ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal13h15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ234421.1|HVU234421 Hordeum vulgare partial mRNA; clone cMW... 345 3e-92
2gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 42 0.58
3gb|AC101775.10| Mus musculus chromosome 19, clone RP24-116B5, co... 40 2.3
4emb|AL591069.5| Human DNA sequence from clone RP11-72O9 on chrom... 40 2.3
5emb|AL359714.18| Human DNA sequence from clone RP11-22A15 on chr... 40 2.3
6ref|XM_231251.3| PREDICTED: Rattus norvegicus G protein-coupled ... 40 2.3
7gb|AC005592.1| Homo sapiens chromosome 5, BAC clone 79a6 (LBNL H... 38 9.0
8gb|AC146000.4| Pan troglodytes BAC clone RP43-147L18 from 7, com... 38 9.0
9gb|AY601819.1| Homo sapiens fibroblast growth factor 1 (acidic) ... 38 9.0
10gb|AY848690.1| Microplitis demolitor bracovirus segment B, compl... 38 9.0
11gb|AC155929.6| Mus musculus BAC clone RP24-75H6 from chromosome ... 38 9.0
12gb|AC158910.3| Mus musculus chromosome 1, clone RP23-181P16, com... 38 9.0
13gb|AC160021.3| Pan troglodytes BAC clone CH251-564M21 from chrom... 38 9.0
14emb|AL645569.21| Mouse DNA sequence from clone RP23-96I9 on chro... 38 9.0
15emb|AL663033.10| Mouse DNA sequence from clone RP23-78H18 on chr... 38 9.0
16gb|AC153141.7| Mus musculus BAC clone RP23-268A17 from chromosom... 38 9.0
17gb|AC119867.11| Mus musculus chromosome 1, clone RP23-411L6, com... 38 9.0
18gb|AC171180.2| Pan troglodytes BAC clone CH251-283C10 from chrom... 38 9.0

>emb|AJ234421.1|HVU234421 Hordeum vulgare partial mRNA; clone cMWG0682
          Length = 577

 Score =  345 bits (174), Expect = 3e-92
 Identities = 180/183 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgatggttatgtctcagcatncaacaatccaatcagtctcattatcaccatggttctat 60
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 525 atgatggttatgtctcagcatccaacaatccaatcagtctcattatcaccatggttctat 466

                                                                       
Query: 61  gtcctaatcagctctcagcttcacagactgcagctncagcagtatgtacacaagcctgct 120
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 465 gtcctaatcagctctcagcttcacagactgcagctacagcagtatgtacacaagcctgct 406

                                                                       
Query: 121 tacagatgctttctaccacgagcaaacctngtccctatgtcctcatctgcaagcgcgagc 180
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 405 tacagatgctttctaccacgagcaaacctcgtccctatgtcctcatctgcaagcgcgagc 346

              
Query: 181 gtc 183
           |||
Sbjct: 345 gtc 343



to top

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 25    acaatccaatcagtctcattatcac 49
             ||||||||||||||||| |||||||
Sbjct: 18436 acaatccaatcagtctctttatcac 18460



to top

>gb|AC101775.10| Mus musculus chromosome 19, clone RP24-116B5, complete sequence
          Length = 167945

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   ttacagatgctttctaccac 139
             ||||||||||||||||||||
Sbjct: 28399 ttacagatgctttctaccac 28418



to top

>emb|AL591069.5| Human DNA sequence from clone RP11-72O9 on chromosome 6q25.2-26
             Contains the 3' end of the SSLC22A3 gene for solute
             carrier family 22 (extraneuronal monoamine transporter),
             member 3 (extraneuronal monoamine transporter solute
             carrier family 22 (organic cation transporter), member
             3(EMT, EMTh, OCT3)), the APOARGC gene for apolipoprotein
             (a) related gene C and a plasminogen (PLG) pseudogene,
             complete sequence
          Length = 162083

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    tcctaatcagctctcagctt 81
             ||||||||||||||||||||
Sbjct: 42585 tcctaatcagctctcagctt 42566



to top

>emb|AL359714.18| Human DNA sequence from clone RP11-22A15 on chromosome 6 Contains part of
              the BAI3 gene for brain-specific angiogenesis inhibitor 3,
              complete sequence
          Length = 156129

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 155    ctatgtcctcatctgcaagc 174
              ||||||||||||||||||||
Sbjct: 141096 ctatgtcctcatctgcaagc 141077



to top

>ref|XM_231251.3| PREDICTED: Rattus norvegicus G protein-coupled receptor 21
           (predicted) (Gpr21_predicted), mRNA
          Length = 3247

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 64  ctaatcagctctcagcttca 83
           ||||||||||||||||||||
Sbjct: 327 ctaatcagctctcagcttca 346



to top

>gb|AC005592.1| Homo sapiens chromosome 5, BAC clone 79a6 (LBNL H172), complete
             sequence
          Length = 90693

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 102   gtatgtacacaagcctgct 120
             |||||||||||||||||||
Sbjct: 61037 gtatgtacacaagcctgct 61019



to top

>gb|AC146000.4| Pan troglodytes BAC clone RP43-147L18 from 7, complete sequence
          Length = 176192

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 28    atccaatcagtctcattatcacc 50
             ||||||||||| |||||||||||
Sbjct: 49410 atccaatcagtatcattatcacc 49432



to top

>gb|AY601819.1| Homo sapiens fibroblast growth factor 1 (acidic) (FGF1) gene,
           complete cds
          Length = 96437

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 102 gtatgtacacaagcctgct 120
           |||||||||||||||||||
Sbjct: 887 gtatgtacacaagcctgct 869



to top

>gb|AY848690.1| Microplitis demolitor bracovirus segment B, complete sequence
          Length = 6307

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 33   atcagtctcattatcaccatggt 55
            ||||||||||||||||| |||||
Sbjct: 1947 atcagtctcattatcactatggt 1969



to top

>gb|AC155929.6| Mus musculus BAC clone RP24-75H6 from chromosome 10, complete sequence
          Length = 191193

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 151   gtccctatgtcctcatctg 169
             |||||||||||||||||||
Sbjct: 19034 gtccctatgtcctcatctg 19052



to top

>gb|AC158910.3| Mus musculus chromosome 1, clone RP23-181P16, complete sequence
          Length = 195115

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 152   tccctatgtcctcatctgc 170
             |||||||||||||||||||
Sbjct: 16270 tccctatgtcctcatctgc 16252



to top

>gb|AC160021.3| Pan troglodytes BAC clone CH251-564M21 from chromosome unknown,
             complete sequence
          Length = 201789

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 102   gtatgtacacaagcctgct 120
             |||||||||||||||||||
Sbjct: 58500 gtatgtacacaagcctgct 58482



to top

>emb|AL645569.21| Mouse DNA sequence from clone RP23-96I9 on chromosome 11 Contains the
             5' end of the gene for a novel protein similar to rat
             rabphilin-3a related protein, two novel genes and two CpG
             islands, complete sequence
          Length = 131144

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    gttctatgtcctaatcagc 72
             |||||||||||||||||||
Sbjct: 87418 gttctatgtcctaatcagc 87400



to top

>emb|AL663033.10| Mouse DNA sequence from clone RP23-78H18 on chromosome 11 Contains the
             5' end of a novel gene (2410004F01Rik), a novel gene, part
             of a novel gene (9630013K17Rik), a novel gene and a CpG
             island, complete sequence
          Length = 126191

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    ctctcagcttcacagactg 90
             |||||||||||||||||||
Sbjct: 52193 ctctcagcttcacagactg 52211



to top

>gb|AC153141.7| Mus musculus BAC clone RP23-268A17 from chromosome 10, complete sequence
          Length = 221824

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 151    gtccctatgtcctcatctg 169
              |||||||||||||||||||
Sbjct: 150882 gtccctatgtcctcatctg 150900



to top

>gb|AC119867.11| Mus musculus chromosome 1, clone RP23-411L6, complete sequence
          Length = 215781

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 152    tccctatgtcctcatctgc 170
              |||||||||||||||||||
Sbjct: 126148 tccctatgtcctcatctgc 126130



to top

>gb|AC171180.2| Pan troglodytes BAC clone CH251-283C10 from chromosome unknown, complete
              sequence
          Length = 166310

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 102    gtatgtacacaagcctgct 120
              |||||||||||||||||||
Sbjct: 114725 gtatgtacacaagcctgct 114707


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,127,866
Number of Sequences: 3902068
Number of extensions: 1127866
Number of successful extensions: 75433
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75399
Number of HSP's gapped (non-prelim): 34
length of query: 183
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 161
effective length of database: 17,147,199,772
effective search space: 2760699163292
effective search space used: 2760699163292
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top