>gb|AY440090.1| Armigeres subalbatus ASAP ID: 42177 conserved unknown mRNA sequence
          Length = 606

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 573 ataactcaggtgatgttgccctgctg 598
           ||||| ||||||||||||||||||||
Sbjct: 553 ataacccaggtgatgttgccctgctg 528

>gb|AC084218.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0001A07,
             complete sequence
          Length = 164898

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 281   atatggagcttattgagttctgaactcgctgttg 314
             ||||||||||||||||| || |||||||| ||||
Sbjct: 19343 atatggagcttattgagctcagaactcgccgttg 19376

>gb|AC016779.5| Genomic sequence for Oryza sativa clone 10N6, complete sequence
          Length = 140234

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 281   atatggagcttattgagttctgaactcgctgttg 314
             ||||||||||||||||| || |||||||| ||||
Sbjct: 42822 atatggagcttattgagctcagaactcgccgttg 42789

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 281     atatggagcttattgagttctgaactcgctgttg 314
               ||||||||||||||||| || |||||||| ||||
Sbjct: 2824732 atatggagcttattgagctcagaactcgccgttg 2824765

>dbj|AK110983.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-174-C11, full
            insert sequence
          Length = 2392

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 281  atatggagcttattgagttctgaactcgctgttg 314
            ||||||||||||||||| || |||||||| ||||
Sbjct: 2144 atatggagcttattgagctcagaactcgccgttg 2111

>emb|CR847832.18| Zebrafish DNA sequence from clone DKEY-30K23 in linkage group 8,
             complete sequence
          Length = 135277

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 41    ttccgttttgtacattattgt 61
             |||||||||||||||||||||
Sbjct: 96888 ttccgttttgtacattattgt 96868

>gb|AC165050.2| Phakopsora pachyrhizi clone JGIAFNA-1073N7, complete sequence
          Length = 42059

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 283  atggagcttattgagttctga 303
            |||||||||||||||||||||
Sbjct: 7399 atggagcttattgagttctga 7419

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 383     ggtcgcgctcgcgctgcttctccagggct 411
               |||||||||||  ||||||||||||||||
Sbjct: 4870128 ggtcgcgctcggcctgcttctccagggct 4870156

>ref|NM_187637.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1464

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 133 aaccccctccaactcttttgtaaa 156
           ||||||||||| ||||||||||||
Sbjct: 915 aaccccctccatctcttttgtaaa 892

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 422    gcagcatttggcctagctgagcac 445
              |||||||||||| |||||||||||
Sbjct: 234817 gcagcatttggcgtagctgagcac 234840

>emb|AL353796.16| Human DNA sequence from clone RP11-305E6 on chromosome 10 Contains the
             3' end of a novel gene (DKFZp434I138) (FLJ10486), a novel
             gene and a eukaryotic translation elongation factor 1
             alpha 1 (EEF1A1) pseudogene, complete sequence
          Length = 57316

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 442   gcacacagggatagaagttc 461
             ||||||||||||||||||||
Sbjct: 25306 gcacacagggatagaagttc 25325

>gb|AC097361.2| Homo sapiens chromosome 3 clone RP11-722P17, complete sequence
          Length = 175036

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   cccctccaactcttttgtaa 155
             ||||||||||||||||||||
Sbjct: 29510 cccctccaactcttttgtaa 29529

>emb|AL157399.14| Human DNA sequence from clone RP11-75M12 on chromosome 10q11.21-21.1
             Contains the PRKG1 gene for protein kinase cGMP-dependent
             type I, complete sequence
          Length = 104959

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 442   gcacacagggatagaagttc 461
             ||||||||||||||||||||
Sbjct: 71442 gcacacagggatagaagttc 71461

>gb|AY270838.1| Homo sapiens clone SKT05-D6 putative promoter sequence
          Length = 493

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 211 tactgccaagtccgagccct 230
           ||||||||||||||||||||
Sbjct: 455 tactgccaagtccgagccct 436

>gb|AY270796.1| Homo sapiens clone SKT05-A1 putative promoter sequence
          Length = 493

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 211 tactgccaagtccgagccct 230
           ||||||||||||||||||||
Sbjct: 39  tactgccaagtccgagccct 58

>gb|AC122177.2| Homo sapiens chromosome 3 clone RP11-411F11, complete sequence
          Length = 167908

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 cccctccaactcttttgtaa 155
           ||||||||||||||||||||
Sbjct: 111 cccctccaactcttttgtaa 130

>gb|AC036196.10| Homo sapiens chromosome 15, clone RP11-599A21, complete sequence
          Length = 180366

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 442    gcacacagggatagaagttc 461
              ||||||||||||||||||||
Sbjct: 112403 gcacacagggatagaagttc 112422

>gb|AC046168.12| Homo sapiens chromosome 15, clone RP11-307C19, complete sequence
          Length = 180484

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 356   tcctccctggagaggatctg 375
             ||||||||||||||||||||
Sbjct: 66124 tcctccctggagaggatctg 66143

>gb|AC073584.6| Homo sapiens chromosome 10 clone RP11-47O13, complete sequence
          Length = 171089

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    gcacacagggatagaagttc 461
              ||||||||||||||||||||
Sbjct: 123198 gcacacagggatagaagttc 123179

>gb|AC021829.8| Homo sapiens chromosome 11, clone RP11-436H16, complete sequence
          Length = 163497

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 442    gcacacagggatagaagttc 461
              ||||||||||||||||||||
Sbjct: 140687 gcacacagggatagaagttc 140706

>gb|AC005954.1|AC005954 Homo sapiens chromosome 19, cosmid R28784, complete sequence
          Length = 37225

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 211  tactgccaagtccgagccct 230
            ||||||||||||||||||||
Sbjct: 1123 tactgccaagtccgagccct 1104

>gb|AC115695.11| Mus musculus chromosome 5, clone RP24-229D18, complete sequence
          Length = 161430

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 343   gtgggcctcggggtcctccc 362
             ||||||||||||||||||||
Sbjct: 65810 gtgggcctcggggtcctccc 65791

>gb|AC016716.6| Homo sapiens BAC clone RP11-312I3 from 2, complete sequence
          Length = 214269

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    gcacacagggatagaagttc 461
              ||||||||||||||||||||
Sbjct: 104593 gcacacagggatagaagttc 104574

>gb|AC017079.5| Homo sapiens BAC clone RP11-462M9 from 2, complete sequence
          Length = 176075

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 80     acaacaacagcagtatatat 99
              ||||||||||||||||||||
Sbjct: 104094 acaacaacagcagtatatat 104113

>gb|AC040174.5| Homo sapiens chromosome 16 clone RP11-96H17, complete sequence
          Length = 175802

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 442   gcacacagggatagaagttc 461
             ||||||||||||||||||||
Sbjct: 99907 gcacacagggatagaagttc 99888

>gb|AC126345.11| Homo sapiens chromosome 11, clone RP11-100E23, complete sequence
          Length = 155913

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    tggtcgcaggcatgaacccc 138
              ||||||||||||||||||||
Sbjct: 122410 tggtcgcaggcatgaacccc 122391

>gb|AC011741.9| Homo sapiens BAC clone RP11-113E4 from 2, complete sequence
          Length = 141418

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 442   gcacacagggatagaagttc 461
             ||||||||||||||||||||
Sbjct: 79113 gcacacagggatagaagttc 79132

>dbj|AB158462.1| Oryza sativa (japonica cultivar-group) PAIR1 mRNA for coiled-coil
            protein, complete cds
          Length = 1705

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 133  aaccccctccaactcttttgtaaa 156
            ||||||||||| ||||||||||||
Sbjct: 1014 aaccccctccatctcttttgtaaa 991

>gb|AC151669.5| Mus musculus chromosome 5, clone RP23-44L13, complete sequence
          Length = 254022

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 343    gtgggcctcggggtcctccc 362
              ||||||||||||||||||||
Sbjct: 238483 gtgggcctcggggtcctccc 238464

>gb|AC006125.1|AC006125 Homo sapiens chromosome 19, cosmid R28778, complete sequence
          Length = 35492

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tactgccaagtccgagccct 230
             ||||||||||||||||||||
Sbjct: 32848 tactgccaagtccgagccct 32829

>ref|NG_000002.1| Homo sapiens immunoglobulin lambda locus (IGL@) on chromosome 22
          Length = 909203

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 676    aacaacagatgatgcaacac 695
              ||||||||||||||||||||
Sbjct: 805404 aacaacagatgatgcaacac 805423

>gb|AC155239.2| Mus musculus BAC clone RP24-462F23 from chromosome 14, complete sequence
          Length = 170006

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 85     aacagcagtatatatgaact 104
              ||||||||||||||||||||
Sbjct: 129433 aacagcagtatatatgaact 129452

>dbj|D87024.1| Homo sapiens immunoglobulin lambda gene locus DNA, clone:92H4
          Length = 41537

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 676  aacaacagatgatgcaacac 695
            ||||||||||||||||||||
Sbjct: 6507 aacaacagatgatgcaacac 6526


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,308,949
Number of Sequences: 3902068
Number of extensions: 5308949
Number of successful extensions: 86637
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86480
Number of HSP's gapped (non-prelim): 157
length of query: 726
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 703
effective length of database: 17,143,297,704
effective search space: 12051738285912
effective search space used: 12051738285912
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)