>gb|U40959.1| Caenorhabditis elegans cosmid B0310, complete sequence
          Length = 39130

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 42    taagcccttgaagatacatg 61
             ||||||||||||||||||||
Sbjct: 25707 taagcccttgaagatacatg 25726

>dbj|AB223280.1| Aspergillus oryzae cDNA, contig sequence: AoEST0111
          Length = 732

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 30  taccatcactactaagccct 49
           ||||||||||||||||||||
Sbjct: 349 taccatcactactaagccct 368

>dbj|AB223182.1| Aspergillus oryzae cDNA, contig sequence: AoEST0013
          Length = 732

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 30  taccatcactactaagccct 49
           ||||||||||||||||||||
Sbjct: 146 taccatcactactaagccct 165

>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 30      taccatcactactaagccct 49
               ||||||||||||||||||||
Sbjct: 1917019 taccatcactactaagccct 1917000

>gb|AC097494.3| Homo sapiens BAC clone RP11-273B19 from 4, complete sequence
          Length = 144135

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    cagctctgctttattccaag 82
             ||||||||||||||||||||
Sbjct: 39528 cagctctgctttattccaag 39547

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 113     ggcagtgacggcacgatct 131
               |||||||||||||||||||
Sbjct: 2230637 ggcagtgacggcacgatct 2230655

>gb|AC024957.9| Mus musculus chromosome 16, clone RP23-178A24, complete sequence
          Length = 229563

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 74    tattccaagaaatgaagat 92
             |||||||||||||||||||
Sbjct: 81505 tattccaagaaatgaagat 81487

>gb|AC098728.3| Mus musculus BAC clone RP23-3H22 from 15, complete sequence
          Length = 245757

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 43     aagcccttgaagatacatg 61
              |||||||||||||||||||
Sbjct: 128514 aagcccttgaagatacatg 128496

>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 59      atggcagctctgctttatt 77
               |||||||||||||||||||
Sbjct: 3834126 atggcagctctgctttatt 3834108

>gb|AC021761.8| Homo sapiens chromosome 11, clone RP11-361M6, complete sequence
          Length = 182789

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 78     ccaagaaatgaagatcatc 96
              |||||||||||||||||||
Sbjct: 113362 ccaagaaatgaagatcatc 113344

>dbj|AK042365.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630085E16 product:hypothetical protein,
           full insert sequence
          Length = 2492

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 47  ccttgaagatacatggcag 65
           |||||||||||||||||||
Sbjct: 908 ccttgaagatacatggcag 926

>gb|AC013265.7| Homo sapiens BAC clone RP11-197H3 from 2, complete sequence
          Length = 151721

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 26/27 (96%), Gaps = 1/27 (3%)
 Strand = Plus / Plus

                                        
Query: 66    ctctgctttat-tccaagaaatgaaga 91
             ||||||||||| |||||||||||||||
Sbjct: 36186 ctctgctttatctccaagaaatgaaga 36212

>gb|BC084926.1| Xenopus laevis hypothetical LOC495416, mRNA (cDNA clone
            IMAGE:6862501), partial cds
          Length = 1686

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 65   gctctgctttattccaagaaatg 87
            ||||||||||| |||||||||||
Sbjct: 1068 gctctgctttactccaagaaatg 1090

>emb|CT009632.14| Mouse DNA sequence from clone RP23-5G10 on chromosome 16, complete
             sequence
          Length = 208600

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 74    tattccaagaaatgaagat 92
             |||||||||||||||||||
Sbjct: 37671 tattccaagaaatgaagat 37653

>gb|BC110927.1| Xenopus laevis cDNA clone MGC:132056 IMAGE:6857297, complete cds
          Length = 3706

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 65   gctctgctttattccaagaaatg 87
            ||||||||||| |||||||||||
Sbjct: 1041 gctctgctttactccaagaaatg 1063

>emb|AL607039.25| Mouse DNA sequence from clone RP23-313J14 on chromosome 11, complete
             sequence
          Length = 147376

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    ccttgaagatacatggcag 65
             |||||||||||||||||||
Sbjct: 33347 ccttgaagatacatggcag 33329


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,105,797
Number of Sequences: 3902068
Number of extensions: 1105797
Number of successful extensions: 75712
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 75650
Number of HSP's gapped (non-prelim): 63
length of query: 145
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 124
effective length of database: 17,151,101,840
effective search space: 2126736628160
effective search space used: 2126736628160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)