect = e-156
 Identities = 466/527 (88%)
 Strand = Plus / Minus

                                                                       
Query: 164 ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 223
           |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 713 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 654

                                                                       
Query: 224 gccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaac 283
           ||||||||||||||||||||| || |  ||||||||||| || |||||||||||||| ||
Sbjct: 653 gccgtcgtcgacgtcggcgtgcaccaatgccagcgacaggggagcaggtccacggacgac 594

                                                                       
Query: 284 cttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggc 343
           | ||||||||||||||||||| || || ||||| ||||||| ||||||||||||||||||
Sbjct: 593 cctgccctggttgttgtactgcgagccgtggcaggggcagatgaacttgttctcggcggc 534

                                                                       
Query: 344 gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgag 403
           |||||| ||||||||||| ||||| |||||||| ||||||||||||||||| ||||| ||
Sbjct: 533 gttccacggcacgacgcacccaaggtgcgtgcacacggcgttgatcccgtacgtggccag 474

                                                                       
Query: 404 ggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagcgt 463
            |||||||||| |||||| || ||||| || || ||||||||||||||||||| ||| ||
Sbjct: 473 cgtcttgtcggcctccacgacgaggtacgtcgggtcacccttgagcccctgggtgagggt 414

                                                                       
Query: 464 gcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagctt 523
           |||||||||||||||||| ||||||||||| |||||| |||| | |||||||||||||||
Sbjct: 413 gcggtcgttggggccgtgtgtcttgagccactcctcggcgagcacgtcgttgccgagctt 354

                                                                       
Query: 524 gtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggagcc 583
           |||||||||| |   ||| ||| ||  | ||||||| ||||| |||| || ||||| |||
Sbjct: 353 gtccttggcgacctgcccgccgccggcgttcccggacccggcggggatgaagaaggcgcc 294

                                                                       
Query: 584 gtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcaggaggttcat 643
           |||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||
Sbjct: 293 gtaggggacgagcatgccgacggtggggagcgagatggcgccgagcaggaggaggttcat 234

                                                          
Query: 644 cagctccctcttgctcatgtccgggacgcggtccgcggagatgctgc 690
           |||||  | ||||| |||||||||||||||||| || | ||||||||
Sbjct: 233 cagctggcgcttgcccatgtccgggacgcggtcggccgggatgctgc 187

---

>gb|BT016255.1| Zea mays clone Contig88 mRNA sequence
          Length = 998

 Score =  549 bits (277), Expect = e-153
 Identities = 466/529 (88%)
 Strand = Plus / Minus

                                                                       
Query: 162 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 221
           ||||||||||||| |||||||||||||||||||||||||||||| || ||||||| ||||
Sbjct: 746 ttccaccacgggtcctcgccggtcctgaagtcggtctccacccacgggacgaagaggacc 687

                                                                       
Query: 222 ttgccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 281
           |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 686 ttgccgtcgtcgacgtcggcgtgaaccagggccagcgacagaggcgccggtccacggacc 627

                                                                       
Query: 282 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 341
           ||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||
Sbjct: 626 accttgccctggttgttgtactgggatccgtggcatgggcagatgaacttgttctcggcg 567

                                                                       
Query: 342 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 401
            ||||||| |||||||||||||| || || ||||| ||||||||||||||||||||||| 
Sbjct: 566 ccgttccacggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggcc 507

                                                                       
Query: 402 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 461
           || ||||||||   ||||||||| ||||| || || ||||||||||||||||| ||||||
Sbjct: 506 agcgtcttgtcctgctccaccaccaggtacgtggggtcacccttgagcccctgcgcgagc 447

                                                                       
Query: 462 gtgcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagc 521
           ||||| |||||||| |||||||| ||||||||  |||| ||   |||||||||||| |||
Sbjct: 446 gtgcgatcgttgggaccgtgcgtgttgagccacgcctccaccgtgatgtcgttgcccagc 387

                                                                       
Query: 522 ttgtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggag 581
           ||||||||||||  |  ||| ||| ||  | ||||||||||||| ||||||| ||||| |
Sbjct: 386 ttgtccttggcgtaggtcccgccgccggcgttcccggagccggcagggacgaagaaggcg 327

                                                                       
Query: 582 ccgtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcaggaggttc 641
           ||||||||||||| |||||||| |||||| | |||||||||||| || || |||||||||
Sbjct: 326 ccgtaggggacgaccatgccgacggtgggcaacgagatggcgccgaggaggaggaggttc 267

                                                            
Query: 642 atcagctccctcttgctcatgtccgggacgcggtccgcggagatgctgc 690
           ||||||| || |||   |||||| ||||||||||| |||||||||||||
Sbjct: 266 atcagcttccgcttctccatgtcggggacgcggtcggcggagatgctgc 218

---

>gb|AY104934.1| Zea mays PCO071754 mRNA sequence
          Length = 1058

 Score =  549 bits (277), Expect = e-153
 Identities = 466/529 (88%)
 Strand = Plus / Minus

                                                                       
Query: 162 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 221
           |||||||| |||| |||||||||||||||||||||||||||||| || ||||||| ||||
Sbjct: 805 ttccaccatgggtcctcgccggtcctgaagtcggtctccacccacgggacgaagaggacc 746

                                                                       
Query: 222 ttgccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 281
           |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 745 ttgccgtcgtcgacgtcggcgtgaaccagggccagcgacagaggcgccggtccacggacc 686

                                                                       
Query: 282 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 341
           ||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| |||
Sbjct: 685 accttgccctggttgttgtactgggatccgtggcaggggcagatgaacttgttctcagcg 626

                                                                       
Query: 342 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 401
            ||||||| |||||||||||||| || || ||||| ||||||||||||||||||||||| 
Sbjct: 625 ccgttccacggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggcc 566

                                                                       
Query: 402 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 461
           || ||||||||   ||||||||| ||||| || || ||||||||||||||||| ||||||
Sbjct: 565 agcgtcttgtcctgctccaccaccaggtacgtggggtcacccttgagcccctgcgcgagc 506

                                                                       
Query: 462 gtgcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagc 521
           |||||||||||||| |||||||| |||||||| ||||| ||   |||||||||||| |||
Sbjct: 505 gtgcggtcgttgggaccgtgcgtgttgagccactcctccaccgtgatgtcgttgcccagc 446

                                                                       
Query: 522 ttgtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggag 581
           ||||||||||||  |  ||| ||| ||  | ||||||||||||| ||||||| ||||| |
Sbjct: 445 ttgtccttggcgtaggtcccgccgccggcgttcccggagccggcagggacgaagaaggcg 386

                                                                       
Query: 582 ccgtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcaggaggttc 641
           ||||||||||||| |||||||| |||||| | |||||||||||| || || |||||||||
Sbjct: 385 ccgtaggggacgaccatgccgacggtgggcaacgagatggcgccgaggaggaggaggttc 326

                                                            
Query: 642 atcagctccctcttgctcatgtccgggacgcggtccgcggagatgctgc 690
           ||||||| || |||   |||||| ||||||||||| |||||||||||||
Sbjct: 325 atcagcttccgcttctccatgtcggggacgcggtcggcggagatgctgc 277

---

>emb|AJ222783.1|HVJ222783 Hordeum vulgare mRNA for cytochrome b6/f-complex iron-sulfur
           like-protein, clone RG115
          Length = 275

 Score =  537 bits (271), Expect = e-149
 Identities = 271/271 (100%)
 Strand = Plus / Minus

                                                                       
Query: 177 tcgccggtcctgaagtcggtctccacccatggcacgaagacgaccttgccgtcgtcgacg 236
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 tcgccggtcctgaagtcggtctccacccatggcacgaagacgaccttgccgtcgtcgacg 216

                                                                       
Query: 237 tcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaaccttgccctggttg 296
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 tcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaaccttgccctggttg 156

                                                                       
Query: 297 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 356
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 155 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 96

                                                                       
Query: 357 acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 416
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95  acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 36

                                          
Query: 417 tccaccacaaggtaggtaggatcacccttga 447
           |||||||||||||||||||||||||||||||
Sbjct: 35  tccaccacaaggtaggtaggatcacccttga 5

---

>gb|AY581830.1| Cynodon dactylon putative Rieske Fe-S precursor protein mRNA,
           partial cds
          Length = 511

 Score =  315 bits (159), Expect = 1e-82
 Identities = 285/327 (87%)
 Strand = Plus / Minus

                                                                       
Query: 162 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 221
           |||||||| |||| |||||||||||||||||||||||||||||| || ||||| | | ||
Sbjct: 327 ttccaccaggggtcctcgccggtcctgaagtcggtctccacccacgggacgaaaagggcc 268

                                                                       
Query: 222 ttgccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 281
           |||||||||||||||||||||||||| | |||||||||||| || || ||||||||||| 
Sbjct: 267 ttgccgtcgtcgacgtcggcgtgaaccaaggccagcgacagtggcgccggtccacggacg 208

                                                                       
Query: 282 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 341
           ||||||||||||||||||||||||||||| ||||| ||| | | |||||||||||||| |
Sbjct: 207 accttgccctggttgttgtactgggatccgtggcatgggtacatgaacttgttctcgggg 148

                                                                       
Query: 342 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 401
           |  ||||| ||||||||||| || || || |||||||| |||||||| ||||||||||| 
Sbjct: 147 ggattccacggcacgacgcatcccaggtgggtgcagaccgcgttgatgccgtaggtggcc 88

                                                                       
Query: 402 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 461
           || ||||||||    ||||| || ||||| || || ||||||||||||||||| | ||||
Sbjct: 87  agcgtcttgtccttgtccacgaccaggtacgtggggtcacccttgagcccctgcgtgagc 28

                                      
Query: 462 gtgcggtcgttggggccgtgcgtcttg 488
           |||||||| ||||||||||||||||||
Sbjct: 27  gtgcggtctttggggccgtgcgtcttg 1

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  194 bits (98), Expect = 3e-46
 Identities = 158/178 (88%)
 Strand = Plus / Minus

                                                                            
Query: 267      gcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagagg 326
                |||||||||||||| ||| ||||||||||||||||||| || || ||||| ||||||| |
Sbjct: 22132649 gcaggtccacggacgaccctgccctggttgttgtactgcgagccgtggcaggggcagatg 22132590

                                                                            
Query: 327      aacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttg 386
                ||||||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 22132589 aacttgttctcggcggcgttccacggcacgacgcacccaaggtgcgtgcacacggcgttg 22132530

                                                                          
Query: 387      atcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatcaccct 444
                |||||||| ||||| || |||||||||| |||||| || ||||| || || |||||||
Sbjct: 22132529 atcccgtacgtggccagcgtcttgtcggcctccacgacgaggtacgtcgggtcaccct 22132472



 Score =  147 bits (74), Expect = 6e-32
 Identities = 116/130 (89%)
 Strand = Plus / Minus

                                                                            
Query: 561      ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
                ||||| |||| || ||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 22132170 ccggcggggatgaagaaggcgccgtaggggacgagcatgccgacggtggggagcgagatg 22132111

                                                                            
Query: 621      gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
                ||||| ||||| ||||||||||||||||  | ||||| |||||||||||||||||| || 
Sbjct: 22132110 gcgccgagcaggaggaggttcatcagctggcgcttgcccatgtccgggacgcggtcggcc 22132051

                          
Query: 681      gagatgctgc 690
                | ||||||||
Sbjct: 22132050 gggatgctgc 22132041



 Score =  129 bits (65), Expect = 1e-26
 Identities = 77/81 (95%)
 Strand = Plus / Minus

                                                                            
Query: 164      ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 223
                |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 22132954 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 22132895

                                     
Query: 224      gccgtcgtcgacgtcggcgtg 244
                |||||||||||||||||||||
Sbjct: 22132894 gccgtcgtcgacgtcggcgtg 22132874



 Score =  127 bits (64), Expect = 5e-26
 Identities = 85/92 (92%)
 Strand = Plus / Minus

                                                                            
Query: 442      ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
                ||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |||||| 
Sbjct: 22132386 ccttgagcccctgggtgagggtgcggtcgttggggccgtgtgtcttgagccactcctcgg 22132327

                                                
Query: 502      cgaggatgtcgttgccgagcttgtccttggcg 533
                |||| | |||||||||||||||||||||||||
Sbjct: 22132326 cgagcacgtcgttgccgagcttgtccttggcg 22132295

---

>dbj|AP005125.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0058I18
          Length = 151453

 Score =  194 bits (98), Expect = 3e-46
 Identities = 158/178 (88%)
 Strand = Plus / Minus

                                                                         
Query: 267   gcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagagg 326
             |||||||||||||| ||| ||||||||||||||||||| || || ||||| ||||||| |
Sbjct: 86305 gcaggtccacggacgaccctgccctggttgttgtactgcgagccgtggcaggggcagatg 86246

                                                                         
Query: 327   aacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttg 386
             ||||||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 86245 aacttgttctcggcggcgttccacggcacgacgcacccaaggtgcgtgcacacggcgttg 86186

                                                                       
Query: 387   atcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatcaccct 444
             |||||||| ||||| || |||||||||| |||||| || ||||| || || |||||||
Sbjct: 86185 atcccgtacgtggccagcgtcttgtcggcctccacgacgaggtacgtcgggtcaccct 86128



 Score =  147 bits (74), Expect = 6e-32
 Identities = 116/130 (89%)
 Strand = Plus / Minus

                                                                         
Query: 561   ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
             ||||| |||| || ||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 85826 ccggcggggatgaagaaggcgccgtaggggacgagcatgccgacggtggggagcgagatg 85767

                                                                         
Query: 621   gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
             ||||| ||||| ||||||||||||||||  | ||||| |||||||||||||||||| || 
Sbjct: 85766 gcgccgagcaggaggaggttcatcagctggcgcttgcccatgtccgggacgcggtcggcc 85707

                       
Query: 681   gagatgctgc 690
             | ||||||||
Sbjct: 85706 gggatgctgc 85697



 Score =  129 bits (65), Expect = 1e-26
 Identities = 77/81 (95%)
 Strand = Plus / Minus

                                                                         
Query: 164   ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 223
             |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 86610 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 86551

                                  
Query: 224   gccgtcgtcgacgtcggcgtg 244
             |||||||||||||||||||||
Sbjct: 86550 gccgtcgtcgacgtcggcgtg 86530



 Score =  127 bits (64), Expect = 5e-26
 Identities = 85/92 (92%)
 Strand = Plus / Minus

                                                                         
Query: 442   ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
             ||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |||||| 
Sbjct: 86042 ccttgagcccctgggtgagggtgcggtcgttggggccgtgtgtcttgagccactcctcgg 85983

                                             
Query: 502   cgaggatgtcgttgccgagcttgtccttggcg 533
             |||| | |||||||||||||||||||||||||
Sbjct: 85982 cgagcacgtcgttgccgagcttgtccttggcg 85951

---

>gb|DQ427777.1| Sorghum propinquum locus HHU30 genomic sequence
          Length = 742

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 320 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 261

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 260 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 201

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 200 gggatgctgc 191



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 524 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 465

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 464 ccgtgatgtcgttgcccagcttgtccttggcg 433



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 739 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 680

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 679 tcctgctccaccaccaggtacgtcgggtcaccct 646

---

>gb|DQ427776.1| Sorghum bicolor voucher PI585454 locus HHU30 genomic sequence
          Length = 728

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 457

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 456 ccgtgatgtcgttgcccagcttgtccttggcg 425



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632

---

>gb|DQ427775.1| Sorghum bicolor voucher PI267539 locus HHU30 genomic sequence
          Length = 731

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ427774.1| Sorghum bicolor voucher PI267408 locus HHU30 genomic sequence
          Length = 731

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ427773.1| Sorghum bicolor voucher PI221607 locus HHU30 genomic sequence
          Length = 725

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 722 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 663

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 662 tcctgctccaccaccaggtacgtcgggtcaccct 629

---

>gb|DQ427772.1| Sorghum bicolor voucher PI152702 locus HHU30 genomic sequence
          Length = 731

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ427771.1| Sorghum bicolor voucher NSL92371 locus HHU30 genomic sequence
          Length = 731

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ427770.1| Sorghum bicolor voucher NSL87902 locus HHU30 genomic sequence
          Length = 728

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 457

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 456 ccgtgatgtcgttgcccagcttgtccttggcg 425



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632

---

>gb|DQ427769.1| Sorghum bicolor voucher NSL87666 locus HHU30 genomic sequence
          Length = 733

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 521 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 462

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 461 ccgtgatgtcgttgcccagcttgtccttggcg 430



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 730 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 671

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 670 tcctgctccaccaccaggtacgtcgggtcaccct 637

---

>gb|DQ427768.1| Sorghum bicolor voucher NSL77217 locus HHU30 genomic sequence
          Length = 731

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ427767.1| Sorghum bicolor voucher NSL77034 locus HHU30 genomic sequence
          Length = 723

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 250 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 191

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 190 gggatgctgc 181



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627

---

>gb|DQ427766.1| Sorghum bicolor voucher NSL56174 locus HHU30 genomic sequence
          Length = 723

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 250 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 191

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 190 gggatgctgc 181



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627

---

>gb|DQ427765.1| Sorghum bicolor voucher NSL56003 locus HHU30 genomic sequence
          Length = 723

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 250 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 191

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 190 gggatgctgc 181



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627

---

>gb|DQ427764.1| Sorghum bicolor voucher NSL55243 locus HHU30 genomic sequence
          Length = 723

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 250 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 191

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 190 gggatgctgc 181



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627

---

>gb|DQ427763.1| Sorghum bicolor voucher NSL51365 locus HHU30 genomic sequence
          Length = 723

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 250 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 191

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 190 gggatgctgc 181



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627

---

>gb|DQ427762.1| Sorghum bicolor voucher NSL51030 locus HHU30 genomic sequence
          Length = 728

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 457

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 456 ccgtgatgtcgttgcccagcttgtccttggcg 425



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632

---

>gb|DQ427761.1| Sorghum bicolor voucher NSL50875 locus HHU30 genomic sequence
          Length = 725

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 722 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 663

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 662 tcctgctccaccaccaggtacgtcgggtcaccct 629

---

>gb|DQ427760.1| Sorghum bicolor voucher BTx623 locus HHU30 genomic sequence
          Length = 731

 Score =  123 bits (62), Expect = 9e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 561 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 620
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                                                       
Query: 621 gcgcccagcagcaggaggttcatcagctccctcttgctcatgtccgggacgcggtccgcg 680
           ||||| || || |||||||||||||||| || |||   |||||| ||||||||||| |||
Sbjct: 252 gcgccgaggaggaggaggttcatcagcttccgcttctccatgtcggggacgcggtcggcg 193

                     
Query: 681 gagatgctgc 690
           | ||||||||
Sbjct: 192 gggatgctgc 183



 Score =  103 bits (52), Expect = 8e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 501
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 502 cgaggatgtcgttgccgagcttgtccttggcg 533
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 351 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 410
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 411 tcggactccaccacaaggtaggtaggatcaccct 444
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635

---

>gb|DQ122916.1| Chlamydomonas incerta chloroplast cytochrome B6/F complex rieske
           iron-sulfur protein (PetC) mRNA, partial cds; nuclear
           gene for chloroplast product
          Length = 1178

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 114/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 308
           |||||||||||||| || || || |||||||| ||||||||||    ||||||||| || 
Sbjct: 443 agggccagcgacaggggagcggggccacggaccaccttgccctcagcgttgtactgagag 384

                                                                       
Query: 309 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 368
           || |||||||||||   ||||||||||||||| ||   |||||||||||||||||| || 
Sbjct: 383 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggcacgacgcagcccagg 324

                            
Query: 369 tgcgtgcagacggcgtt 385
           || ||||| ||||||||
Sbjct: 323 tgagtgcacacggcgtt 307

---

>dbj|D32003.1| Chlamydomonas reinhardtii mRNA for chloroplast Rieske Fe-S
           precursor protein, complete cds
          Length = 1436

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 114/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 308
           |||||||||||||| || || || |||||||| ||||||||||    ||||||||| || 
Sbjct: 576 agggccagcgacaggggagcggggccacggaccaccttgccctcagcgttgtactgagag 517

                                                                       
Query: 309 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 368
           || |||||||||||   ||||||||||||||| ||   |||||||||||||||||| || 
Sbjct: 516 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggcacgacgcagcccagg 457

                            
Query: 369 tgcgtgcagacggcgtt 385
           || ||||| ||||||||
Sbjct: 456 tgagtgcacacggcgtt 440

---

>emb|AL731601.3|OSJN00245 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0044M19,
             complete sequence
          Length = 188317

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 88/103 (85%), Gaps = 6/103 (5%)
 Strand = Plus / Plus

                                                                         
Query: 164   ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 217
             |||||||||||| ||||| ||||||||||||||||||||      ||| |||||||||| 
Sbjct: 53046 ccaccacgggttgtcgccagtcctgaagtcggtctccactcacacccacggcacgaagag 53105

                                                        
Query: 218   gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 260
              |||||| |||||||||||||||||||||| |  |||||||||
Sbjct: 53106 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 53148

---

>gb|DQ384526.1| Panax ginseng clone PG6L-3 photosynthetic electron transfer-like
           protein mRNA, complete cds
          Length = 770

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 116/140 (82%)
 Strand = Plus / Minus

                                                                       
Query: 258 gacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaa 317
           |||||||| ||||| || |  ||||||||||| |||||||||||||| ||||||||||| 
Sbjct: 528 gacagaggagcagggcctctaacaaccttgccttggttgttgtactgagatccatggcat 469

                                                                       
Query: 318 gggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcag 377
           ||||| | |||||||||||| ||    ||||| ||||| || || |||||||||||||| 
Sbjct: 468 gggcacatgaacttgttctctgctttattccatggcacaacacaaccaagatgcgtgcac 409

                               
Query: 378 acggcgttgatcccgtaggt 397
           || || ||||| || |||||
Sbjct: 408 actgcattgataccataggt 389

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 88/103 (85%), Gaps = 6/103 (5%)
 Strand = Plus / Plus

                                                                            
Query: 164      ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 217
                |||||||||||| ||||| ||||||||||||||||||||      ||| |||||||||| 
Sbjct: 18961122 ccaccacgggttgtcgccagtcctgaagtcggtctccactcacacccacggcacgaagag 18961181

                                                           
Query: 218      gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 260
                 |||||| |||||||||||||||||||||| |  |||||||||
Sbjct: 18961182 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 18961224

---

>ref|NM_193963.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 705

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 tctccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggcca 255
           |||||||||| ||||||||||  ||||||||||||||||||||||||||||| |  ||||
Sbjct: 160 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 101

                
Query: 256 gcgac 260
           |||||
Sbjct: 100 gcgac 96

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                            
Query: 196      tctccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggcca 255
                |||||||||| ||||||||||  ||||||||||||||||||||||||||||| |  ||||
Sbjct: 14242662 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 14242603

                     
Query: 256      gcgac 260
                |||||
Sbjct: 14242602 gcgac 14242598

---

>gb|AY826845.1| Pavlova lutheri clone PLCB61 chloroplast cytochrome b6 mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 640

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                       
Query: 299 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 358
           |||||| || || ||||| ||||||| |||||| | ||  ||||||||||| ||||||||
Sbjct: 310 gtactgcgagccgtggcaggggcagatgaacttctgctgcgcggcgttccacggcacgac 251

                                        
Query: 359 gcagccaagatgcgtgcagacggcgttga 387
           ||||||||| ||||||||||| |||||||
Sbjct: 250 gcagccaaggtgcgtgcagaccgcgttga 222

---

>dbj|AP002870.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0458A05
          Length = 120593

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                         
Query: 196   tctccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggcca 255
             |||||||||| ||||||||||  ||||||||||||||||||||||||||||| |  ||||
Sbjct: 38352 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 38293

                  
Query: 256   gcgac 260
             |||||
Sbjct: 38292 gcgac 38288

---

>gb|AY300039.1| Solanum tuberosum putative Rieske Fe-S protein precursor (FeS)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 693

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 294 ttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggc 353
           |||||||| || ||||||||||||||||| | |||||||||||| || |  ||||| |||
Sbjct: 557 ttgttgtattgagatccatggcaagggcaaatgaacttgttctcagcagtattccacggc 498

                                                                       
Query: 354 acgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
           ||||| || ||||| || ||||| || |||||||| || ||||| ||||| ||    |||
Sbjct: 497 acgacacaaccaaggtgagtgcacacagcgttgataccataggtcgcgagtgttccatcg 438

                                           
Query: 414 gactccaccacaaggtaggtaggatcaccctt 445
             |||||| |||||||| |||||||| |||||
Sbjct: 437 ttctccacaacaaggtaagtaggatctccctt 406

---

>gb|AC122543.1| Genomic sequence for Brassica oleracea, clone B21H13, complete sequence
          Length = 101563

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 121/148 (81%)
 Strand = Plus / Minus

                                                                          
Query: 297    ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 356
              ||||| ||||||||||||||||| || |||||||||||||| ||   |||||| ||||| 
Sbjct: 101211 ttgtattgggatccatggcaaggacataggaacttgttctcagctttgttccatggcaca 101152

                                                                          
Query: 357    acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 416
              || || |||||||| ||||| || ||||| || ||||| || || || |||||||||  |
Sbjct: 101151 acacatccaagatgtgtgcatactgcgtttataccgtatgtcgctagtgtcttgtcgttc 101092

                                          
Query: 417    tccaccacaaggtaggtaggatcaccct 444
              ||||| || ||||| || ||||| ||||
Sbjct: 101091 tccacaactaggtaagttggatctccct 101064

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 87/103 (84%), Gaps = 6/103 (5%)
 Strand = Plus / Minus

                                                                           
Query: 164     ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 217
               |||||||||||| ||||| ||||||||||| ||||||||      ||| |||||||||| 
Sbjct: 8732264 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 8732205

                                                          
Query: 218     gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 260
                |||||| |||||||||||||||||||||| |  |||||||||
Sbjct: 8732204 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 8732162

---

>dbj|AP004875.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0463G12
          Length = 145403

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 87/103 (84%), Gaps = 6/103 (5%)
 Strand = Plus / Minus

                                                                          
Query: 164    ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 217
              |||||||||||| ||||| ||||||||||| ||||||||      ||| |||||||||| 
Sbjct: 139311 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 139252

                                                         
Query: 218    gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 260
               |||||| |||||||||||||||||||||| |  |||||||||
Sbjct: 139251 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 139209

---

>dbj|AP006844.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0052K15
          Length = 156250

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 87/103 (84%), Gaps = 6/103 (5%)
 Strand = Plus / Minus

                                                                         
Query: 164   ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 217
             |||||||||||| ||||| ||||||||||| ||||||||      ||| |||||||||| 
Sbjct: 31343 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 31284

                                                        
Query: 218   gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 260
              |||||| |||||||||||||||||||||| |  |||||||||
Sbjct: 31283 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 31241

---

>gb|AF037456.1|AF037456 Fritillaria agrestis cytochrome B6-F complex iron-sulfur subunit
           precursor (petC) mRNA, complete cds
          Length = 881

 Score = 77.8 bits (39), Expect = 5e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 gccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatcca 311
           ||||||||||  ||||||||||| | ||||||||| || || |||||||| || ||||| 
Sbjct: 605 gccagcgacaacggtgcaggtcccctgacaaccttcccttgattgttgtattgcgatccg 546

                                  
Query: 312 tggcaagggcagaggaacttgtt 334
           ||||| |||||||||||||||||
Sbjct: 545 tggcaggggcagaggaacttgtt 523

---

>ref|NM_116566.3| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECTRON TRANSFER C)
           AT4G03280 (PETC) transcript variant AT4G03280.1 mRNA,
           complete cds
          Length = 963

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 296 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 678 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 619

                                                                     
Query: 356 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 618 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 561

---

>ref|NM_178964.1| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECTRON TRANSFER C)
           AT4G03280 (PETC) transcript variant AT4G03280.2 mRNA,
           complete cds
          Length = 1062

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 296 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 777 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 718

                                                                     
Query: 356 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 717 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 660

---

>gb|AC005275.1| Arabidopsis thaliana BAC F4C21 from chromosome IV, top arm, near 17 cM,
             complete sequence
          Length = 136335

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                         
Query: 296   gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
             |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 74269 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 74210

                                                                       
Query: 356   gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
              || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 74209 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 74152

---

>emb|AL161496.2|ATCHRIV8 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 8
          Length = 195429

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                         
Query: 296   gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
             |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 92641 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 92582

                                                                       
Query: 356   gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
              || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 92581 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 92524

---

>emb|AJ292972.1|ATH292972 Arabidopsis thaliana petC gene for Rieske FeS protein, exons 1-5
          Length = 2145

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                        
Query: 296  gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
            |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 1917 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 1858

                                                                      
Query: 356  gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
             || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 1857 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 1800

---

>emb|AJ243702.1|ATH243702 Arabidopsis thaliana mRNA for rieske iron-sulfur protein precursor
           (petC gene)
          Length = 957

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 296 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 654 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 595

                                                                     
Query: 356 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 594 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 537

---

>gb|AY093726.1| Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, complete cds
          Length = 633

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 296 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 492 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 433

                                                                     
Query: 356 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 432 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 375

---

>gb|AF410296.1|AF410296 Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, complete cds
          Length = 1061

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 296 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 780 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 721

                                                                     
Query: 356 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 720 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 663

---

>gb|AF370566.1|AF370566 Arabidopsis thaliana putative component of cytochrome B6-F complex
           (F4C21.21) mRNA, complete cds
          Length = 732

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 296 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 549 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 490

                                                                     
Query: 356 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 489 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 432

---

>emb|BX827560.1|CNS0A2RQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS74ZE01 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1358

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                        
Query: 296  gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
            |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 1133 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 1074

                                                                      
Query: 356  gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
             || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 1073 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 1016

---

>emb|AJ784852.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur protein (petC-1
           gene)
          Length = 864

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 299 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 358
           ||||||||| || ||||| ||||| | |||||||||||| |  |||||||| || |||||
Sbjct: 615 gtactgggagccgtggcacgggcacatgaacttgttctccgacgcgttccacgggacgac 556

                                        
Query: 359 gcagccaagatgcgtgcagacggcgttga 387
           ||| ||||| || ||||||||||||||||
Sbjct: 555 gcacccaaggtgagtgcagacggcgttga 527

---

>dbj|AB025003.1| Cicer arietinum mRNA for plastoquinol-plastocyanin reductase,
           partial cds
          Length = 479

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 297 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 356
           |||||||| ||||||||||| |||||||  |||||||||||||||| |||  | ||||||
Sbjct: 361 ttgtactgagatccatggcaggggcagataaacttgttctcggcggtgttaaacggcacg 302

                                                                       
Query: 357 acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 416
           || || || || || ||||| || || || ||||| || || || || ||  ||||   |
Sbjct: 301 acacacccgaggtgagtgcatactgcattaatcccatatgttgcaagtgttctgtctttc 242

                                        
Query: 417 tccaccacaaggtaggtaggatcaccctt 445
           ||||||||||||||||||||||| |||||
Sbjct: 241 tccaccacaaggtaggtaggatccccctt 213

---

>gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05,
             complete sequence
          Length = 143400

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                         
Query: 198   tccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggccagc 257
             |||| ||| ||||||||||  ||||||||||||||||||||||||||||| |  ||||||
Sbjct: 64199 tccatccacggcacgaagataaccttgccgtcgtcgacgtcggcgtgaaccaatgccagc 64258

                
Query: 258   gac 260
             |||
Sbjct: 64259 gac 64261

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                            
Query: 198      tccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggccagc 257
                |||| ||| ||||||||||  ||||||||||||||||||||||||||||| |  ||||||
Sbjct: 16113029 tccatccacggcacgaagataaccttgccgtcgtcgacgtcggcgtgaaccaatgccagc 16113088

                   
Query: 258      gac 260
                |||
Sbjct: 16113089 gac 16113091

---

>dbj|AU066527.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl
           inducible, complete cds, clone:NaEX96-104
          Length = 578

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 282 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctc 337
           ||||||||||||||||||||||| ||||| ||||| |||||   ||||||||||||
Sbjct: 474 accttgccctggttgttgtactgcgatccgtggcaggggcacttgaacttgttctc 419

---

>emb|BX826362.1|CNS0A4FZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB19ZF07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 714

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 296 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
           |||||| ||||||||||||||||| ||  | ||||||| ||| ||   |||||| |||||
Sbjct: 678 gttgtattgggatccatggcaaggacatggaaacttgtactcagctttgttccatggcac 619

                                                                     
Query: 356 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 618 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 561

---

>emb|X63605.1|PSPETC P.sativum petC mRNA for chloroplast Rieske FeS protein
          Length = 880

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 297 ttgtactgggatccatggcaagggcagaggaacttgttctc 337
           |||||||| ||||||||||| ||||||| ||||||||||||
Sbjct: 591 ttgtactgagatccatggcaggggcagatgaacttgttctc 551



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 420 accacaaggtaggtaggatcaccctt 445
           ||||||||||||||||||||||||||
Sbjct: 468 accacaaggtaggtaggatcaccctt 443

---

>gb|AY826843.1| Heterocapsa triquetra clone HTCB61 chloroplast cytochrome b6 mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 531

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 282 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 341
           |||||||||| || ||||||||| ||||| ||||| ||||||| |||   |||| ||   
Sbjct: 276 accttgccctcgtcgttgtactgcgatccgtggcacgggcagatgaagcggttcgcgttc 217

                                                          
Query: 342 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgat 388
             |||||| |||||||||||||| || || |||||||| ||||||||
Sbjct: 216 ctgttccagggcacgacgcagcccaggtgggtgcagaccgcgttgat 170

---

>emb|AJ784853.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur protein (petC-2
           gene)
          Length = 874

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 344 gttccaaggcacgacgcagccaagatgcgtgcagacggcgtt 385
           |||||| || |||||||||||||| || ||||||||||||||
Sbjct: 554 gttccagggaacgacgcagccaaggtgagtgcagacggcgtt 513



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 426 aggtaggtaggatcacccttgagcccctgggcgagcgtgcggtcg 470
           |||||||| | ||| |||||||| ||||||||||||| |||||||
Sbjct: 472 aggtaggtggcatcgcccttgaggccctgggcgagcgagcggtcg 428

---

>emb|BX826457.1|CNS0A4G1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB28ZC01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 532

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 296 gttgtactgggatccatggcaagggcagaggaacttgttctc 337
           |||||| ||||||||||||||||| || || |||||||||||
Sbjct: 252 gttgtattgggatccatggcaaggacatagaaacttgttctc 211

---

>emb|BX826302.1|CNS0A381 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZB05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 790

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 95/118 (80%)
 Strand = Plus / Minus

                                                                       
Query: 296 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
           |||||| ||||||||||||||||| || |  ||||||||||| ||   |||||| |||||
Sbjct: 553 gttgtattgggatccatggcaaggacataaaaacttgttctcagctttgttccatggcac 494

                                                                     
Query: 356 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 413
            || || |||||| | || || || |||||||| ||||| || || || |||||||||
Sbjct: 493 aacacatccaagaagagttcacactgcgttgataccgtatgtcgctagagtcttgtcg 436

---

>emb|X06244.1|SORFES Spinach mRNA for Rieske FeS-precursor protein
          Length = 1024

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 258 gacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaa 317
           |||| ||||||||| || || |||||  |||| ||||| ||||| |||||||||||||| 
Sbjct: 683 gacaaaggtgcagggcctcgaacaactctgccttggttattgtattgggatccatggcat 624

                                                                       
Query: 318 gggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcag 377
           || || | ||| |||||||| || || ||  | ||||| || || |||||||| ||||||
Sbjct: 623 ggacaaatgaatttgttctcagcagcattaaatggcaccacacatccaagatgtgtgcag 564

             
Query: 378 ac 379
           ||
Sbjct: 563 ac 562

---

>gb|AF110783.1|AF110783 Volvox carteri f. nagariensis clone G9 rieske iron-sulfur protein
           precursor (petC) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1159

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 109/137 (79%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 308
           |||||||  ||||| || ||||| |||||||| ||||||||||     |||||||| || 
Sbjct: 553 agggccaaagacagcggagcagggccacggaccaccttgccctcagcattgtactgagag 494

                                                                       
Query: 309 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 368
           || |||||||||||   ||||||||||||||| ||   |||||| ||||| ||||| |  
Sbjct: 493 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggaacgacacagcccaag 434

                            
Query: 369 tgcgtgcagacggcgtt 385
           || ||||| ||||||||
Sbjct: 433 tgggtgcacacggcgtt 417

---

>gb|AY267656.1| Bigelowiella natans Fe-S subunit of cytochrome c6f complex mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1025

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 299 gtactgggatccatggcaagggca 322
           ||||||||||||||||||||||||
Sbjct: 653 gtactgggatccatggcaagggca 630

---

>emb|X76299.1|CRPETC C.reinhardtii petC gene
          Length = 1608

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 273  ccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagaggaacttg 332
            |||||||| ||||||||||    ||||||||| || || |||||||||||   |||||||
Sbjct: 1171 ccacggaccaccttgccctcagcgttgtactgagagccgtggcaagggcacttgaacttg 1112

                    
Query: 333  ttctcggc 340
            ||||||||
Sbjct: 1111 ttctcggc 1104



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 347 ccaaggcacgacgcagccaagatgcgtgcagacggcgtt 385
           |||||||||||||||||| || || ||||| ||||||||
Sbjct: 959 ccaaggcacgacgcagcccaggtgagtgcacacggcgtt 921

---

>emb|X66009.1|NTRFES1 N.tabacum mRNA for chloroplast Rieske FeS precursor protein 1
          Length = 814

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 291 tggttgttgtactgggatccatggcaagggcagaggaacttgttctc 337
           ||||||||||| || ||||||||||| ||||| |  |||||||||||
Sbjct: 592 tggttgttgtattgagatccatggcaggggcaaataaacttgttctc 546

---

>emb|X64353.1|NTRFSCBFC N.tabacum mRNA for Rieske Fe/S protein of cytochrome b6/f complex
          Length = 833

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 291 tggttgttgtactgggatccatggcaagggcagaggaacttgttctc 337
           ||||||||||| || ||||||||||| ||||| |  |||||||||||
Sbjct: 556 tggttgttgtattgagatccatggcaggggcaaataaacttgttctc 510

---

>emb|BX572099.1| Prochlorococcus marinus MIT9313 complete genome; segment 5/7
          Length = 349746

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 344   gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgta 394
             |||||||||||| |||||||| || || |||||||  |||||||| |||||
Sbjct: 12422 gttccaaggcaccacgcagccgaggtgggtgcagatcgcgttgattccgta 12372

---

>emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segment 6/7
          Length = 349122

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                         
Query: 312   tggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgc 371
             ||||||||||| | |||||||||  || ||  |||||| ||||| |||||||| || || 
Sbjct: 17548 tggcaagggcacatgaacttgttggcgccgctgttccagggcaccacgcagcccaggtgg 17489

                                    
Query: 372   gtgcagacggcgttgatcccgta 394
             ||||||| |||||| || |||||
Sbjct: 17488 gtgcagatggcgttaatgccgta 17466

---

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 215     gacgaccttgccgtcgtcgacg 236
               ||||||||||||||||||||||
Sbjct: 1061182 gacgaccttgccgtcgtcgacg 1061203

---

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                    
Query: 342    gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtag 395
              |||||||||||||| |||||||| |  || ||||| || |||||||| ||||||
Sbjct: 367671 gcgttccaaggcaccacgcagcccaagtgggtgcaaactgcgttgatgccgtag 367618

---

>gb|AY826844.1| Isochrysis galbana clone ISCB61 chloroplast cytochrome b6 mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 1010

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 91/114 (79%)
 Strand = Plus / Minus

                                                                       
Query: 299 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 358
           |||||| || || ||||| ||||||| | |||||  || ||||  |||||| || |||||
Sbjct: 521 gtactgcgagccgtggcacgggcagatgtacttgagctgggcgcggttccatgggacgac 462

                                                                 
Query: 359 gcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtc 412
           |||||| || || ||||| || ||||||||  ||||| |  |||||||||||||
Sbjct: 461 gcagccgaggtgggtgcaaacagcgttgatggcgtagttctcgagggtcttgtc 408

---

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 209     cacgaagacgaccttgccgtcg 230
               ||||||||||||||||||||||
Sbjct: 3591632 cacgaagacgaccttgccgtcg 3591653

---

>gb|AY487229.1| Mycobacterium fortuitum PgaE gene, partial cds; putative
            transcription regulator, hypothetical protein, Erm(39),
            3355, and FolD genes, complete cds; and 3359 gene,
            partial cds
          Length = 4803

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 224  gccgtcgtcgacgtcggcgtga 245
            ||||||||||||||||||||||
Sbjct: 3357 gccgtcgtcgacgtcggcgtga 3336

---

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                     
Query: 342     gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtag 395
               |||||||||||||| |||||||| |  || ||||| || |||||||| ||||||
Sbjct: 1253134 gcgttccaaggcaccacgcagcccaagtgggtgcaaactgcgttgatgccgtag 1253187

---

>dbj|AB070940.1| Streptomyces avermitilis oligomycin biosynthetic gene cluster
          Length = 104326

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 209   cacgaagacgaccttgccgtcg 230
             ||||||||||||||||||||||
Sbjct: 46173 cacgaagacgaccttgccgtcg 46152

---

>gb|AC093100.2| Drosophila melanogaster clone BACR05J04, complete sequence
          Length = 214621

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 513    ttgccgagcttgtccttggcggcga 537
              ||||||||| |||||||||||||||
Sbjct: 148179 ttgccgagcgtgtccttggcggcga 148155

---

>gb|AC090377.15| Homo sapiens chromosome 18, clone RP11-866E20, complete sequence
          Length = 192704

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 623    gcccagcagcaggaggttcat 643
              |||||||||||||||||||||
Sbjct: 142142 gcccagcagcaggaggttcat 142162

---

>gb|AC107990.5| Homo sapiens chromosome 18, clone RP11-103A19, complete sequence
          Length = 166109

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 623   gcccagcagcaggaggttcat 643
             |||||||||||||||||||||
Sbjct: 25300 gcccagcagcaggaggttcat 25320

---

>ref|NM_135169.2| Drosophila melanogaster Pez CG9493-RA (Pez), mRNA
          Length = 4527

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 513  ttgccgagcttgtccttggcggcga 537
            ||||||||| |||||||||||||||
Sbjct: 1064 ttgccgagcgtgtccttggcggcga 1040

---

>gb|AF217284.1|AF217284 Drosophila melanogaster protein tyrosine phosphatase Pez (Pez)
           mRNA, complete cds
          Length = 4433

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 513 ttgccgagcttgtccttggcggcga 537
           ||||||||| |||||||||||||||
Sbjct: 955 ttgccgagcgtgtccttggcggcga 931

---

>gb|AE003613.4| Drosophila melanogaster chromosome 2L, section 22 of 83 of the complete
              sequence
          Length = 280095

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 513    ttgccgagcttgtccttggcggcga 537
              ||||||||| |||||||||||||||
Sbjct: 119693 ttgccgagcgtgtccttggcggcga 119717

---

>gb|AC005285.1|AC005285 Drosophila melanogaster DNA sequence (P1s DS00121 (D128), DS05470 (D270),
              and DS00108 (D120)), complete sequence
          Length = 209071

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 513    ttgccgagcttgtccttggcggcga 537
              ||||||||| |||||||||||||||
Sbjct: 133047 ttgccgagcgtgtccttggcggcga 133071

---

>ref|XM_529565.1| PREDICTED: Pan troglodytes LOC452570 (LOC452570), mRNA
          Length = 1461

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 685  tgctgccggccatgcatgtg 704
            ||||||||||||||||||||
Sbjct: 1158 tgctgccggccatgcatgtg 1177

---

>ref|NM_018094.2| Homo sapiens G1 to S phase transition 2 (GSPT2), mRNA
          Length = 2503

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 547 cgttgctcccggagccggccggga 570
           ||||||| ||||||||||||||||
Sbjct: 464 cgttgctgccggagccggccggga 441

---

>gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, complete sequence
          Length = 215810

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 95    ttaggactggcaggaggctt 114
             ||||||||||||||||||||
Sbjct: 14455 ttaggactggcaggaggctt 14436

---

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 517     cgagcttgtccttggcggcg 536
               ||||||||||||||||||||
Sbjct: 1291092 cgagcttgtccttggcggcg 1291073

---

>ref|XM_659574.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7062.2), mRNA
          Length = 1668

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 211 cgaagacgaccttgccgtcg 230
           ||||||||||||||||||||
Sbjct: 976 cgaagacgaccttgccgtcg 957

---

>gb|AC148476.4| Homo sapiens 12 BAC RP13-714J12 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 41737

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 616  agatggcgcccagcagcagg 635
            ||||||||||||||||||||
Sbjct: 3744 agatggcgcccagcagcagg 3763

---

>ref|XM_754954.1| Ustilago maydis 521 hypothetical protein (UM03900.1) partial mRNA
          Length = 3015

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 313  ggcaagggcagaggaacttg 332
            ||||||||||||||||||||
Sbjct: 1647 ggcaagggcagaggaacttg 1628

---

>gb|AC124358.4| Mus musculus BAC clone RP24-491B24 from chromosome 3, complete sequence
          Length = 161119

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 639   ttcatcagctccctcttgctcatg 662
             ||||| ||||||||||||||||||
Sbjct: 31588 ttcataagctccctcttgctcatg 31611

---

>gb|AC125332.3| Mus musculus BAC clone RP23-113I20 from 3, complete sequence
          Length = 220068

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 310    catggcaagggcagaggaac 329
              ||||||||||||||||||||
Sbjct: 148711 catggcaagggcagaggaac 148730

---

>gb|AC121928.2| Mus musculus BAC clone RP24-204F1 from 3, complete sequence
          Length = 178387

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 310    catggcaagggcagaggaac 329
              ||||||||||||||||||||
Sbjct: 151789 catggcaagggcagaggaac 151770

---

>emb|AL929101.4| Human DNA sequence from clone RP11-22B10 on chromosome X Contains the
             GSPT2 gene for G1 to S phase transition 2, a pseudogene
             similar to part of p30 (nuclear protein p30), a zinc
             finger protein pseudogene, the 5' end of a variant of the
             MAGED1 gene for melanoma antigen, family D, 1 and two CpG
             islands, complete sequence
          Length = 157110

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 547   cgttgctcccggagccggccggga 570
             ||||||| ||||||||||||||||
Sbjct: 40236 cgttgctgccggagccggccggga 40213

---

>emb|AL662824.9| Human DNA sequence from clone XXbac-22I16 on chromosome 6 contains the
             HLA-DPA1 gene for major histocompatibility complex, class
             II, DP alpha 1, the HLA-DPB1 gene for major
             histocompatibility complex, class II, DP beta 1, a
             ribosomal protein L32 (RPL32) pseudogene, the HLA-DPA2
             pseudogene for major histocompatibility complex, class II,
             DP alpha 2, a pseudogene similar to part of collagens, a
             novel protein similar to major histocompatibility complex,
             class II, DP beta 2 (pseudogene), a major
             histocompatibility complex, class II, DP beta 1
             pseudogene, two putative novel transcripts, the COL11A2
             gene for collagen, type XI, alpha 2, the RXRB gene for
             retinoid X receptor, beta, the HKE4 gene for HLA-class II
             region expressed gene KE4, the 5' end of the HSD17B8 gene
             for hydroxysteroid (17-beta) dehydrogenase 8 and four CpG
             islands, complete sequence
          Length = 187964

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 312   tggcaagggcagaggaactt 331
             ||||||||||||||||||||
Sbjct: 38046 tggcaagggcagaggaactt 38027

---

>emb|AL645931.7| Human DNA sequence from clone XXbac-138A21 on chromosome 6 Contains the
             HLA-DOA, HLA-DPA1 and HLA-DPB1 genes for major
             histocompatibility complex class II proteins DO alpha, DP
             alpha 1 and DP beta 1, the HLA-DPA2 major
             histocompatibility complex class II DP alpha 2 pseudogene,
             ribosomal protein L32 pseudogene RPL32P1, a pseudogene
             similar to part of collagens, the 5' end of an HLA class
             II histocompatibility antigen D or S beta pseudogene, the
             5' end of a novel protein similar to major
             histocompatibility complex class II DP beta 1 precursor
             and a CpG island, complete sequence
          Length = 124899

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 312   tggcaagggcagaggaactt 331
             ||||||||||||||||||||
Sbjct: 63756 tggcaagggcagaggaactt 63737

---

>ref|XM_783177.1| PREDICTED: Strongylocentrotus purpuratus similar to tripartite
           motif protein TRIM2 (LOC583257), mRNA
          Length = 1002

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 492 caatcctcgacgaggatgtc 511
           ||||||||||||||||||||
Sbjct: 776 caatcctcgacgaggatgtc 757

---

>gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 map 14, complete sequence
          Length = 180338

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 95     ttaggactggcaggaggctt 114
              ||||||||||||||||||||
Sbjct: 173120 ttaggactggcaggaggctt 173101

---

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 625     ccagcagcaggaggttcatc 644
               ||||||||||||||||||||
Sbjct: 1354502 ccagcagcaggaggttcatc 1354483

---

>gb|BC036077.1| Homo sapiens G1 to S phase transition 2, mRNA (cDNA clone MGC:33729
           IMAGE:5313878), complete cds
          Length = 2513

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 547 cgttgctcccggagccggccggga 570
           ||||||| ||||||||||||||||
Sbjct: 464 cgttgctgccggagccggccggga 441

---

>emb|AJ251548.1|HSA251548 Homo sapiens mRNA for polypeptide chain release factor 3b (GSPT2
           gene)
          Length = 1887

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 547 cgttgctcccggagccggccggga 570
           ||||||| ||||||||||||||||
Sbjct: 268 cgttgctgccggagccggccggga 245

---

>emb|CR759795.4| Human DNA sequence from clone DAMC-206D4 on chromosome 6, complete
             sequence
          Length = 119898

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 312   tggcaagggcagaggaactt 331
             ||||||||||||||||||||
Sbjct: 58192 tggcaagggcagaggaactt 58173

---

>emb|AL133055.1|HSM801326 Homo sapiens mRNA; cDNA DKFZp434J1015 (from clone DKFZp434J1015)
          Length = 1904

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 620 ggcgcccagcagcaggaggt 639
           ||||||||||||||||||||
Sbjct: 236 ggcgcccagcagcaggaggt 255

---

>emb|CR861342.1| Pongo pygmaeus mRNA; cDNA DKFZp459J1511 (from clone DKFZp459J1511)
          Length = 2532

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 547 cgttgctcccggagccggccggga 570
           ||||||| ||||||||||||||||
Sbjct: 482 cgttgctgccggagccggccggga 459

---

>gb|AC087892.16| Homo sapiens 12q BAC RP11-3L23 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 123004

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 45   atacaagaaacaggtgcatt 64
            ||||||||||||||||||||
Sbjct: 2769 atacaagaaacaggtgcatt 2788

---

>gb|AE005819.1| Caulobacter crescentus CB15 section 145 of 359 of the complete
           genome
          Length = 10591

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 519 agcttgtccttggcggcgacccct 542
           ||||||||||||||| ||||||||
Sbjct: 434 agcttgtccttggcgccgacccct 457

---

>gb|AC098615.2| Homo sapiens chromosome 3 clone RP11-268I20, complete sequence
          Length = 167486

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 49     aagaaacaggtgcatttata 68
              ||||||||||||||||||||
Sbjct: 151940 aagaaacaggtgcatttata 151921

---

>dbj|AK023155.1| Homo sapiens cDNA FLJ13093 fis, clone NT2RP3002151, highly similar
           to G1 TO S PHASE TRANSITION PROTEIN 1 HOMOLOG
          Length = 2492

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 547 cgttgctcccggagccggccggga 570
           ||||||| ||||||||||||||||
Sbjct: 454 cgttgctgccggagccggccggga 431

---

>dbj|AK001303.1| Homo sapiens cDNA FLJ10441 fis, clone NT2RP1000733, highly similar
           to Human mRNA for GSPT1-TK protein
          Length = 2481

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 547 cgttgctcccggagccggccggga 570
           ||||||| ||||||||||||||||
Sbjct: 448 cgttgctgccggagccggccggga 425

---

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 496     cctcgacgaggatgtcgttgccga 519
               ||||||||| ||||||||||||||
Sbjct: 2955444 cctcgacgatgatgtcgttgccga 2955467

---

>ref|XM_498167.2| PREDICTED: Homo sapiens hypothetical protein DKFZp434J1015
           (DKFZp434J1015), mRNA
          Length = 4839

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 620 ggcgcccagcagcaggaggt 639
           ||||||||||||||||||||
Sbjct: 85  ggcgcccagcagcaggaggt 104

---

>gb|AC073343.6| Homo sapiens BAC clone RP11-611L7 from 7, complete sequence
          Length = 173967

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 620  ggcgcccagcagcaggaggt 639
            ||||||||||||||||||||
Sbjct: 7411 ggcgcccagcagcaggaggt 7430

---

>gb|AC157941.4| Mus musculus BAC clone RP24-253I2 from chromosome 3, complete sequence
          Length = 204323

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 639   ttcatcagctccctcttgctcatg 662
             ||||| ||||||||||||||||||
Sbjct: 34511 ttcataagctccctcttgctcatg 34488

---

>gb|AF336983.1|AF336983 Vaucheria litorea cytochrome b6f complex Rieske FeS protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 222

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 300 tactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 355
           ||||| || ||||||||||| |||| ||||||||| || ||   ||||||||||||
Sbjct: 128 tactgcgacccatggcaaggacagatgaacttgttttcagccttgttccaaggcac 73

---

>gb|AC012451.8| Homo sapiens BAC clone RP11-414K19 from 2, complete sequence
          Length = 188121

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 313    ggcaagggcagaggaacttg 332
              ||||||||||||||||||||
Sbjct: 179433 ggcaagggcagaggaacttg 179452

---

>gb|AC055858.18| Homo sapiens chromosome 17, clone RP11-682M7, complete sequence
          Length = 167395

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 643   tcagctccctcttgctcatg 662
             ||||||||||||||||||||
Sbjct: 64929 tcagctccctcttgctcatg 64910

---

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 217     cgaccttgccgtcgtcgacg 236
               ||||||||||||||||||||
Sbjct: 2036408 cgaccttgccgtcgtcgacg 2036389

---

>gb|AE005063.1| Halobacterium sp. NRC-1 section 94 of 170 of the complete genome
          Length = 11844

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 454  gggcgagcgtgcggtcgttggggccgtg 481
            |||||||||||||||||| |||| ||||
Sbjct: 3239 gggcgagcgtgcggtcgtcggggtcgtg 3212

---

>gb|AF203698.1|AF203698 Rattus norvegicus T calcium channel alpha1G subunit (Cacna1g) gene,
            partial cds
          Length = 4171

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 434  aggatcacccttgagcccctgggc 457
            ||||||||||||||||| ||||||
Sbjct: 3868 aggatcacccttgagcctctgggc 3845

---

>gb|U04283.1|SAPHSA Streptomyces antibioticus IMRU3720 phenoxazinone synthase (phsA)
            gene, complete cds
          Length = 2302

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  gccgtcgtcgacgtcggcgt 243
            ||||||||||||||||||||
Sbjct: 1257 gccgtcgtcgacgtcggcgt 1238


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,518,353
Number of Sequences: 3902068
Number of extensions: 4518353
Number of successful extensions: 79720
Number of sequences better than 10.0: 122
Number of HSP's better than 10.0 without gapping: 122
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78548
Number of HSP's gapped (non-prelim): 1148
length of query: 724
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 701
effective length of database: 17,143,297,704
effective search space: 12017451690504
effective search space used: 12017451690504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---