ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal13n18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC144826.2| Danio rerio clone CH211-20C7, complete sequence 46 0.16
2emb|BX119910.7| Zebrafish DNA sequence from clone DKEY-17C10 in ... 46 0.16
3gb|AC154641.2| Mus musculus BAC clone RP23-276C17 from chromosom... 44 0.61
4dbj|AB158556.1| Paralichthys olivaceus pre-mRNA, containing exon... 44 0.61
5dbj|AB052658.1| Paralichthys olivaceus mRNA for immunoglobulin D... 44 0.61
6emb|AL645924.13| Human DNA sequence from clone RP11-503N18 on ch... 42 2.4
7emb|AL606623.3|OSJN00053 Oryza sativa genomic DNA, chromosome 4,... 42 2.4
8emb|BX248577.16| Zebrafish DNA sequence from clone CH211-162H21 ... 42 2.4
9dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
10emb|AL929286.13| Zebrafish DNA sequence from clone CH211-117K10 ... 42 2.4
11emb|Z54336.1|HSL25G12 Human DNA sequence from clone LA04NC01-25G... 42 2.4
12gb|BC077300.1| Xenopus laevis MGC80192 protein, mRNA (cDNA clone... 40 9.6
13ref|XM_368337.1| Magnaporthe grisea 70-15 chromosome VI hypothet... 40 9.6
14gb|BC070533.1| Xenopus laevis hypothetical protein MGC78839, mRN... 40 9.6
15gb|AC133179.3| Mus musculus BAC clone RP24-134P14 from chromosom... 40 9.6
16emb|Z82205.1|HS363L9 Human DNA sequence from clone RP3-363L9 on ... 40 9.6
17emb|AL928596.5| Human DNA sequence from clone RP11-1037J10 on ch... 40 9.6
18emb|AL513332.9| Human DNA sequence from clone RP11-58B8 on chrom... 40 9.6
19gb|AC083905.20| Homo sapiens 3 BAC RP11-124N24 (Roswell Park Can... 40 9.6
20emb|BX000995.12| Mouse DNA sequence from clone RP23-106K17 on ch... 40 9.6
21gb|AC008885.5| Homo sapiens chromosome 5 clone CTD-2218K11, comp... 40 9.6
22gb|AC108174.1| Homo sapiens chromosome 5 clone RP11-78C3, comple... 40 9.6
23gb|AC091643.6| Homo sapiens chromosome 18, clone RP11-727B4, com... 40 9.6
24dbj|AK162061.1| Mus musculus adult male adrenal gland cDNA, RIKE... 40 9.6
25gb|AC107633.11| Mus musculus chromosome 12, clone RP23-7P3, comp... 40 9.6
26gb|AC131987.10| Mus musculus chromosome 13, clone RP24-184L10, c... 40 9.6
27dbj|AP000639.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 9.6
28gb|AC125100.4| Mus musculus BAC clone RP24-206N14 from 9, comple... 40 9.6
29gb|AC134893.4| Mus musculus BAC clone RP24-251N8 from 9, complet... 40 9.6
30emb|CR974587.14| Pig DNA sequence from clone CH242-288P9 on chro... 40 9.6
31emb|AL844562.3| Mouse DNA sequence from clone RP23-230F7 on chro... 40 9.6
32emb|AL604045.7| Mouse DNA sequence from clone RP23-418O11 on chr... 40 9.6
33emb|AL671900.5| Mouse DNA sequence from clone RP23-282O5 on chro... 40 9.6

>gb|AC144826.2| Danio rerio clone CH211-20C7, complete sequence
          Length = 163056

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 140    caccaacaaatcttcattttaca 162
              |||||||||||||||||||||||
Sbjct: 161766 caccaacaaatcttcattttaca 161788



to top

>emb|BX119910.7| Zebrafish DNA sequence from clone DKEY-17C10 in linkage group 10,
             complete sequence
          Length = 199662

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 140   caccaacaaatcttcattttaca 162
             |||||||||||||||||||||||
Sbjct: 13848 caccaacaaatcttcattttaca 13870



to top

>gb|AC154641.2| Mus musculus BAC clone RP23-276C17 from chromosome 16, complete
             sequence
          Length = 190523

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 63    cacatacagcaaagacatctctgaca 88
             ||||||||||||| ||||||||||||
Sbjct: 31142 cacatacagcaaaaacatctctgaca 31167



to top

>dbj|AB158556.1| Paralichthys olivaceus pre-mRNA, containing exons for immunoglobulin
            M and immunoglobulin D, partial cds
          Length = 4320

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 453  gtcagtggaaacaactcaaatc 474
            ||||||||||||||||||||||
Sbjct: 2346 gtcagtggaaacaactcaaatc 2367



to top

>dbj|AB052658.1| Paralichthys olivaceus mRNA for immunoglobulin D, complete cds
          Length = 3244

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 453  gtcagtggaaacaactcaaatc 474
            ||||||||||||||||||||||
Sbjct: 1270 gtcagtggaaacaactcaaatc 1291



to top

>emb|AL645924.13| Human DNA sequence from clone RP11-503N18 on chromosome 4, complete
              sequence
          Length = 168683

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 354    gatcctggcagctccccatca 374
              |||||||||||||||||||||
Sbjct: 121559 gatcctggcagctccccatca 121539



to top

>emb|AL606623.3|OSJN00053 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0081L15,
             complete sequence
          Length = 150864

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 189   cagtacagtagtagatatgta 209
             |||||||||||||||||||||
Sbjct: 55773 cagtacagtagtagatatgta 55793



to top

>emb|BX248577.16| Zebrafish DNA sequence from clone CH211-162H21 in linkage group 11,
             complete sequence
          Length = 155980

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 212   atcatcaggtgattgggcatc 232
             |||||||||||||||||||||
Sbjct: 94550 atcatcaggtgattgggcatc 94530



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 189      cagtacagtagtagatatgta 209
                |||||||||||||||||||||
Sbjct: 24166548 cagtacagtagtagatatgta 24166568



to top

>emb|AL929286.13| Zebrafish DNA sequence from clone CH211-117K10 in linkage group 11,
              complete sequence
          Length = 168222

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    atcatcaggtgattgggcatc 232
              |||||||||||||||||||||
Sbjct: 107349 atcatcaggtgattgggcatc 107369



to top

>emb|Z54336.1|HSL25G12 Human DNA sequence from clone LA04NC01-25G12 on chromosome 4, complete
             sequence
          Length = 37153

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 354   gatcctggcagctccccatca 374
             |||||||||||||||||||||
Sbjct: 19277 gatcctggcagctccccatca 19257



to top

>gb|BC077300.1| Xenopus laevis MGC80192 protein, mRNA (cDNA clone MGC:80192
            IMAGE:4970737), complete cds
          Length = 2258

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 151  cttcattttacaatgcaagc 170
            ||||||||||||||||||||
Sbjct: 1935 cttcattttacaatgcaagc 1916



to top

>ref|XM_368337.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein
           (MG00907.4) partial mRNA
          Length = 420

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 278 aaaatggcattgatctcctc 297
           ||||||||||||||||||||
Sbjct: 410 aaaatggcattgatctcctc 391



to top

>gb|BC070533.1| Xenopus laevis hypothetical protein MGC78839, mRNA (cDNA clone
            MGC:78839 IMAGE:3402761), complete cds
          Length = 3493

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 644  aaagaaggaaatttaagaag 663
            ||||||||||||||||||||
Sbjct: 2440 aaagaaggaaatttaagaag 2459



to top

>gb|AC133179.3| Mus musculus BAC clone RP24-134P14 from chromosome 14, complete
             sequence
          Length = 160216

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 329   atgacatctcctccaaaatc 348
             ||||||||||||||||||||
Sbjct: 35695 atgacatctcctccaaaatc 35676



to top

>emb|Z82205.1|HS363L9 Human DNA sequence from clone RP3-363L9 on chromosome X Contains a
              N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae) (NAT5)
              pseudogene, complete sequence
          Length = 125971

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 352    aggatcctggcagctcccca 371
              ||||||||||||||||||||
Sbjct: 125044 aggatcctggcagctcccca 125025



to top

>emb|AL928596.5| Human DNA sequence from clone RP11-1037J10 on chromosome X, complete
             sequence
          Length = 64394

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 456   agtggaaacaactcaaatca 475
             ||||||||||||||||||||
Sbjct: 44720 agtggaaacaactcaaatca 44701



to top

>emb|AL513332.9| Human DNA sequence from clone RP11-58B8 on chromosome 9, complete
             sequence
          Length = 124531

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 11    ggcagataagttctatgatacatc 34
             |||||||||| |||||||||||||
Sbjct: 20920 ggcagataagctctatgatacatc 20943



to top

>gb|AC083905.20| Homo sapiens 3 BAC RP11-124N24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109471

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 361   gcagctccccatcagcaactgaataaag 388
             ||||||||||| ||||||| ||||||||
Sbjct: 77488 gcagctccccaccagcaacggaataaag 77461



to top

>emb|BX000995.12| Mouse DNA sequence from clone RP23-106K17 on chromosome 11 Contains a
              protease pseuodogene, complete sequence
          Length = 189417

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 80     tctctgacagcttaacaaaa 99
              ||||||||||||||||||||
Sbjct: 149781 tctctgacagcttaacaaaa 149800



to top

>gb|AC008885.5| Homo sapiens chromosome 5 clone CTD-2218K11, complete sequence
          Length = 127790

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 456  agtggaaacaactcaaatcaactgatga 483
            |||| |||||||||||||||||| ||||
Sbjct: 1160 agtgaaaacaactcaaatcaactaatga 1133



to top

>gb|AC108174.1| Homo sapiens chromosome 5 clone RP11-78C3, complete sequence
          Length = 162435

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 456   agtggaaacaactcaaatcaactgatga 483
             |||| |||||||||||||||||| ||||
Sbjct: 69575 agtgaaaacaactcaaatcaactaatga 69602



to top

>gb|AC091643.6| Homo sapiens chromosome 18, clone RP11-727B4, complete sequence
          Length = 169944

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   acaaatcttcattttacaat 164
             ||||||||||||||||||||
Sbjct: 94697 acaaatcttcattttacaat 94716



to top

>dbj|AK162061.1| Mus musculus adult male adrenal gland cDNA, RIKEN full-length
           enriched library, clone:7330407L19 product:testicular
           cell adhesion molecule 1, full insert sequence
          Length = 1280

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 378 actgaataaagatctctctt 397
           ||||||||||||||||||||
Sbjct: 943 actgaataaagatctctctt 924



to top

>gb|AC107633.11| Mus musculus chromosome 12, clone RP23-7P3, complete sequence
          Length = 202640

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    cacaaacacatacagcaaag 76
             ||||||||||||||||||||
Sbjct: 49845 cacaaacacatacagcaaag 49864



to top

>gb|AC131987.10| Mus musculus chromosome 13, clone RP24-184L10, complete sequence
          Length = 174529

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 445    cagattaggtcagtggaaacaactcaaa 472
              |||||| |||||||||||| ||||||||
Sbjct: 116131 cagatttggtcagtggaaagaactcaaa 116158



to top

>dbj|AP000639.4| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-26D11, complete
             sequences
          Length = 103758

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 381   gaataaagatctctctttct 400
             ||||||||||||||||||||
Sbjct: 14935 gaataaagatctctctttct 14954



to top

>gb|AC125100.4| Mus musculus BAC clone RP24-206N14 from 9, complete sequence
          Length = 169501

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 48     ctacaagggcacaaacacatacag 71
              ||||||| ||||||||||||||||
Sbjct: 153634 ctacaagtgcacaaacacatacag 153611



to top

>gb|AC134893.4| Mus musculus BAC clone RP24-251N8 from 9, complete sequence
          Length = 166674

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 48    ctacaagggcacaaacacatacag 71
             ||||||| ||||||||||||||||
Sbjct: 25194 ctacaagtgcacaaacacatacag 25171



to top

>emb|CR974587.14| Pig DNA sequence from clone CH242-288P9 on chromosome 7, complete
             sequence
          Length = 165092

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 648   aaggaaatttaagaagctttgcct 671
             |||||||||||| |||||||||||
Sbjct: 77701 aaggaaatttaataagctttgcct 77678



to top

>emb|AL844562.3| Mouse DNA sequence from clone RP23-230F7 on chromosome 2, complete
              sequence
          Length = 208058

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 643    caaagaaggaaatttaagaa 662
              ||||||||||||||||||||
Sbjct: 185943 caaagaaggaaatttaagaa 185962



to top

>emb|AL604045.7| Mouse DNA sequence from clone RP23-418O11 on chromosome 11, complete
             sequence
          Length = 221399

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 378   actgaataaagatctctctt 397
             ||||||||||||||||||||
Sbjct: 59530 actgaataaagatctctctt 59511



to top

>emb|AL671900.5| Mouse DNA sequence from clone RP23-282O5 on chromosome X, complete
              sequence
          Length = 185389

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 57     cacaaacacatacagcaaagacat 80
              |||||||||||||||| |||||||
Sbjct: 136482 cacaaacacatacagccaagacat 136459


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,091,124
Number of Sequences: 3902068
Number of extensions: 7091124
Number of successful extensions: 139119
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 138995
Number of HSP's gapped (non-prelim): 124
length of query: 701
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 678
effective length of database: 17,143,297,704
effective search space: 11623155843312
effective search space used: 11623155843312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top