ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal13d09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_466527.1| Oryza sativa (japonica cultivar-group), mRNA 696 0.0
2ref|XM_507491.1| PREDICTED Oryza sativa (japonica cultivar-group... 696 0.0
3ref|XM_506850.2| PREDICTED Oryza sativa (japonica cultivar-group... 696 0.0
4dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 696 0.0
5dbj|AP004023.3| Oryza sativa (japonica cultivar-group) genomic D... 696 0.0
6dbj|AK064937.1| Oryza sativa (japonica cultivar-group) cDNA clon... 696 0.0
7gb|AF145053.1|AF145053 Oryza sativa chloroplast translational el... 692 0.0
8dbj|AK104785.1| Oryza sativa (japonica cultivar-group) cDNA clon... 688 0.0
9dbj|AK119587.1| Oryza sativa (japonica cultivar-group) cDNA clon... 680 0.0
10gb|AF327413.1|AF327413 Oryza sativa translational elongation fac... 648 0.0
11gb|BT018667.1| Zea mays clone EL01N0510C05.d mRNA sequence 624 e-176
12gb|AY105509.1| Zea mays PCO100031 mRNA sequence 593 e-166
13ref|XM_466528.1| Oryza sativa (japonica cultivar-group), mRNA 295 1e-76
14dbj|AK066858.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 1e-76
15emb|X89058.1|GMRNAEFTU G.max DNA for EF-Tu chloroplast specific ... 129 1e-26
16gb|AF234537.1|AF234537 Pelargonium graveolens chloroplast transl... 125 2e-25
17emb|Y15108.1|GMTUFB2 Glycine max tufB2 gene 109 1e-20
18gb|CP000110.1| Synechococcus sp. CC9605, complete genome 105 2e-19
19gb|AY107645.1| Zea mays PCO100030 mRNA sequence 105 2e-19
20emb|Y14561.1|PSY14561 Pisum sativum mRNA for choloroplast transl... 103 8e-19
21gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 100 1e-17
22dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 96 2e-16
23emb|X98830.1|PRFUSTUF P.rosea fus, tuf, rpsJ and rplC genes 90 1e-14
24gb|U67308.1|PRU67308 Planobispora rosea elongation factor Tu1 (t... 90 1e-14
25emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segmen... 88 4e-14
26gb|AF109211.1|AF109211 Synechococcus WH8103 elongation factor Tu... 88 4e-14
27gb|AY083613.1| Pisum sativum translation elongation factor (tufA... 86 2e-13
28emb|X77039.1|SCTUF1FUS S.coelicolor tuf1 and fus genes 86 2e-13
29emb|X67057.1|SRTUF1 S.ramocissimus tuf1 gene for elongation fact... 86 2e-13
30emb|X66062.1|GMTUFA G.max tufA gene for chloroplast translation ... 86 2e-13
31emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete ... 86 2e-13
32gb|CP000249.1| Frankia sp. CcI3, complete genome 86 2e-13
33gb|S79408.1| tuf1=elongation factor Tu1 [Streptomyces collinus, ... 86 2e-13
34gb|AF153618.1|AF153618 Streptomyces netropsis elongation factor ... 86 2e-13
35dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 86 2e-13
36gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 80 1e-11
37ref|XM_323038.1| Neurospora crassa OR74A hypothetical protein ( ... 80 1e-11
38ref|XM_956420.1| Neurospora crassa OR74A hypothetical protein ( ... 80 1e-11
39gb|AY372040.1| Lactobacillus paracasei strain NCC 2461 Tuf gene,... 80 1e-11
40gb|AY372039.1| Lactobacillus paracasei strain NCC 989 Tuf gene, ... 80 1e-11
41emb|AJ459399.1|LPA459399 Lactobacillus paracasei subsp. paracase... 80 1e-11
42emb|AJ459398.1|LPA459398 Lactobacillus paracasei subsp. paracase... 80 1e-11
43emb|AJ459397.1|LPA459397 Lactobacillus paracasei subsp. paracase... 80 1e-11
44emb|AJ459396.1|LPA459396 Lactobacillus paracasei subsp. paracase... 80 1e-11
45emb|AJ459395.1|LPA459395 Lactobacillus paracasei subsp. tolerans... 80 1e-11
46emb|AJ459394.1|LPA459394 Lactobacillus paracasei subsp. paracase... 80 1e-11
47emb|AJ459393.1|LPA459393 Lactobacillus paracasei subsp. paracase... 80 1e-11
48emb|AJ459392.1|LPA459392 Lactobacillus paracasei subsp. paracase... 80 1e-11
49emb|AJ459391.1|LPA459391 Lactobacillus paracasei subsp. paracase... 80 1e-11
50emb|AJ459389.1|LPA459389 Lactobacillus paracasei subsp. paracase... 80 1e-11
51emb|AJ459388.1|LPA459388 Lactobacillus paracasei subsp. paracase... 80 1e-11
52emb|AJ459387.1|LZE459387 Lactobacillus zeae partial mRNA for put... 80 1e-11
53emb|AJ459386.1|LCA459386 Lactobacillus casei partial mRNA for pu... 80 1e-11
54emb|AJ459385.1|LPA459385 Lactobacillus paracasei subsp. paracase... 80 1e-11
55emb|AJ418937.2|LCA418937 Lactobacillus paracasei subsp. paracase... 80 1e-11
56emb|AJ418923.2|LCA418923 Lactobacillus casei partial mRNA for pu... 80 1e-11
57emb|AJ418922.2|LCA418922 Lactobacillus paracasei subsp. tolerans... 80 1e-11
58emb|AJ418912.2|LCA418912 Lactobacillus casei subsp. pseudoplanta... 80 1e-11
59gb|AF368284.1|AF368284 Streptomyces aureofaciens strain 84/25 el... 80 1e-11
60emb|AL513467.1|NC17E5 Neurospora crassa DNA linkage group V Cosm... 80 1e-11
61gb|AF007125.1|AF007125 Streptomyces aureofaciens elongation fact... 78 4e-11
62gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 76 2e-10
63gb|CP000097.1| Synechococcus sp. CC9902, complete genome 76 2e-10
64gb|U09443.1|PEU09443 Phormidium ectocarpi PCC 7375 protein synth... 76 2e-10
65gb|AY372038.1| Lactobacillus casei strain NCC 2508 Tuf gene, par... 72 3e-09
66emb|X76871.1|TCHOE5TUF T.cuprinus (Hoe5) tuf gene 72 3e-09
67emb|AJ459390.1|LCA459390 Lactobacillus casei subsp. casei partia... 72 3e-09
68emb|AJ418933.2|LZE418933 Lactobacillus zeae partial mRNA for put... 72 3e-09
69gb|AY860112.1| Micromonospora sp. ATCC 39149 RpsL (rpsL), RpsG (... 72 3e-09
70gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome 70 1e-08
71dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome 70 1e-08
72gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 68 4e-08
73gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 68 4e-08
74gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 68 4e-08
75gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 68 4e-08
76gb|U09444.1|PBU09444 Plectonema boryanum PCC 73110 protein synth... 68 4e-08
77ref|NM_118155.2| Arabidopsis thaliana ATP binding / GTP binding ... 66 2e-07
78gb|BT000998.1| Arabidopsis thaliana clone U19264 putative transl... 66 2e-07
79gb|BT000699.1| Arabidopsis thaliana putative chloroplast transla... 66 2e-07
80gb|BT000687.1| Arabidopsis thaliana clone RAFL09-18-H05 (R09411)... 66 2e-07
81gb|AY074355.1| Arabidopsis thaliana putative translation elongat... 66 2e-07
82emb|X52256.1|ATTUFA A.thaliana tufA gene for elongation factor Tu 66 2e-07
83emb|CR628336.1| Legionella pneumophila str. Paris complete genome 66 2e-07
84emb|AL161552.2|ATCHRIV52 Arabidopsis thaliana DNA chromosome 4, ... 66 2e-07
85emb|AL080253.2|ATF9F13 Arabidopsis thaliana DNA chromosome 4, BA... 66 2e-07
86gb|AF419609.1|AF419609 Arabidopsis thaliana AT4g20360/F9F13_10 m... 66 2e-07
87gb|AF410329.1|AF410329 Arabidopsis thaliana AT4g20360/F9F13_10 m... 66 2e-07
88emb|BX827505.1|CNS0A2SS Arabidopsis thaliana Full-length cDNA Co... 66 2e-07
89gb|BT002642.1| Arabidopsis thaliana At4g20360/F9F13_10 gene, com... 66 2e-07
90emb|X17442.1|ANORF150 A.nidulans DNA for a region containing ORF... 64 7e-07
91dbj|AP007154.1| Aspergillus oryzae RIB40 genomic DNA, SC001 64 7e-07
92dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 64 7e-07
93dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 64 7e-07
94gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 64 7e-07
95dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 64 7e-07
96emb|X76869.1|PN20475 P.niger (DSM 20475) tuf gene 64 7e-07
97gb|AF153617.1|AF153617 Streptomyces mobaraensis elongation facto... 64 7e-07
98gb|U78300.1|TCU78300 Thiobacillus cuprinus complete streptomycin... 64 7e-07
99gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 64 7e-07
100gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 62 3e-06
101emb|Z99104.2|BSUB0001 Bacillus subtilis complete genome (section... 62 3e-06
102emb|X98831.1|SCFUSTUF S.cinnamoneus fus and tuf genes 62 3e-06
103dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome 62 3e-06
104dbj|D64127.1| Bacillus subtilis genes for RNA polymerase beta su... 62 3e-06
105dbj|AB017508.1| Bacillus halodurans C-125 genomic DNA, 32 kb fra... 62 3e-06
106gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome 60 1e-05
107emb|AJ781773.3| Lactobacillus buchneri partial tuf gene for elon... 60 1e-05
108gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 60 1e-05
109gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 60 1e-05
110gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 60 1e-05
111gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 60 1e-05
112emb|AL111934.1|CNS019PI Botrytis cinerea strain T4 cDNA library 60 1e-05
113dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete ge... 60 1e-05
114gb|U09445.1|PHU09445 Prochlorothrix hollandica protein synthesis... 60 1e-05
115gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 58 4e-05
116gb|U09434.1|GSU09434 Gloeothece PCC6501 protein synthesis elonga... 58 4e-05
117gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete... 56 2e-04
118gb|AY372037.1| Lactobacillus rhamnosus strain NCC 2504 Tuf gene,... 56 2e-04
119gb|AY305397.1| Synthetic construct reconstructed ancestral elong... 56 2e-04
120emb|Y15107.1|GMTUFA2 Glycine max tufA2 gene 56 2e-04
121emb|X77033.1|CVTUF Chlorobium vibrioforme tuf gene for elongatio... 56 2e-04
122emb|X76867.1|FF13524 F.ferrugineum (DSM 13524) tuf gene 56 2e-04
123emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome 56 2e-04
124emb|AJ786714.1| Lactobacillus kimchii partial tuf gene for elong... 56 2e-04
125emb|AJ786713.1| Lactobacillus alimentarius partial tuf gene for ... 56 2e-04
126emb|AJ459829.1|LRH459829 Lactobacillus rhamnosus partial tuf gen... 56 2e-04
127emb|AJ459828.1|LRH459828 Lactobacillus rhamnosus partial tuf gen... 56 2e-04
128emb|AJ418939.2|LRH418939 Lactobacillus rhamnosus partial mRNA fo... 56 2e-04
129emb|AJ418930.2|LAG418930 Lactobacillus agilis partial mRNA for p... 56 2e-04
130emb|AJ418920.2|LPE418920 Lactobacillus pentosus partial mRNA for... 56 2e-04
131gb|AE006470.1| Chlorobium tepidum TLS, complete genome 56 2e-04
132gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 56 2e-04
133dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 56 2e-04
134gb|DQ098151.1| Uncultured Pseudonocardia sp. clone colony 30 Tuf... 54 6e-04
135gb|DQ098149.1| Uncultured Pseudonocardia sp. clone colony 168 Tu... 54 6e-04
136gb|DQ098148.1| Uncultured Pseudonocardia sp. clone colony 167 Tu... 54 6e-04
137gb|DQ098147.1| Uncultured Pseudonocardia sp. clone colony SP0110... 54 6e-04
138gb|DQ098146.1| Uncultured Pseudonocardia sp. clone colony CC0301... 54 6e-04
139gb|DQ098143.1| Uncultured Pseudonocardia sp. clone colony CC0103... 54 6e-04
140gb|DQ098141.1| Uncultured Pseudonocardia sp. clone colony 33 Tuf... 54 6e-04
141gb|DQ098140.1| Uncultured Pseudonocardia sp. clone colony 101 Tu... 54 6e-04
142gb|DQ098139.1| Uncultured Pseudonocardia sp. clone colony 12 Tuf... 54 6e-04
143gb|DQ098138.1| Uncultured Pseudonocardia sp. clone colony 21 Tuf... 54 6e-04
144gb|DQ098136.1| Uncultured Pseudonocardia sp. clone colony 31 Tuf... 54 6e-04
145gb|DQ098135.1| Uncultured Pseudonocardia sp. clone colony 113 Tu... 54 6e-04
146gb|DQ098134.1| Uncultured Pseudonocardia sp. clone colony 174 Tu... 54 6e-04
147gb|DQ098133.1| Uncultured Pseudonocardia sp. clone colony 38 Tuf... 54 6e-04
148gb|DQ098132.1| Uncultured Pseudonocardia sp. clone colony 43 Tuf... 54 6e-04
149gb|DQ098129.1| Uncultured Pseudonocardia sp. clone colony 48 Tuf... 54 6e-04
150gb|DQ098126.1| Uncultured Pseudonocardia sp. clone colony 117 Tu... 54 6e-04
151gb|DQ098123.1| Uncultured Pseudonocardia sp. clone colony 20 Tuf... 54 6e-04
152gb|DQ098122.1| Uncultured Pseudonocardia sp. clone colony 44 Tuf... 54 6e-04
153gb|DQ098121.1| Uncultured Pseudonocardia sp. clone colony 170 Tu... 54 6e-04
154gb|DQ098120.1| Uncultured Pseudonocardia sp. clone colony 24 Tuf... 54 6e-04
155gb|DQ098119.1| Uncultured Pseudonocardia sp. clone colony 10 Tuf... 54 6e-04
156gb|DQ098118.1| Uncultured Pseudonocardia sp. clone colony 13 Tuf... 54 6e-04
157ref|XM_387358.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 54 6e-04
158emb|X76863.1|BL20425 B.linens (DSM 20425) tuf gene 54 6e-04
159emb|AL596173.1| Listeria innocua Clip11262 complete genome, segm... 54 6e-04
160emb|AL591984.1| Listeria monocytogenes strain EGD, complete geno... 54 6e-04
161gb|AF274746.1|AF274746 Listeria monocytogenes elongation factor ... 54 6e-04
162gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete ge... 54 6e-04
163gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 52 0.002
164ref|XM_362579.1| Magnaporthe grisea 70-15 hypothetical protein (... 52 0.002
165emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 52 0.002
166emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete ch... 52 0.002
167gb|AY305396.1| Synthetic construct reconstructed ancestral elong... 52 0.002
168emb|X63539.1|MTTUF M.tuberculosis tuf gene for elongation factor TU 52 0.002
169gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete seq... 52 0.002
170emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome... 52 0.002
171emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 52 0.002
172emb|AJ786715.1| Lactobacillus farciminis partial tuf gene for el... 52 0.002
173dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, compl... 52 0.002
174dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 52 0.002
175gb|AE004843.1| Pseudomonas aeruginosa PAO1, section 404 of 529 o... 52 0.002
176gb|AE004842.1| Pseudomonas aeruginosa PAO1, section 403 of 529 o... 52 0.002
177dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 52 0.002
178gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequ... 52 0.002
179gb|AD000005.1|MSGY42 Mycobacterium tuberculosis sequence from cl... 52 0.002
180gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 50 0.010
181gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 50 0.010
182gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 50 0.010
183gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 50 0.010
184gb|CP000001.1| Bacillus cereus E33L, complete genome 50 0.010
185gb|CP000088.1| Thermobifida fusca YX, complete genome 50 0.010
186emb|AJ544131.1|PCA544131 Pleurochrysis carterae chloroplast part... 50 0.010
187emb|AJ418919.2|LDE418919 Lactobacillus delbrueckii subsp. lactis... 50 0.010
188emb|AJ418911.2|LDE418911 Lactobacillus delbrueckii subsp. delbru... 50 0.010
189emb|AJ418910.2|LDE418910 Lactobacillus delbrueckii subsp. bulgar... 50 0.010
190gb|AE005800.1| Caulobacter crescentus CB15 section 126 of 359 of... 50 0.010
191gb|AE005984.1| Caulobacter crescentus CB15 section 310 of 359 of... 50 0.010
192gb|AF176664.1|AF176664 EDTA-degrading bacterium BNC1 EDTA degrad... 50 0.010
193gb|AF274736.1|AF274736 Enterococcus saccharolyticus elongation f... 50 0.010
194gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 50 0.010
195gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 50 0.010
196emb|AM049970.1| Udotea orientalis plastid partial tufA gene for ... 50 0.010
197gb|M94204.1|TOBTEFTU Nicotiana tabacum translation elongation fa... 50 0.010
198dbj|D11469.1|TOBTUFA2 Nicotiana sylvestris tufA gene for chlorop... 50 0.010
199dbj|D11375.1|TOBTUFA N. sylvestris tufA gene for chloroplast elo... 50 0.010
200ref|XM_631056.1| Dictyostelium discoideum hypothetical protein (... 48 0.039
201gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 48 0.039
202gb|AY582542.1| Streptococcus dysgalactiae strain CCRI-14550 elon... 48 0.039
203gb|AY582541.1| Streptococcus dysgalactiae strain CCRI-14549 elon... 48 0.039
204gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome 48 0.039
205gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome 48 0.039
206gb|BT014591.1| Lycopersicon esculentum clone 134061F, mRNA sequence 48 0.039
207gb|AY372042.1| Bifidobacterium longum strain ATCC 15707 Tuf gene... 48 0.039
208gb|AE004124.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 48 0.039
209gb|AE004120.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 48 0.039
210gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome 48 0.039
211emb|X52383.1|TCEF1A Thermococcus celer EF-1a gene for elongation... 48 0.039
212gb|AY845412.1| Neochlamydia hartmannellae translation elongation... 48 0.039
213emb|CR628337.1| Legionella pneumophila str. Lens complete genome 48 0.039
214emb|BX572603.1| Rhodopseudomonas palustris CGA009 complete genom... 48 0.039
215emb|BX572100.1| Prochlorococcus marinus MIT9313 complete genome;... 48 0.039
216emb|AJ555814.1|PGI555814 Porphyromonas gingivalis partial ef-tu ... 48 0.039
217emb|AJ544132.1|PDE544132 Pleurochrysis dentata chloroplast parti... 48 0.039
218gb|AE011727.1| Xanthomonas axonopodis pv. citri str. 306, secti... 48 0.039
219gb|AE011726.1| Xanthomonas axonopodis pv. citri str. 306, secti... 48 0.039
220gb|AE010001.1| Streptococcus pyogenes strain MGAS8232, section 4... 48 0.039
221gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 48 0.039
222gb|AF274733.1|AF274733 Enterococcus pseudoavium strain ATCC49372... 48 0.039
223dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome 48 0.039
224gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 48 0.039
225gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome 48 0.039
226gb|DQ098150.1| Uncultured Pseudonocardia sp. clone colony 219 Tu... 46 0.15
227gb|DQ098145.1| Uncultured Pseudonocardia sp. clone colony UGM020... 46 0.15
228gb|DQ098144.1| Uncultured Pseudonocardia sp. clone colony CC0112... 46 0.15
229gb|DQ098142.1| Uncultured Pseudonocardia sp. clone colony CC0301... 46 0.15
230gb|DQ098137.1| Uncultured Pseudonocardia sp. clone colony 34 Tuf... 46 0.15
231gb|DQ098131.1| Uncultured Pseudonocardia sp. clone colony 112 Tu... 46 0.15
232gb|DQ098130.1| Uncultured Pseudonocardia sp. clone colony 35 Tuf... 46 0.15
233gb|DQ098128.1| Uncultured Pseudonocardia sp. clone colony 134 Tu... 46 0.15
234gb|DQ098127.1| Uncultured Pseudonocardia sp. clone colony 26 Tuf... 46 0.15
235gb|DQ098125.1| Uncultured Pseudonocardia sp. clone colony 168 Tu... 46 0.15
236gb|DQ098124.1| Uncultured Pseudonocardia sp. clone colony 47 Tuf... 46 0.15
237gb|DQ414204.1| Staphylococcus aureus strain H116 TufA (tufA) gen... 46 0.15
238gb|DQ414203.1| Staphylococcus aureus strain D547 TufA (tufA) gen... 46 0.15
239gb|DQ414202.1| Staphylococcus aureus strain H591 TufA (tufA) gen... 46 0.15
240gb|DQ414201.1| Staphylococcus aureus strain C2 TufA (tufA) gene,... 46 0.15
241gb|DQ414200.1| Staphylococcus aureus strain H466 TufA (tufA) gen... 46 0.15
242gb|DQ414199.1| Staphylococcus aureus strain EMRSA3 TufA (tufA) g... 46 0.15
243gb|DQ414198.1| Staphylococcus aureus strain D535 TufA (tufA) gen... 46 0.15
244gb|DQ414197.1| Staphylococcus aureus strain D97 TufA (tufA) gene... 46 0.15
245gb|DQ414196.1| Staphylococcus aureus strain H560 TufA (tufA) gen... 46 0.15
246gb|DQ414195.1| Staphylococcus aureus strain H417 TufA (tufA) gen... 46 0.15
247gb|DQ414194.1| Staphylococcus aureus strain H707 TufA (tufA) gen... 46 0.15
248gb|DQ414193.1| Staphylococcus aureus strain H295 TufA (tufA) gen... 46 0.15
249gb|DQ414192.1| Staphylococcus aureus strain H831 TufA (tufA) gen... 46 0.15
250gb|DQ414191.1| Staphylococcus aureus strain C101 TufA (tufA) gen... 46 0.15
251gb|DQ414190.1| Staphylococcus aureus strain C437 TufA (tufA) gen... 46 0.15
252gb|DQ414189.1| Staphylococcus aureus strain EMRSA9 TufA (tufA) g... 46 0.15
253gb|DQ414188.1| Staphylococcus aureus strain EMRSA4 TufA (tufA) g... 46 0.15
254gb|DQ414187.1| Staphylococcus aureus strain C720 TufA (tufA) gen... 46 0.15
255gb|DQ414186.1| Staphylococcus aureus strain C640 TufA (tufA) gen... 46 0.15
256gb|DQ414185.1| Staphylococcus aureus strain D17 TufA (tufA) gene... 46 0.15
257gb|DQ414184.1| Staphylococcus aureus strain D470 TufA (tufA) gen... 46 0.15
258gb|DQ414183.1| Staphylococcus aureus strain H512 TufA (tufA) gen... 46 0.15
259gb|DQ414182.1| Staphylococcus aureus strain D22 TufA (tufA) gene... 46 0.15
260gb|DQ414181.1| Staphylococcus aureus strain D274 TufA (tufA) gen... 46 0.15
261gb|DQ414180.1| Staphylococcus aureus strain H783 TufA (tufA) gen... 46 0.15
262gb|DQ414179.1| Staphylococcus aureus strain H402 TufA (tufA) gen... 46 0.15
263gb|DQ414178.1| Staphylococcus aureus strain D365 TufA (tufA) gen... 46 0.15
264gb|DQ414177.1| Staphylococcus aureus strain H19 TufA (tufA) gene... 46 0.15
265gb|DQ414176.1| Staphylococcus aureus strain D456 TufA (tufA) gen... 46 0.15
266emb|X66322.1|TAEFTUG T.aquaticus tufA and fus genes for elongati... 46 0.15
267gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 46 0.15
268emb|BX842654.1| Bdellovibrio bacteriovorus complete genome, stra... 46 0.15
269emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 46 0.15
270gb|AY741371.1| Emiliania huxleyi strain CCMP 373 chloroplast, co... 46 0.15
271dbj|AP006861.1| Chlamydophila felis Fe/C-56 DNA, complete genome 46 0.15
272gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 46 0.15
273gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 46 0.15
274dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 46 0.15
275dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, comple... 46 0.15
276gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete... 46 0.15
277dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticu... 46 0.15
278gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 46 0.15
279gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl... 46 0.15
280gb|AF298806.1|AF298806 Staphylococcus warneri translation elonga... 46 0.15
281gb|AF298804.1|AF298804 Staphylococcus saprophyticus translation ... 46 0.15
282gb|AF298803.1|AF298803 Staphylococcus lugdunensis translation el... 46 0.15
283gb|AF298802.1|AF298802 Staphylococcus hominis translation elonga... 46 0.15
284gb|AF298801.1|AF298801 Staphylococcus haemolyticus translation e... 46 0.15
285gb|AF298800.1|AF298800 Staphylococcus epidermidis translation el... 46 0.15
286gb|AF298798.1|AF298798 Staphylococcus capitis translation elonga... 46 0.15
287gb|AF298796.1|AF298796 Staphylococcus aureus translation elongat... 46 0.15
288gb|AF274747.1|AF274747 Listeria seeligeri elongation factor Tu (... 46 0.15
289gb|AF274740.1|AF274740 Staphylococcus epidermidis elongation fac... 46 0.15
290gb|AF274739.1|AF274739 Staphylococcus aureus elongation factor T... 46 0.15
291gb|AF274729.1|AF274729 Enterococcus malodoratus strain ATCC43197... 46 0.15
292gb|AF269681.1|AF269681 Staphylococcus epidermidis strain SR1 clo... 46 0.15
293gb|AF545609.1| Emiliania huxleyi elongation factor Tu (tufA) gen... 46 0.15
294dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 46 0.15
295dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 46 0.15
296gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome 46 0.15
297emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2... 46 0.15
298gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete g... 46 0.15
299emb|AJ938182.1| Staphylococcus aureus RF122 complete genome 46 0.15
300gb|AY266999.1| Streptococcus mitis ATCC 903 elongation factor Tu... 44 0.60
301gb|AY266998.1| Streptococcus mitis elongation factor Tu (tuf) ge... 44 0.60
302gb|AY266996.1| Streptococcus agalactiae CDCss-1073 elongation fa... 44 0.60
303gb|AY266993.1| Streptococcus agalactiae ATCC 12403 elongation fa... 44 0.60
304gb|AF276274.1| Streptococcus sanguinis elongation factor Tu (tuf... 44 0.60
305gb|AF276269.1| Streptococcus mitis elongation factor Tu (tuf) ge... 44 0.60
306gb|AF276263.1| Streptococcus dysgalactiae elongation factor Tu (... 44 0.60
307gb|AF276261.2| Streptococcus cristatus elongation factor Tu (tuf... 44 0.60
308gb|AF276256.1| Streptococcus agalactiae elongation factor Tu (tu... 44 0.60
309gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome 44 0.60
310gb|AE006416.1| Lactococcus lactis subsp. lactis IL1403 section 1... 44 0.60
311gb|CP000114.1| Streptococcus agalactiae A909, complete genome 44 0.60
312gb|AY134478.1| Salmonella bongori strain ATCC 43975 elongation f... 44 0.60
313gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 44 0.60
314gb|AE014226.1| Streptococcus agalactiae 2603V/R section 36 of 10... 44 0.60
315gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome 44 0.60
316emb|X52497.1|CHCPSTR1 Cyanophora paradoxa cyanelle rps12, rps7 a... 44 0.60
317emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 44 0.60
318emb|BX294146.1| Pirellula sp. strain 1 complete genome; segment ... 44 0.60
319emb|AL766847.1|SAG766847 Streptococcus agalactiae NEM316 complet... 44 0.60
320emb|AJ891030.1| Lactobacillus parabuchneri partial tuf gene for ... 44 0.60
321gb|CP000264.1| Jannaschia sp. CCS1, complete genome 44 0.60
322gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete ... 44 0.60
323gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 44 0.60
324ref|NM_059468.2| Caenorhabditis elegans MeDiaTor family member (... 44 0.60
325gb|AC006625.1| Caenorhabditis elegans cosmid C55B7, complete seq... 44 0.60
326gb|AF274745.1|AF274745 Lactococcus lactis elongation factor Tu (... 44 0.60
327gb|AF545608.1| Rhodomonas abbreviata elongation factor Tu (tufA)... 44 0.60
328emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 44 0.60
329gb|AE000520.1| Treponema pallidum subsp. pallidum str. Nichols c... 44 0.60
330gb|U30821.1|CPU30821 Cyanophora paradoxa cyanelle, complete genome 44 0.60
331gb|AC116505.13| Mus musculus chromosome 5, clone RP24-302O2, com... 42 2.4
332gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome 42 2.4
333gb|AE010322.1| Methanopyrus kandleri AV19 section 21 of 157 of t... 42 2.4
334gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 42 2.4
335gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 42 2.4
336gb|AE009149.1| Agrobacterium tumefaciens str. C58 circular chrom... 42 2.4
337gb|AE009147.1| Agrobacterium tumefaciens str. C58 circular chrom... 42 2.4
338gb|AY957604.1| Pseudomonas putida EF-Tu-1 gene, complete cds 42 2.4
339emb|CR710932.2|CNS0GBI8 Tetraodon nigroviridis full-length cDNA 42 2.4
340emb|CR706129.2|CNS0G7ST Tetraodon nigroviridis full-length cDNA 42 2.4
341emb|CR692644.2|CNS0FXE8 Tetraodon nigroviridis full-length cDNA 42 2.4
342emb|CR685186.2|CNS0FRN2 Tetraodon nigroviridis full-length cDNA 42 2.4
343emb|CR684668.2|CNS0FR8O Tetraodon nigroviridis full-length cDNA 42 2.4
344emb|CR679521.2|CNS0FN9P Tetraodon nigroviridis full-length cDNA 42 2.4
345emb|CR674601.2|CNS0FJHR Tetraodon nigroviridis full-length cDNA 42 2.4
346emb|CR671855.2|CNS0FHDH Tetraodon nigroviridis full-length cDNA 42 2.4
347emb|CR663629.2|CNS0FB0Z Tetraodon nigroviridis full-length cDNA 42 2.4
348emb|CR660686.2|CNS0F8R8 Tetraodon nigroviridis full-length cDNA 42 2.4
349emb|CR641097.2|CNS0ETN3 Tetraodon nigroviridis full-length cDNA 42 2.4
350gb|AY305395.1| Synthetic construct reconstructed ancestral elong... 42 2.4
351emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chr... 42 2.4
352emb|X99673.1|ATFUSATUF A.tumefaciens fusA & tufA genes 42 2.4
353emb|X99674.1|ATTUFB A.tumefaciens tufB gene 42 2.4
354gb|AY845408.1| Simkania negevensis ATCC VR 1471 translation elon... 42 2.4
355emb|BX640437.1| Bordetella bronchiseptica strain RB50, complete ... 42 2.4
356emb|BX640423.1| Bordetella parapertussis strain 12822, complete ... 42 2.4
357emb|BX640422.1| Bordetella pertussis strain Tohama I, complete g... 42 2.4
358emb|BX640411.1| Bordetella pertussis strain Tohama I, complete g... 42 2.4
359emb|AL627281.1| Salmonella enterica serovar Typhi (Salmonella ty... 42 2.4
360emb|AJ418938.2|LFE418938 Lactobacillus fermentum partial mRNA fo... 42 2.4
361emb|AJ418913.2|LRU418913 Lactobacillus ruminis partial mRNA for ... 42 2.4
362dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co... 42 2.4
363gb|AE012188.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 2.4
364gb|AE012187.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 2.4
365gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome 42 2.4
366ref|NM_010305.1| Mus musculus guanine nucleotide binding protein... 42 2.4
367gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 42 2.4
368gb|AF298799.1|AF298799 Staphylococcus cohnii subsp. ureolyticus ... 42 2.4
369gb|BC032995.1| Mus musculus guanine nucleotide binding protein, ... 42 2.4
370gb|AF274738.1|AF274738 Enterococcus sulfureus elongation factor ... 42 2.4
371gb|AF274730.1|AF274730 Enterococcus mundtii strain ATCC43186 elo... 42 2.4
372gb|AF274722.1|AF274722 Enterococcus durans strain ATCC19432 elon... 42 2.4
373gb|AF274720.1|AF274720 Enterococcus dispar strain ATCC51266 elon... 42 2.4
374gb|AE004924.1| Pseudomonas aeruginosa PAO1, section 485 of 529 o... 42 2.4
375gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 42 2.4
376dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete... 42 2.4
377gb|U38501.1|MMU38501 Mus musculus G protein alpha i1 subunit mRN... 42 2.4
378gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 42 2.4
379gb|AF037997.1|AF037997 Nannochloropsis oculata elongation factor... 42 2.4
380gb|AE015451.1| Pseudomonas putida KT2440 complete genome 42 2.4
381emb|AL691454.15| Mouse DNA sequence from clone RP23-423P8 on chr... 42 2.4
382dbj|AB073986.1| Myxococcus xanthus tufA gene for elongation fact... 42 2.4
383dbj|AB001741.1| Oryzias latipes mRNA for Gi1 alpha subunit, comp... 42 2.4
384gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome 40 9.4
385gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 9.4
386ref|NM_184511.1| Oryza sativa (japonica cultivar-group), mRNA 40 9.4
387ref|XM_479893.1| Oryza sativa (japonica cultivar-group), mRNA 40 9.4
388ref|XM_474125.1| Oryza sativa (japonica cultivar-group), predic... 40 9.4
389ref|XM_463771.1| Oryza sativa (japonica cultivar-group), mRNA 40 9.4
390ref|NM_183732.1| Oryza sativa (japonica cultivar-group), predic... 40 9.4
391gb|AC116815.15| Mus musculus chromosome 5, clone RP24-357H22, co... 40 9.4
392gb|AF041004.1|HSPPLG6 Homo sapiens periplakin (PPL) gene, exons ... 40 9.4
393gb|AC161484.4| Mus musculus chromosome 5, clone RP23-6C10, compl... 40 9.4
394gb|AC119215.6| Mus musculus chromosome 5, clone RP24-199K22, com... 40 9.4
395gb|AC147079.4| Pan troglodytes BAC clone RP43-184E24 from 7, com... 40 9.4
396gb|AY582544.1| Streptococcus oralis strain ATCC 10557 elongation... 40 9.4
397gb|AY267004.1| Streptococcus parauberis DSM 6631 elongation fact... 40 9.4
398gb|AY266995.1| Streptococcus agalactiae ATCC 13813 elongation fa... 40 9.4
399gb|AY266994.1| Streptococcus agalactiae ATCC 12973 elongation fa... 40 9.4
400ref|XM_369287.1| Magnaporthe grisea 70-15 chromosome III hypothe... 40 9.4
401ref|XM_954377.1| Neurospora crassa OR74A hypothetical protein [N... 40 9.4
402ref|XM_331123.1| Neurospora crassa OR74A hypothetical protein ( ... 40 9.4
403gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118... 40 9.4
404gb|AY134479.1| Raoultella ornithinolytica strain DSM 7464 elonga... 40 9.4
405gb|AY957605.1| Pseudomonas putida EF-Tu-2 gene, complete cds 40 9.4
406gb|AC140981.3| Mus musculus chromosome 9 clone RP23-282G22, comp... 40 9.4
407gb|AC126046.3| Mus musculus BAC clone RP23-176P24 from chromosom... 40 9.4
408gb|AC128705.4| Mus musculus BAC clone RP23-443P12 from chromosom... 40 9.4
409emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 9.4
410gb|AY370922.1| Bifidobacterium animalis strain NCC383 Tuf gene, ... 40 9.4
411gb|AY370921.1| Bifidobacterium animalis strain ATCC 27672 Tuf ge... 40 9.4
412gb|AY370918.1| Bifidobacterium animalis strain ATCC 27674 Tuf ge... 40 9.4
413gb|AY370917.1| Bifidobacterium animalis strain ATCC 27673 Tuf ge... 40 9.4
414gb|AY370916.1| Bifidobacterium animalis strain NCC402 Tuf gene, ... 40 9.4
415gb|AY370915.1| Bifidobacterium animalis strain NCC363 Tuf gene, ... 40 9.4
416gb|AY370914.1| Bifidobacterium animalis strain NCC311 Tuf gene, ... 40 9.4
417gb|AY370913.1| Bifidobacterium animalis strain NCC239 Tuf gene, ... 40 9.4
418gb|AY370912.1| Bifidobacterium animalis strain ATCC 27536 Tuf ge... 40 9.4
419gb|AY372049.1| Lactobacillus johnsonii strain NCC 533 RpsT, RpsO... 40 9.4
420gb|AY372043.1| Bifidobacterium longum bv. Infantis strain ATCC 1... 40 9.4
421gb|AY372041.1| Bifidobacterium bifidum strain ATCC 29521 Tuf gen... 40 9.4
422gb|AY372036.1| Lactobacillus johnsonii strain ATCC 33200 Tuf gen... 40 9.4
423gb|AY372035.1| Lactobacillus gasseri strain ATCC 19992 Tuf gene,... 40 9.4
424gb|AC127236.3| Mus musculus BAC clone RP24-351L1 from chromosome... 40 9.4
425gb|AC132389.3| Mus musculus BAC clone RP23-448A4 from chromosome... 40 9.4
426gb|AY370920.1| Bifidobacterium animalis strain ATCC25527 Tuf gen... 40 9.4
427gb|AY370919.1| Bifidobacterium animalis strain DSM10140 Tuf gene... 40 9.4
428gb|AC121973.2| Mus musculus BAC clone RP24-276I10 from chromosom... 40 9.4
429gb|AE014075.1| Escherichia coli CFT073, complete genome 40 9.4
430gb|CP000243.1| Escherichia coli UTI89, complete genome 40 9.4
431emb|AL357149.13| Human DNA sequence from clone RP11-352E13 on ch... 40 9.4
432gb|U00096.2| Escherichia coli K-12 MG1655, complete genome 40 9.4
433gb|U00006.1|ECOUW89 E. coli chromosomal region from 89.2 to 92.8... 40 9.4
434emb|Z67753.1|OSCHLPLXX Odontella sinensis complete chloroplast g... 40 9.4
435emb|Z14314.1|MLB1790G M.leprae genes rplL, rpoB, rpoC, end, rpsL... 40 9.4
436emb|X76874.1|SA1902TUF S.aurantia (DSM 1902) tuf gene 40 9.4
437gb|AE008893.1| Salmonella typhimurium LT2, section 197 of 220 of... 40 9.4
438gb|AE008858.1| Salmonella typhimurium LT2, section 162 of 220 of... 40 9.4
439emb|X55117.1|STTUFB S. typhimurium tufB gene for elongation fact... 40 9.4
440emb|X55116.1|STTUFA S. typhimurium tufA gene for elongation fact... 40 9.4
441gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 9.4
442emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 9.4
443ref|NM_002705.3| Homo sapiens periplakin (PPL), mRNA 40 9.4
444emb|AL627279.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 9.4
445emb|AL583923.1|MLEPRTN7 Mycobacterium leprae strain TN complete ... 40 9.4
446emb|AJ418929.2|LMU418929 Lactobacillus murinus partial mRNA for ... 40 9.4
447emb|AJ555817.1|PGI555817 Porphyromonas gingivalis partial ef-tu ... 40 9.4
448emb|AJ555816.1|PGI555816 Porphyromonas gingivalis partial ef-tu ... 40 9.4
449emb|AJ555815.1|PGI555815 Porphyromonas gingivalis partial ef-tu ... 40 9.4
450emb|AJ555813.1|PGI555813 Porphyromonas gingivalis partial ef-tu ... 40 9.4
451emb|AJ555811.1|PGI555811 Porphyromonas gingivalis partial ef-tu ... 40 9.4
452emb|AJ555810.1|PGI555810 Porphyromonas gingivalis partial ef-tu ... 40 9.4
453emb|AJ555809.1|PGI555809 Porphyromonas gingivalis partial ef-tu ... 40 9.4
454emb|AJ555808.1|PGI555808 Porphyromonas gingivalis partial ef-tu ... 40 9.4
455emb|AJ555807.1|PGI555807 Porphyromonas gingivalis partial ef-tu ... 40 9.4
456emb|AJ555806.1|PGI555806 Porphyromonas gingivalis partial ef-tu ... 40 9.4
457emb|AJ555805.1|PGI555805 Porphyromonas gingivalis partial ef-tu ... 40 9.4
458emb|AJ555804.1|PGI555804 Porphyromonas gingivalis partial ef-tu ... 40 9.4
459emb|AJ555803.1|PGI555803 Porphyromonas gingivalis partial ef-tu ... 40 9.4
460emb|AJ555802.1|PGI555802 Porphyromonas gingivalis partial ef-tu ... 40 9.4
461emb|AJ555801.1|PGI555801 Porphyromonas gingivalis partial ef-tu ... 40 9.4
462emb|AJ555800.1|PGI555800 Porphyromonas gingivalis partial ef-tu ... 40 9.4
463emb|AJ555799.1|PGI555799 Porphyromonas gingivalis partial ef-tu ... 40 9.4
464emb|AJ418909.2|LJE418909 Lactobacillus jensenii partial mRNA for... 40 9.4
465emb|AJ418908.2|LJO418908 Lactobacillus johnsonii partial mRNA f... 40 9.4
466dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome 40 9.4
467dbj|D13869.1|MSGEFTUA Mycobacterium leprae Tuf gene for elongati... 40 9.4
468gb|AC022164.8| Homo sapiens chromosome 16 clone RP11-513N24, com... 40 9.4
469ref|XM_679464.1| PREDICTED: Danio rerio similar to CG14446-PA (L... 40 9.4
470gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome 40 9.4
471ref|XM_691001.1| PREDICTED: Danio rerio similar to chicken cadhe... 40 9.4
472emb|BX511023.8| Zebrafish DNA sequence from clone DKEY-148A12 in... 40 9.4
473emb|AJ556181.1|OSA556181 Oryza sativa (japonica cultivar-group) ... 40 9.4
474dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
475dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
476dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
477gb|AC027687.7| Homo sapiens chromosome 16 clone RP11-61L4, compl... 40 9.4
478gb|AC146149.2| Pan troglodytes BAC clone RP43-37G13 from chromos... 40 9.4
479gb|AF274723.1|AF274723 Enterococcus durans strain ATCC19432 elon... 40 9.4
480gb|J01690.1|ECOSTR3 E.coli str operon with fusA and tufA genes c... 40 9.4
481gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome 40 9.4
482gb|AC087858.2| Homo sapiens chromosome 3 clone RP11-207E20 map 3... 40 9.4
483gb|AF545614.1| Pylaiella littoralis elongation factor Tu (tufA) ... 40 9.4
484gb|AC067938.1|AC067938 Neurospora crassa chromosome 7, clone G21... 40 9.4
485gb|AC067937.1|AC067937 Neurospora crassa chromosome 7, clone X11... 40 9.4
486emb|BX908788.1| Neurospora crassa DNA linkage group VII BAC clon... 40 9.4
487dbj|AP003301.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
488dbj|AP003535.2| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
489dbj|AP003886.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
490dbj|AP004166.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
491dbj|AP005873.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
492emb|X57091.1|ECTUFBT E.coli tufB gene for translation elongation... 40 9.4
493gb|AF170176.1|STYSTMF1 Salmonella typhimurium fragment STMF1 40 9.4
494dbj|AK070106.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.4
495dbj|AK068943.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.4
496gb|U18997.1|ECOUW67 Escherichia coli K-12 chromosomal region fro... 40 9.4
497emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 9.4
498gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 9.4
499gb|AF038004.1|AF038004 Tribonema marinium elongation factor Tu (... 40 9.4
500gb|AE015924.1| Porphyromonas gingivalis W83, complete genome 40 9.4

>ref|XM_466527.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1614

 Score =  696 bits (351), Expect = 0.0
 Identities = 597/679 (87%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 500  atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 559

                                                                        
Query: 72   cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
            |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 560  cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 619

                                                                        
Query: 132  gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
            ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 620  gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 679

                                                                        
Query: 192  acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
             |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 680  tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 739

                                                                        
Query: 252  ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
            ||||||  ||||||||||| ||||| | | ||||| || ||| ||||||||||||| || 
Sbjct: 740  ctcgagaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacggg 799

                                                                        
Query: 312  atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
            |||||||| |||||||| |||||||| | | | |||||||| || ||| | ||||| |||
Sbjct: 800  atcttctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgac 859

                                                                        
Query: 372  ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
            || || |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 860  ctcccgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgcc 919

                                                                        
Query: 432  actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
            ||||||||||| ||||||||||||||||||||||||||| | |||||  ||||||| |||
Sbjct: 920  actggccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatc 979

                                                                        
Query: 492  agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
             ||||||| |||||   |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 980  cgggagactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgat 1039

                                                                        
Query: 552  gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
            || || |||||||||||||| |||||||| ||||| |||||||||||||| || || |||
Sbjct: 1040 gcgatggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgag 1099

                                                                        
Query: 612  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
            |||||||||||| | || ||||| | ||||||||||||||||||||||||||| || |||
Sbjct: 1100 agaggcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggtt 1159

                               
Query: 672  gtgtatgtgctcaagaagg 690
            |||||||| || |||||||
Sbjct: 1160 gtgtatgtcctgaagaagg 1178



to top

>ref|XM_507491.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1126_D09.31-2
            mRNA
          Length = 1701

 Score =  696 bits (351), Expect = 0.0
 Identities = 597/679 (87%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 501  atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 560

                                                                        
Query: 72   cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
            |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 561  cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 620

                                                                        
Query: 132  gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
            ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 621  gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 680

                                                                        
Query: 192  acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
             |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 681  tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 740

                                                                        
Query: 252  ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
            ||||||  ||||||||||| ||||| | | ||||| || ||| ||||||||||||| || 
Sbjct: 741  ctcgagaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacggg 800

                                                                        
Query: 312  atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
            |||||||| |||||||| |||||||| | | | |||||||| || ||| | ||||| |||
Sbjct: 801  atcttctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgac 860

                                                                        
Query: 372  ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
            || || |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 861  ctcccgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgcc 920

                                                                        
Query: 432  actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
            ||||||||||| ||||||||||||||||||||||||||| | |||||  ||||||| |||
Sbjct: 921  actggccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatc 980

                                                                        
Query: 492  agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
             ||||||| |||||   |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 981  cgggagactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgat 1040

                                                                        
Query: 552  gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
            || || |||||||||||||| |||||||| ||||| |||||||||||||| || || |||
Sbjct: 1041 gcgatggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgag 1100

                                                                        
Query: 612  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
            |||||||||||| | || ||||| | ||||||||||||||||||||||||||| || |||
Sbjct: 1101 agaggcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggtt 1160

                               
Query: 672  gtgtatgtgctcaagaagg 690
            |||||||| || |||||||
Sbjct: 1161 gtgtatgtcctgaagaagg 1179



to top

>ref|XM_506850.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1126_D09.31-2
            mRNA
          Length = 1894

 Score =  696 bits (351), Expect = 0.0
 Identities = 597/679 (87%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 572  atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 631

                                                                        
Query: 72   cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
            |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 632  cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 691

                                                                        
Query: 132  gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
            ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 692  gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 751

                                                                        
Query: 192  acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
             |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 752  tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 811

                                                                        
Query: 252  ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
            ||||||  ||||||||||| ||||| | | ||||| || ||| ||||||||||||| || 
Sbjct: 812  ctcgagaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacggg 871

                                                                        
Query: 312  atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
            |||||||| |||||||| |||||||| | | | |||||||| || ||| | ||||| |||
Sbjct: 872  atcttctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgac 931

                                                                        
Query: 372  ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
            || || |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 932  ctcccgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgcc 991

                                                                        
Query: 432  actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
            ||||||||||| ||||||||||||||||||||||||||| | |||||  ||||||| |||
Sbjct: 992  actggccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatc 1051

                                                                        
Query: 492  agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
             ||||||| |||||   |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1052 cgggagactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgat 1111

                                                                        
Query: 552  gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
            || || |||||||||||||| |||||||| ||||| |||||||||||||| || || |||
Sbjct: 1112 gcgatggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgag 1171

                                                                        
Query: 612  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
            |||||||||||| | || ||||| | ||||||||||||||||||||||||||| || |||
Sbjct: 1172 agaggcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggtt 1231

                               
Query: 672  gtgtatgtgctcaagaagg 690
            |||||||| || |||||||
Sbjct: 1232 gtgtatgtcctgaagaagg 1250



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  696 bits (351), Expect = 0.0
 Identities = 597/679 (87%)
 Strand = Plus / Plus

                                                                            
Query: 12       atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
                |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 23131901 atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 23131960

                                                                            
Query: 72       cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
                |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 23131961 cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 23132020

                                                                            
Query: 132      gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
                ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 23132021 gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 23132080

                                                                            
Query: 192      acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
                 |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 23132081 tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 23132140

                                                                            
Query: 252      ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
                ||||||  ||||||||||| ||||| | | ||||| || ||| ||||||||||||| || 
Sbjct: 23132141 ctcgagaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacggg 23132200

                                                                            
Query: 312      atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
                |||||||| |||||||| |||||||| | | | |||||||| || ||| | ||||| |||
Sbjct: 23132201 atcttctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgac 23132260

                                                                            
Query: 372      ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
                || || |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 23132261 ctcccgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgcc 23132320

                                                                            
Query: 432      actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
                ||||||||||| ||||||||||||||||||||||||||| | |||||  ||||||| |||
Sbjct: 23132321 actggccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatc 23132380

                                                                            
Query: 492      agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
                 ||||||| |||||   |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 23132381 cgggagactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgat 23132440

                                                                            
Query: 552      gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
                || || |||||||||||||| |||||||| ||||| |||||||||||||| || || |||
Sbjct: 23132441 gcgatggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgag 23132500

                                                                            
Query: 612      agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
                |||||||||||| | || ||||| | ||||||||||||||||||||||||||| || |||
Sbjct: 23132501 agaggcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggtt 23132560

                                   
Query: 672      gtgtatgtgctcaagaagg 690
                |||||||| || |||||||
Sbjct: 23132561 gtgtatgtcctgaagaagg 23132579



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   cgacgacgaggagctgcttg 159
             ||||||||||||||||||||
Sbjct: 34932 cgacgacgaggagctgcttg 34913



to top

>dbj|AP004023.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1126_D09
          Length = 138615

 Score =  696 bits (351), Expect = 0.0
 Identities = 597/679 (87%)
 Strand = Plus / Plus

                                                                         
Query: 12    atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 98939 atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 98998

                                                                         
Query: 72    cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
             |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 98999 cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 99058

                                                                         
Query: 132   gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
             ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 99059 gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 99118

                                                                         
Query: 192   acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
              |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 99119 tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 99178

                                                                         
Query: 252   ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
             ||||||  ||||||||||| ||||| | | ||||| || ||| ||||||||||||| || 
Sbjct: 99179 ctcgagaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacggg 99238

                                                                         
Query: 312   atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
             |||||||| |||||||| |||||||| | | | |||||||| || ||| | ||||| |||
Sbjct: 99239 atcttctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgac 99298

                                                                         
Query: 372   ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
             || || |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 99299 ctcccgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgcc 99358

                                                                         
Query: 432   actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
             ||||||||||| ||||||||||||||||||||||||||| | |||||  ||||||| |||
Sbjct: 99359 actggccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatc 99418

                                                                         
Query: 492   agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
              ||||||| |||||   |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 99419 cgggagactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgat 99478

                                                                         
Query: 552   gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
             || || |||||||||||||| |||||||| ||||| |||||||||||||| || || |||
Sbjct: 99479 gcgatggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgag 99538

                                                                         
Query: 612   agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
             |||||||||||| | || ||||| | ||||||||||||||||||||||||||| || |||
Sbjct: 99539 agaggcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggtt 99598

                                
Query: 672   gtgtatgtgctcaagaagg 690
             |||||||| || |||||||
Sbjct: 99599 gtgtatgtcctgaagaagg 99617



to top

>dbj|AK064937.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000P03, full
            insert sequence
          Length = 1700

 Score =  696 bits (351), Expect = 0.0
 Identities = 597/679 (87%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 500  atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 559

                                                                        
Query: 72   cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
            |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 560  cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 619

                                                                        
Query: 132  gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
            ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 620  gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 679

                                                                        
Query: 192  acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
             |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 680  tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 739

                                                                        
Query: 252  ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
            ||||||  ||||||||||| ||||| | | ||||| || ||| ||||||||||||| || 
Sbjct: 740  ctcgagaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacggg 799

                                                                        
Query: 312  atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
            |||||||| |||||||| |||||||| | | | |||||||| || ||| | ||||| |||
Sbjct: 800  atcttctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgac 859

                                                                        
Query: 372  ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
            || || |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 860  ctcccgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgcc 919

                                                                        
Query: 432  actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
            ||||||||||| ||||||||||||||||||||||||||| | |||||  ||||||| |||
Sbjct: 920  actggccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatc 979

                                                                        
Query: 492  agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
             ||||||| |||||   |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 980  cgggagactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgat 1039

                                                                        
Query: 552  gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
            || || |||||||||||||| |||||||| ||||| |||||||||||||| || || |||
Sbjct: 1040 gcgatggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgag 1099

                                                                        
Query: 612  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
            |||||||||||| | || ||||| | ||||||||||||||||||||||||||| || |||
Sbjct: 1100 agaggcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggtt 1159

                               
Query: 672  gtgtatgtgctcaagaagg 690
            |||||||| || |||||||
Sbjct: 1160 gtgtatgtcctgaagaagg 1178



to top

>gb|AF145053.1|AF145053 Oryza sativa chloroplast translational elongation factor Tu (tufA)
            mRNA, complete cds; nuclear gene for chloroplast product
          Length = 1678

 Score =  692 bits (349), Expect = 0.0
 Identities = 595/677 (87%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 530  atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 589

                                                                        
Query: 72   cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
            |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 590  cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 649

                                                                        
Query: 132  gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
            ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 650  gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 709

                                                                        
Query: 192  acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
             |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 710  tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 769

                                                                        
Query: 252  ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
            ||||||  ||||||||||| ||||| | | ||||| || ||| ||||||||||||| || 
Sbjct: 770  ctcgagaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacggg 829

                                                                        
Query: 312  atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
            |||||||| |||||||| |||||||| | | | |||||||| || ||| | ||||| |||
Sbjct: 830  atcttctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgac 889

                                                                        
Query: 372  ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
            || || |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 890  ctcccgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgcc 949

                                                                        
Query: 432  actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
            ||||||||||| ||||||||||||||||||||||||||| | |||||  ||||||| |||
Sbjct: 950  actggccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatc 1009

                                                                        
Query: 492  agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
             ||||||| |||||   |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1010 cgggagactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgat 1069

                                                                        
Query: 552  gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
            || || |||||||||||||| |||||||| ||||| |||||||||||||| || || |||
Sbjct: 1070 gcgatggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgag 1129

                                                                        
Query: 612  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
            |||||||||||| | || ||||| | ||||||||||||||||||||||||||| || |||
Sbjct: 1130 agaggcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggtt 1189

                             
Query: 672  gtgtatgtgctcaagaa 688
            |||||||| || |||||
Sbjct: 1190 gtgtatgtcctgaagaa 1206



to top

>dbj|AK104785.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D07, full
            insert sequence
          Length = 1614

 Score =  688 bits (347), Expect = 0.0
 Identities = 596/679 (87%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 500  atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 559

                                                                        
Query: 72   cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
            |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 560  cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 619

                                                                        
Query: 132  gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
            ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 620  gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 679

                                                                        
Query: 192  acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
             |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 680  tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 739

                                                                        
Query: 252  ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
            ||||||  ||||||||||| ||||| | | ||||| || ||| |||||||| |||| || 
Sbjct: 740  ctcgagaacctcatggccaaccctgccattaagcgcggcgatgatgagtggatggacggg 799

                                                                        
Query: 312  atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
            |||||||| |||||||| |||||||| | | | |||||||| || ||| | ||||| |||
Sbjct: 800  atcttctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgac 859

                                                                        
Query: 372  ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
            || || |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 860  ctcccgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgcc 919

                                                                        
Query: 432  actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
            ||||||||||| ||||||||||||||||||||||||||| | |||||  ||||||| |||
Sbjct: 920  actggccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatc 979

                                                                        
Query: 492  agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
             ||||||| |||||   |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 980  cgggagactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgat 1039

                                                                        
Query: 552  gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
            || || |||||||||||||| |||||||| ||||| |||||||||||||| || || |||
Sbjct: 1040 gcgatggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgag 1099

                                                                        
Query: 612  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
            |||||||||||| | || ||||| | ||||||||||||||||||||||||||| || |||
Sbjct: 1100 agaggcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggtt 1159

                               
Query: 672  gtgtatgtgctcaagaagg 690
            |||||||| || |||||||
Sbjct: 1160 gtgtatgtcctgaagaagg 1178



to top

>dbj|AK119587.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-C11, full
            insert sequence
          Length = 1894

 Score =  680 bits (343), Expect = 0.0
 Identities = 595/679 (87%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 572  atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 631

                                                                        
Query: 72   cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
            |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 632  cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 691

                                                                        
Query: 132  gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
            ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 692  gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 751

                                                                        
Query: 192  acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
             |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 752  tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 811

                                                                        
Query: 252  ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
            ||||||  ||||||||||| ||||| | | ||||| || ||| ||||||||||||| || 
Sbjct: 812  ctcgagaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacggg 871

                                                                        
Query: 312  atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
            |||||||| |||||||| |||||||| | | | |||||||| || ||  | ||||| |||
Sbjct: 872  atcttctcgttgattgattccgtggataactacatccctgtcccacaacgccagaccgac 931

                                                                        
Query: 372  ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
            || || |||||||| |||||||||||||| |||||||||||||| |||||||| ||||||
Sbjct: 932  ctcccgttcttgcttgctgttgaggatgtgttctccatcaccggccgtggtaccgttgcc 991

                                                                        
Query: 432  actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
            ||||||||||| ||||||||||||||||||||||||||| | |||||  ||||||| |||
Sbjct: 992  actggccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatc 1051

                                                                        
Query: 492  agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
             ||||||| |||||   |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1052 cgggagactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgat 1111

                                                                        
Query: 552  gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
            || || |||||||||||||| |||||||| ||||| |||||||||||||| || || |||
Sbjct: 1112 gcgatggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgag 1171

                                                                        
Query: 612  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
            |||||||||||| | || ||||| | ||||||||||||||||||||||||||| || |||
Sbjct: 1172 agaggcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggtt 1231

                               
Query: 672  gtgtatgtgctcaagaagg 690
            |||||||| || |||||||
Sbjct: 1232 gtgtatgtcctgaagaagg 1250



to top

>gb|AF327413.1|AF327413 Oryza sativa translational elongation factor Tu (tufA) gene, complete
            cds; nuclear gene for chloroplast product
          Length = 2050

 Score =  648 bits (327), Expect = 0.0
 Identities = 591/679 (87%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||
Sbjct: 577  atggacggggccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaagag 636

                                                                        
Query: 72   cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
            ||||| ||  | || ||||| ||||||||||| |  |||||||| || || |||||||||
Sbjct: 637  cacattctgttggccaagcaagtcggtgtcccaaagattgttgtctttcttaacaagaag 696

                                                                        
Query: 132  gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
            ||||||||||||||||||||||||||| |||||||||| ||||||||||| ||  |||||
Sbjct: 697  gaccaggtcgacgacgaggagctgcttcagctcgtcgagctcgaggtccgcgaattgctc 756

                                                                        
Query: 192  acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
             |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 757  tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 816

                                                                        
Query: 252  ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
            ||||||  ||||||||||| ||||| | | ||||| || ||| ||||||||||||| || 
Sbjct: 817  ctcgagaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacggg 876

                                                                        
Query: 312  atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
            |||||||| |||||||| |||||||| | | | |||||||| || ||| | ||||| |||
Sbjct: 877  atcttctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgac 936

                                                                        
Query: 372  ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
            || || |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 937  ctcccgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgcc 996

                                                                        
Query: 432  actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
            ||||||||||| ||||||||||||||||||||||||||| | |||||  ||||||| |||
Sbjct: 997  actggccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatc 1056

                                                                        
Query: 492  agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
             ||||||| |||||   |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1057 cgggagactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgat 1116

                                                                        
Query: 552  gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
            || || |||||||||||||| |||||||| |||||||||||||||||||| || || |||
Sbjct: 1117 gcgatggctggggacaatgtcggcctgcttctccgtggtatgcagaaggatgatatcgag 1176

                                                                        
Query: 612  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
            |||||||||||| | |||||||| | ||||||||||||||||||||||||||| || |||
Sbjct: 1177 agaggcatggtgcttgcaaagcctgcttccatcacgccacacaccaagtttgatgcggtt 1236

                               
Query: 672  gtgtatgtgctcaagaagg 690
            |||||||| || |||||||
Sbjct: 1237 gtgtatgtcctgaagaagg 1255



to top

>gb|BT018667.1| Zea mays clone EL01N0510C05.d mRNA sequence
          Length = 2057

 Score =  624 bits (315), Expect = e-176
 Identities = 588/679 (86%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||| |||||||||||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 460  atggacggtgccatcctcgtcgtatccggtgccgacgggcccatgccgcagaccaaagag 519

                                                                        
Query: 72   cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
            |||||||| ||||| ||||| |||||||| ||||  || ||||| ||||||||||| |||
Sbjct: 520  cacatcctcctcgccaagcaagtcggtgttcccaagatcgttgtcttcctcaacaaaaag 579

                                                                        
Query: 132  gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
            |||  ||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||
Sbjct: 580  gacatggtcgacgacgaggagctgctcgagctcgtcgagctcgaggtccgcgagctgctc 639

                                                                        
Query: 192  acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
            |    ||| |||||||| || ||| | || ||||||||| | ||||| || ||||  |||
Sbjct: 640  agcaactacgagtacgacggcgacgacgtaccaatcgtcgctggctccgccctcaaggcg 699

                                                                        
Query: 252  ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
            |||||||| ||||||| || ||||| ||| ||||| || ||  |||||||||| ||   |
Sbjct: 700  ctcgaggctctcatggtcaaccctgccctgaagcgcggcgacgatgagtgggtcgactac 759

                                                                        
Query: 312  atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
            |||||||| ||| ||||    |||||  || |||| || || |||||||||||||| |||
Sbjct: 760  atcttctcgttggttgataaagtggattcctatattccagtcccgcagaggcagactgac 819

                                                                        
Query: 372  ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
            || || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 820  ctcccgttcttgctcgctgttgaagatgtcttctccatcaccggtcgtggtacagttgcc 879

                                                                        
Query: 432  actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
            ||||||||||| |||||||||||||||||| |||| ||| |||||||  ||||||| |||
Sbjct: 880  actggccgtatagagcgtggcaccgtcaagattggtgacacagtcgatatcgtcggaatc 939

                                                                        
Query: 492  agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
             |||| ||||| ||   |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 940  cgggacacccggaactgcacggtcactggtgttgagatgttccagaagaccatggatgat 999

                                                                        
Query: 552  gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
            ||||| || || ||||||||||| |||||||||||||||||||||||||| |||||||| 
Sbjct: 1000 gccatggccggagacaatgttgggctgctgctccgtggtatgcagaaggatgacattgaa 1059

                                                                        
Query: 612  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
            |||||||||||| |||||||||| || || ||||| || ||||||||||||||||| |||
Sbjct: 1060 agaggcatggtgctggcaaagcctggctctatcacaccgcacaccaagtttgaggctgtt 1119

                               
Query: 672  gtgtatgtgctcaagaagg 690
            ||||||||||| |||||||
Sbjct: 1120 gtgtatgtgcttaagaagg 1138



to top

>gb|AY105509.1| Zea mays PCO100031 mRNA sequence
          Length = 1193

 Score =  593 bits (299), Expect = e-166
 Identities = 584/679 (86%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||
Sbjct: 21  atggacggcgccatcctcgtcgtctctggcgccgacggtcccatgccgcagaccaaagag 80

                                                                       
Query: 72  cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
           ||||| || ||||| ||||||||||| || ||||  || ||||| |||||||||||||||
Sbjct: 81  cacattctcctcgccaagcaggtcggcgttcccaagatcgttgtcttcctcaacaagaag 140

                                                                       
Query: 132 gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
           |||  ||||||||||||||||||||| ||||||||||| || || ||||| |||||||||
Sbjct: 141 gacatggtcgacgacgaggagctgctcgagctcgtcgagctggaagtccgcgagctgctc 200

                                                                       
Query: 192 acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
           |    |||||||||||| || ||| | |||||||||||| | ||||| || ||||  |||
Sbjct: 201 agcaactatgagtacgacggcgacgaggtgccaatcgtcgctggctccgccctcaaggcg 260

                                                                       
Query: 252 ctcgaggccctcatggccacccctggcctcaagcgtggggataatgagtgggtggatggc 311
           |||||||||||||||| || ||||  ||| ||||| || ||  |||||||||||||  ||
Sbjct: 261 ctcgaggccctcatgggcaaccctaccctgaagcgcggcgacgatgagtgggtggactgc 320

                                                                       
Query: 312 atcttctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagac 371
           ||||||    || |||| || |||||  || | || || || || ||| ||||||| |||
Sbjct: 321 atcttcaagctggttgattctgtggattcctacattccagtgccacagcggcagaccgac 380

                                                                       
Query: 372 ctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgcc 431
           || || ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 381 ctcccgttcttactcgctgttgaagatgtcttctccatcaccggtcgtggtacagttgcc 440

                                                                       
Query: 432 actggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatc 491
           |||||||||||||||||||||||||||||| |||| ||| |||||||  |||| || |||
Sbjct: 441 actggccgtatcgagcgtggcaccgtcaagattggtgacacagtcgatatcgttggaatc 500

                                                                       
Query: 492 agggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgat 551
            |||| ||||| ||   ||| || ||||| |||||||||||||||||||||||||| |||
Sbjct: 501 cgggacacccggaactgcaccgtgactggcgttgagatgttccagaagaccatggacgat 560

                                                                       
Query: 552 gccattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgag 611
           ||||| ||||| |||||||| || |||||||||||||||||||||||||| |||||||||
Sbjct: 561 gccatggctggagacaatgtcggactgctgctccgtggtatgcagaaggatgacattgag 620

                                                                       
Query: 612 agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
           |||||||||||| |||||||||| || || ||||| || ||||||||||||||||| |||
Sbjct: 621 agaggcatggtgctggcaaagcccggctctatcacaccgcacaccaagtttgaggctgtt 680

                              
Query: 672 gtgtatgtgctcaagaagg 690
           ||||||||||| |||||||
Sbjct: 681 gtgtatgtgcttaagaagg 699



to top

>ref|XM_466528.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 900

 Score =  295 bits (149), Expect = 1e-76
 Identities = 236/265 (89%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 163 atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 222

                                                                       
Query: 72  cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
           |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 223 cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 282

                                                                       
Query: 132 gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
           ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 283 gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 342

                                                                       
Query: 192 acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
            |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 343 tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 402

                                    
Query: 252 ctcgaggccctcatggccacccctg 276
           ||||||  ||||||||||| |||||
Sbjct: 403 ctcgagaacctcatggccaaccctg 427



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 638 ttccatcacgccacacaccaagtttgaggcagttgtgtatgtgctcaagaagg 690
           ||||||||||||||||||||||||||| || ||||||||||| || |||||||
Sbjct: 429 ttccatcacgccacacaccaagtttgatgcggttgtgtatgtcctgaagaagg 481



to top

>dbj|AK066858.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013084O08, full
           insert sequence
          Length = 899

 Score =  295 bits (149), Expect = 1e-76
 Identities = 236/265 (89%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 162 atggacggcgccatcctcgtcgtctccggcgccgacgggcccatgccgcagaccaaggag 221

                                                                       
Query: 72  cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
           |||||||| ||||| |||||||||||||||||||  |||||||| |||||||||||||||
Sbjct: 222 cacatcctgctcgccaagcaggtcggtgtccccaagattgttgtcttcctcaacaagaag 281

                                                                       
Query: 132 gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
           ||||||||||||||||||||||||||  |||||||||| ||||||||||| ||  |||||
Sbjct: 282 gaccaggtcgacgacgaggagctgctccagctcgtcgagctcgaggtccgcgaattgctc 341

                                                                       
Query: 192 acggcctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcg 251
            |  |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||
Sbjct: 342 tcctcctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcg 401

                                    
Query: 252 ctcgaggccctcatggccacccctg 276
           ||||||  ||||||||||| |||||
Sbjct: 402 ctcgagaacctcatggccaaccctg 426



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 638 ttccatcacgccacacaccaagtttgaggcagttgtgtatgtgctcaagaagg 690
           ||||||||||||||||||||||||||| || ||||||||||| || |||||||
Sbjct: 428 ttccatcacgccacacaccaagtttgatgcggttgtgtatgtcctgaagaagg 480



to top

>emb|X89058.1|GMRNAEFTU G.max DNA for EF-Tu chloroplast specific protein
          Length = 3079

 Score =  129 bits (65), Expect = 1e-26
 Identities = 132/153 (86%), Gaps = 1/153 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    gctgcccagnatggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgca 61
            ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 1714 gctgcccag-atggacggcgccatcctcgtcgtctccggcgccgacggcccaatgcccca 1772

                                                                        
Query: 62   gaccaaggagcacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcct 121
             ||||| || ||||| ||| | || || || ||||| || |||| |||||| || |||||
Sbjct: 1773 aaccaaagaacacattcttttggccaaacaagtcggcgttcccaacattgtcgtcttcct 1832

                                             
Query: 122  caacaagaaggaccaggtcgacgacgaggagct 154
            ||||||  |||||||||| || |||||||||||
Sbjct: 1833 caacaaacaggaccaggttgatgacgaggagct 1865



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 391  ttgaggatgtcttctccatcaccggtcgtgg 421
            |||||||||| ||| ||||||||||||||||
Sbjct: 2102 ttgaggatgttttcaccatcaccggtcgtgg 2132



to top

>gb|AF234537.1|AF234537 Pelargonium graveolens chloroplast translational elongation factor
           Tu (tufA) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1584

 Score =  125 bits (63), Expect = 2e-25
 Identities = 123/143 (86%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| ||||||||||| |||||||||||||||||||| ||||| ||||| ||||||
Sbjct: 510 atggacggagccatcctcgtggtctccggcgccgacggcccgatgccacagacgaaggag 569

                                                                       
Query: 72  cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
           |||||  | || || |||||||| ||||| |||| ||| || || |||||||||||| ||
Sbjct: 570 cacattttgctggccaagcaggttggtgtgcccaacatggtggtgttcctcaacaagcag 629

                                  
Query: 132 gaccaggtcgacgacgaggagct 154
           |||||||| || || ||||||||
Sbjct: 630 gaccaggttgatgatgaggagct 652



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 363 cagacagacctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggt 422
           ||||| ||||| || || ||||| |||||||||||||| || || |||||||| ||||||
Sbjct: 861 cagactgaccttccgtttttgctagctgttgaggatgtgttttcaatcaccggacgtggt 920

                      
Query: 423 acagttgccac 433
           || ||||||||
Sbjct: 921 accgttgccac 931



to top

>emb|Y15108.1|GMTUFB2 Glycine max tufB2 gene
          Length = 1337

 Score =  109 bits (55), Expect = 1e-20
 Identities = 121/143 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           ||||||||||||||||||||||||||||||||||||||||  ||||| || ||||| || 
Sbjct: 107 atggacggcgccatcctcgtcgtctccggcgccgacggccttatgccccaaaccaaagaa 166

                                                                       
Query: 72  cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
           ||||| ||  | || || || ||||| || |||| |||||| || |||||||||||  ||
Sbjct: 167 cacattctcttggccaaacaagtcggcgttcccaacattgtcgtcttcctcaacaaacag 226

                                  
Query: 132 gaccaggtcgacgacgaggagct 154
           |||||||| || |||||||||||
Sbjct: 227 gaccaggttgatgacgaggagct 249



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 391 ttgaggatgtcttctccatcaccggtcg 418
           |||||||||| ||| |||||||||||||
Sbjct: 486 ttgaggatgttttcaccatcaccggtcg 513



to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score =  105 bits (53), Expect = 2e-19
 Identities = 251/317 (79%)
 Strand = Plus / Minus

                                                                          
Query: 374    gcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccac 433
              ||||||| || | ||||| || || |||||||||||||||||||| || || || |||||
Sbjct: 324745 gcccttcctgatggctgtggaagacgtcttctccatcaccggtcgcggcaccgtggccac 324686

                                                                          
Query: 434    tggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcag 493
               |||||||||||||| || |  |||||||| || ||   | ||||  | ||||| |||| 
Sbjct: 324685 aggccgtatcgagcgcggaatagtcaaggtcggcgaagaaatcgaaattgtcggtatcaa 324626

                                                                          
Query: 494    ggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgc 553
              ||| ||||||||  |||| ||||| ||||| || |||||||  |||    | ||||| | 
Sbjct: 324625 ggacacccgcaagaccaccgtcaccggtgtggaaatgttccgcaagctgctcgatgaggg 324566

                                                                          
Query: 554    cattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagag 613
              ||| ||||| ||||| ||||| |||||||| || || || |||||||||||||| ||| |
Sbjct: 324565 catggctggcgacaacgttggtctgctgcttcgcggcatccagaaggaagacatcgagcg 324506

                                                                          
Query: 614    aggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgt 673
               ||||||||| | |  ||||| ||||||||||| || ||||||||||||||||     ||
Sbjct: 324505 cggcatggtgctcgtgaagcccggttccatcacccctcacaccaagtttgagggtcaggt 324446

                               
Query: 674    gtatgtgctcaagaagg 690
              ||| |||||||||||||
Sbjct: 324445 gtacgtgctcaagaagg 324429



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                  
Query: 43     ccgacggccccatgccgcagaccaaggagcacatccttctcgctaagcaggt 94
              |||||||||| ||| | |||||||||||||||||||| || || ||||||||
Sbjct: 325046 ccgacggcccgatggcccagaccaaggagcacatcctgctggccaagcaggt 324995



to top

>gb|AY107645.1| Zea mays PCO100030 mRNA sequence
          Length = 623

 Score =  105 bits (53), Expect = 2e-19
 Identities = 62/65 (95%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||
Sbjct: 551 atggacggcgccatcctcgtcgtctctggcgccgacggtcccatgccgcagaccaaagag 610

                
Query: 72  cacat 76
           |||||
Sbjct: 611 cacat 615



to top

>emb|Y14561.1|PSY14561 Pisum sativum mRNA for choloroplast translation elongation factor
          Length = 1731

 Score =  103 bits (52), Expect = 8e-19
 Identities = 127/152 (83%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           ||||||||||| |||||||| |||||||||||||| || |||||||| || || || || 
Sbjct: 616 atggacggcgctatcctcgttgtctccggcgccgatggtcccatgcctcaaactaaagaa 675

                                                                       
Query: 72  cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
           |||||||||||||| |||||||| ||||| || ||| | ||||| ||  | |||||| ||
Sbjct: 676 cacatccttctcgccaagcaggttggtgttccgagcgtggttgtgtttttgaacaagcag 735

                                           
Query: 132 gaccaggtcgacgacgaggagctgcttgagct 163
           ||||| || || || |||||||| ||||||||
Sbjct: 736 gaccaagtggatgatgaggagcttcttgagct 767



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||| |||||||| || || | |||||||||||| ||||||||||| ||||||
Sbjct: 2974557 atggacggcgcgatcctcgttgtgtcggccgccgacggcccgatgccgcagacgaaggag 2974498

                                         
Query: 72      cacatccttctcgctaagcaggtcgg 97
               |||||||| ||||| |||||||||||
Sbjct: 2974497 cacatcctgctcgcgaagcaggtcgg 2974472



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 147/180 (81%)
 Strand = Plus / Plus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               |||||||||||||||||||| ||| | | | |||||||||| ||||||||||||||||||
Sbjct: 5981606 atggacggcgccatcctcgtggtcgcggccaccgacggcccgatgccgcagaccaaggag 5981665

                                                                           
Query: 72      cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
               ||| | || || ||    |||||||| ||||||  ||| |||||   ||| ||||||   
Sbjct: 5981666 cacgtgctcctggcccgccaggtcggcgtcccctacatcgttgtcgccctgaacaaggcc 5981725

                                                                           
Query: 132     gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
               |||  ||| |||||||||||| | || ||||||||||| |||||||| ||||||||||||
Sbjct: 5981726 gacatggtggacgacgaggagatcctggagctcgtcgagctcgaggttcgtgagctgctc 5981785



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                          
Query: 393     gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
               ||||| |||||| | |||||||||||||| || || | ||| || ||||||||||||||
Sbjct: 5981957 gaggacgtcttcacgatcaccggtcgtggcacggtcgtcaccggtcgtatcgagcgtgg 5982015



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 27      ctcgtcgtctccggcgccgacggc 50
               ||||||||||||||||| ||||||
Sbjct: 4450568 ctcgtcgtctccggcgcggacggc 4450545



to top

>emb|X98830.1|PRFUSTUF P.rosea fus, tuf, rpsJ and rplC genes
          Length = 2742

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 150/185 (81%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||||||||||||||| ||  ||| | |||||||||| ||||||||||| ||||||
Sbjct: 777 atggacggcgccatcctcgtggtggccgccaccgacggcccgatgccgcagacgaaggag 836

                                                                       
Query: 72  cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
           ||| |||| || ||    |||||||| ||||||  ||| || ||   ||| ||||||   
Sbjct: 837 cacgtcctcctggcccgtcaggtcggcgtcccctacatcgtcgtggccctgaacaaggcc 896

                                                                       
Query: 132 gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
           |||  ||| |||||||||||| | || ||||||||||| ||||||||||| |||||||||
Sbjct: 897 gacatggtggacgacgaggagatcctggagctcgtcgagctcgaggtccgcgagctgctc 956

                
Query: 192 acggc 196
            ||||
Sbjct: 957 tcggc 961



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 393  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 448
            ||||| |||||||| |||||||||||||| || || | ||| ||||||||||||||
Sbjct: 1128 gaggacgtcttctcgatcaccggtcgtggaaccgtcgtcaccggccgtatcgagcg 1183



to top

>gb|U67308.1|PRU67308 Planobispora rosea elongation factor Tu1 (tuf1) gene, complete cds
          Length = 1826

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 150/185 (81%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||||||||||||||| ||| ||| | ||| |||||| ||||||||||| ||||||
Sbjct: 777 atggacggcgccatcctcgtggtcgccgccaccgccggcccgatgccgcagacgaaggag 836

                                                                       
Query: 72  cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
           ||| |||| || ||    |||||||| ||||||  ||| || ||   ||| ||||||   
Sbjct: 837 cacgtcctcctggcccgtcaggtcggcgtcccctacatcgtcgtggccctgaacaaggcc 896

                                                                       
Query: 132 gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
           |||  ||| |||||||||||| | || ||||||||||| ||||||||||| |||||||||
Sbjct: 897 gacatggtggacgacgaggagatcctggagctcgtcgagctcgaggtccgcgagctgctc 956

                
Query: 192 acggc 196
            ||||
Sbjct: 957 tcggc 961



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 393  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 448
            ||||| |||||||| |||||||||||||| || || | ||| ||||||||||||||
Sbjct: 1128 gaggacgtcttctcgatcaccggtcgtggaaccgtcgtcaccggccgtatcgagcg 1183



to top

>emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segment 6/7
          Length = 349122

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                          
Query: 387    gctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgag 446
              ||||||||||| ||||||||||||||||||||||| || || ||||| || || ||||||
Sbjct: 288777 gctgttgaggacgtcttctccatcaccggtcgtggcaccgtggccaccggtcggatcgag 288836

                                  
Query: 447    cgtggcaccgtcaaggttgg 466
              |||||||  |||||||||||
Sbjct: 288837 cgtggcaaagtcaaggttgg 288856



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 85/99 (85%), Gaps = 1/99 (1%)
 Strand = Plus / Plus

                                                                          
Query: 2      gctgcccagnatggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgca 61
              ||||||||| ||||||||||||||||| |||  | ||| | |||||||||| ||| | ||
Sbjct: 288423 gctgcccag-atggacggcgccatcctggtctgcgccgccaccgacggccctatggctca 288481

                                                     
Query: 62     gaccaaggagcacatccttctcgctaagcaggtcggtgt 100
              |||||||||||||||||| || || |||||||| |||||
Sbjct: 288482 gaccaaggagcacatcctgctggccaagcaggtgggtgt 288520



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                          
Query: 573    ggcctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtgttggcaaag 632
              ||||| |||||||| ||||| ||||| || ||||| ||| | ||||||||| |||  |||
Sbjct: 288963 ggccttctgctccgcggtatccagaaagaggacatcgagcgcggcatggtgctggtgaag 289022

                                        
Query: 633    ccgggttccatcacgccacacaccaa 658
              || ||||||||||| || ||||||||
Sbjct: 289023 cccggttccatcacccctcacaccaa 289048



to top

>gb|AF109211.1|AF109211 Synechococcus WH8103 elongation factor Tu (tufA) gene, partial cds
          Length = 535

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                       
Query: 387 gctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgag 446
           ||||||||||| ||||||||||||||||||||||| || || ||||| || || ||||||
Sbjct: 376 gctgttgaggacgtcttctccatcaccggtcgtggcaccgtggccaccggtcggatcgag 435

                               
Query: 447 cgtggcaccgtcaaggttgg 466
           |||||||  |||||||||||
Sbjct: 436 cgtggcaaggtcaaggttgg 455



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           ||||||||||||||||| |||  | ||| | |||||||||||||| | ||||||||||||
Sbjct: 31  atggacggcgccatcctggtctgcgccgccaccgacggccccatggcccagaccaaggag 90

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           |||||||| || || |||||||| |||||
Sbjct: 91  cacatcctgctggccaagcaggtgggtgt 119



to top

>gb|AY083613.1| Pisum sativum translation elongation factor (tufA) gene, complete
           cds; nuclear gene for chloroplast product
          Length = 1985

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 73/83 (87%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           ||||||||||| |||||||| |||||||||||||| || |||||||| || || || || 
Sbjct: 795 atggacggcgctatcctcgttgtctccggcgccgatggtcccatgcctcaaactaaagaa 854

                                  
Query: 72  cacatccttctcgctaagcaggt 94
           |||||||||||||| ||||||||
Sbjct: 855 cacatccttctcgccaagcaggt 877



to top

>emb|X77039.1|SCTUF1FUS S.coelicolor tuf1 and fus genes
          Length = 1900

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||||||||||||||| ||| ||| | |||||||||| ||||||||||||||||||
Sbjct: 756 atggacggcgccatcctcgtggtcgccgccaccgacggcccgatgccgcagaccaaggag 815

              
Query: 72  cac 74
           |||
Sbjct: 816 cac 818



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 393  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
            ||||| |||||| ||||||||||||| ||||| || | ||| ||||| |||||||||||
Sbjct: 1107 gaggacgtcttcaccatcaccggtcgcggtacggtcgtcaccggccgcatcgagcgtgg 1165



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 141 gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||| | || ||||||||||| |||||||| ||||||||
Sbjct: 885 gacgacgaggagatcctggagctcgtcgagctcgaggtgcgtgagct 931



to top

>emb|X67057.1|SRTUF1 S.ramocissimus tuf1 gene for elongation factor Tu1
          Length = 2836

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||||||||||||||| ||| ||| | |||||||||| ||||||||||||||||||
Sbjct: 1484 atggacggcgccatcctcgtggtcgccgccaccgacggcccgatgccgcagaccaaggag 1543

               
Query: 72   cac 74
            |||
Sbjct: 1544 cac 1546



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
            ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||||||
Sbjct: 1835 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgtgg 1893



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 141  gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
            |||||||||||| |  | |||||||| || |||||||||||||||||
Sbjct: 1613 gacgacgaggagatcatggagctcgttgagctcgaggtccgtgagct 1659



to top

>emb|X66062.1|GMTUFA G.max tufA gene for chloroplast translation elongation factor EF-Tu
          Length = 2313

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            ||||||||||||||  | ||||||||||||||||||||||||||||| || ||||| || 
Sbjct: 1214 atggacggcgccatattagtcgtctccggcgccgacggccccatgccccaaaccaaagaa 1273

                                                                        
Query: 72   cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
            |||||  |  | || || || ||||||||||||| ||| || || ||| | |||||| | 
Sbjct: 1274 cacataatattagcgaaacaagtcggtgtccccaacatggtcgtgttcttaaacaagcaa 1333

                                   
Query: 132  gaccaggtcgacgacgaggagct 154
            ||||| ||||||||||| |||||
Sbjct: 1334 gaccaagtcgacgacgaagagct 1356



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 90/107 (84%)
 Strand = Plus / Plus

                                                                        
Query: 363  cagacagacctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggt 422
            ||||| ||||| |||||| | ||||| || || || ||||||||||||||||| ||||| 
Sbjct: 1565 cagaccgacctccccttcctcctcgccgtcgaagacgtcttctccatcaccggccgtggc 1624

                                                           
Query: 423  acagttgccactggccgtatcgagcgtggcaccgtcaaggttgggga 469
            || || |||||||||||| | |||||||||||| |||| || |||||
Sbjct: 1625 accgtcgccactggccgtgtagagcgtggcaccatcaaagtagggga 1671



to top

>emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete genome; segment 18/29
          Length = 292100

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                         
Query: 12    atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
             |||||||||||||||||||| ||| ||| | |||||||||| ||||||||||||||||||
Sbjct: 14480 atggacggcgccatcctcgtggtcgccgccaccgacggcccgatgccgcagaccaaggag 14539

                
Query: 72    cac 74
             |||
Sbjct: 14540 cac 14542



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                        
Query: 393   gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
             ||||| |||||| ||||||||||||| ||||| || | ||| ||||| |||||||||||
Sbjct: 14831 gaggacgtcttcaccatcaccggtcgcggtacggtcgtcaccggccgcatcgagcgtgg 14889



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 141   gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
             |||||||||||| | || ||||||||||| |||||||| ||||||||
Sbjct: 14609 gacgacgaggagatcctggagctcgtcgagctcgaggtgcgtgagct 14655



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 145/179 (81%)
 Strand = Plus / Plus

                                                                          
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
              ||||||||||| ||||| ||||| |||| | |||||||||| ||||||||||| ||||||
Sbjct: 676119 atggacggcgcgatcctggtcgtgtccgccaccgacggcccgatgccgcagacgaaggag 676178

                                                                          
Query: 72     cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
              ||| | || |||||    |||||||| || |||  |||||| ||   ||| ||||||   
Sbjct: 676179 cacgtgctcctcgcccgccaggtcggcgtgccctacattgtcgtcgccctgaacaaggcc 676238

                                                                         
Query: 132    gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
              |||  |||||||||||||||| | || ||||||||||| || |||||||| ||||||||
Sbjct: 676239 gacatggtcgacgacgaggagatcctcgagctcgtcgagctggaggtccgggagctgct 676297



to top

>gb|S79408.1| tuf1=elongation factor Tu1 [Streptomyces collinus, BSM 40733,
           Genomic, 1358 nt]
          Length = 1358

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||||||||||||||| ||| ||| | |||||||||| ||||||||||||||||||
Sbjct: 449 atggacggcgccatcctcgtggtcgccgccaccgacggcccgatgccgcagaccaaggag 508

              
Query: 72  cac 74
           |||
Sbjct: 509 cac 511



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 141 gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||| | || ||||||||||| |||||||||||||||||
Sbjct: 578 gacgacgaggagatcctggagctcgtcgagctcgaggtccgtgagct 624



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
           ||||| |||||| | |||||||||||||| || || | ||| || ||||||||||||||
Sbjct: 800 gaggacgtcttcacgatcaccggtcgtggcaccgtcgtcaccggtcgtatcgagcgtgg 858



to top

>gb|AF153618.1|AF153618 Streptomyces netropsis elongation factor G (fus) gene, partial cds;
            and elongation factor Tu1 (tuf1) gene, complete cds
          Length = 2250

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||||||||||||||| ||| ||| | |||||||||| ||||||||||||||||||
Sbjct: 1157 atggacggcgccatcctcgtggtcgccgccaccgacggcccgatgccgcagaccaaggag 1216

               
Query: 72   cac 74
            |||
Sbjct: 1217 cac 1219



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 141  gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
            |||||||||||| | || ||||||||||| |||||||| ||||||||
Sbjct: 1286 gacgacgaggagatcctggagctcgtcgagctcgaggtgcgtgagct 1332



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                    
Query: 393  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 448
            ||||| |||||| | |||||||||||||| || || | ||| || |||||||||||
Sbjct: 1508 gaggacgtcttcacgatcaccggtcgtggcaccgtcgtcaccggtcgtatcgagcg 1563



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 145/179 (81%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||| ||||| || ||||||| ||| |||||||||||||||||||||   |||
Sbjct: 3276701 atggacggcgcgatcctggtggtctccgccgctgacggccccatgccgcagacccgtgag 3276642

                                                                           
Query: 72      cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
               |||||||| || ||    ||||| || || |||  ||| || || ||||| ||||||   
Sbjct: 3276641 cacatcctgctggcccgccaggtgggcgtgcccgccatcgtggtcttcctgaacaagtgc 3276582

                                                                          
Query: 132     gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
               |||  |||||| |||||||||||||| ||||| || || ||||||||||| ||||||||
Sbjct: 3276581 gacatggtcgatgacgaggagctgctggagctggtggagctcgaggtccgcgagctgct 3276523



to top

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||| ||||||||||| |||| |||||| ||||||||||||||||||   |||
Sbjct: 3146758 atggacggcgcgatcctcgtcgtatccgccgccgatggccccatgccgcagacccgcgag 3146699

                       
Query: 72      cacatcct 79
               ||||||||
Sbjct: 3146698 cacatcct 3146691



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||| ||||||||||| |||| |||||| ||||||||||||||||||   |||
Sbjct: 3130441 atggacggcgcgatcctcgtcgtatccgccgccgatggccccatgccgcagacccgcgag 3130382

                       
Query: 72      cacatcct 79
               ||||||||
Sbjct: 3130381 cacatcct 3130374



to top

>ref|XM_323038.1| Neurospora crassa OR74A hypothetical protein ( (AL513467) probable
           translation elongation factor EF-Tu precursor,
           mitochondrial [Neurospora crassa OR74> (NCU03737.1)
           partial mRNA; nuclear gene for mitochondrial product
          Length = 1314

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                       
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
           ||||||||||||||||||||| |||| |||||||| || ||| |||||||| ||||||||
Sbjct: 754 gttgaggatgtcttctccatcgccggccgtggtaccgtcgcctctggccgtgtcgagcgt 813

                       
Query: 450 ggcaccgtcaag 461
           || ||| |||||
Sbjct: 814 ggtaccctcaag 825



to top

>ref|XM_956420.1| Neurospora crassa OR74A hypothetical protein ( (AL513467) probable
           translation elongation factor EF-Tu precursor,
           mitochondrial [Neurospora crassa OR74A> (NCU03737.1)
           partial mRNA
          Length = 1314

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                       
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
           ||||||||||||||||||||| |||| |||||||| || ||| |||||||| ||||||||
Sbjct: 754 gttgaggatgtcttctccatcgccggccgtggtaccgtcgcctctggccgtgtcgagcgt 813

                       
Query: 450 ggcaccgtcaag 461
           || ||| |||||
Sbjct: 814 ggtaccctcaag 825



to top

>gb|AY372040.1| Lactobacillus paracasei strain NCC 2461 Tuf gene, partial cds
          Length = 699

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 334 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 393

               
Query: 448 gtgg 451
           ||||
Sbjct: 394 gtgg 397



to top

>gb|AY372039.1| Lactobacillus paracasei strain NCC 989 Tuf gene, partial cds
          Length = 701

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 335 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 394

               
Query: 448 gtgg 451
           ||||
Sbjct: 395 gtgg 398



to top

>emb|AJ459399.1|LPA459399 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 335
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459398.1|LPA459398 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 25303
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459397.1|LPA459397 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 25180
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459396.1|LPA459396 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain DSM 20207
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459395.1|LPA459395 Lactobacillus paracasei subsp. tolerans partial mRNA for putative
           elongation factor Tu (tuf gene), strain DSM 20012
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459394.1|LPA459394 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 11582
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459393.1|LPA459393 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain NCFB 151
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459392.1|LPA459392 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 27092
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459391.1|LPA459391 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain DSM 20006
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459389.1|LPA459389 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain NCDO206
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459388.1|LPA459388 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain NCDO 205
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459387.1|LZE459387 Lactobacillus zeae partial mRNA for putative elongation factor Tu
           (tuf gene), strain ATCC 15820
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| ||||||||||| |||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtaccgttgcttctggccgtatcgatc 406

                           
Query: 448 gtggcaccgtcaaggt 463
           |||| ||||| |||||
Sbjct: 407 gtggtaccgttaaggt 422



to top

>emb|AJ459386.1|LCA459386 Lactobacillus casei partial mRNA for putative elongation factor Tu
           (tuf gene), strain ATCC 4646
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459385.1|LPA459385 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 29599
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ418937.2|LCA418937 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 27216
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ418923.2|LCA418923 Lactobacillus casei partial mRNA for putative elongation factor Tu
           (tuf gene), strain ATCC 334
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ418922.2|LCA418922 Lactobacillus paracasei subsp. tolerans partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 25599
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ418912.2|LCA418912 Lactobacillus casei subsp. pseudoplantarum partial mRNA for
           putative elongation factor Tu (tuf gene), strain ATCC
           25598
          Length = 761

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>gb|AF368284.1|AF368284 Streptomyces aureofaciens strain 84/25 elongation factor Tu (tuf1)
           gene, complete cds
          Length = 1374

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           ||||||||||||||||| || ||| ||| | |||||||||| ||||||||||||||||||
Sbjct: 431 atggacggcgccatcctggtggtcgccgccaccgacggcccgatgccgcagaccaaggag 490

                   
Query: 72  cacatcct 79
           ||| ||||
Sbjct: 491 cacgtcct 498



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | |||||||||||||| || || | ||| || ||||||||||| |||
Sbjct: 782 gaggacgtcttcacgatcaccggtcgtggcaccgtcgtcaccggtcgtatcgagcgcggc 841

                      
Query: 453 accgtcaaggt 463
           | | |||||||
Sbjct: 842 atcctcaaggt 852



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 141 gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||| | || ||||||||||| |||||||| || |||||
Sbjct: 560 gacgacgaggagatcctggagctcgtcgagctcgaggtgcgcgagct 606



to top

>emb|AL513467.1|NC17E5 Neurospora crassa DNA linkage group V Cosmid contig 17E5
          Length = 130049

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 64/72 (88%)
 Strand = Plus / Minus

                                                                         
Query: 390   gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
             ||||||||||||||||||||| |||| |||||||| || ||| |||||||| ||||||||
Sbjct: 23973 gttgaggatgtcttctccatcgccggccgtggtaccgtcgcctctggccgtgtcgagcgt 23914

                         
Query: 450   ggcaccgtcaag 461
             || ||| |||||
Sbjct: 23913 ggtaccctcaag 23902



to top

>gb|AF007125.1|AF007125 Streptomyces aureofaciens elongation factor G (fus) gene, partial
           cds, and elongation factor Tu (tuf1) gene, complete cds
          Length = 1741

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| ||||||||||| ||| ||| | |||||||||| ||||||||||||||||||
Sbjct: 712 atggacggtgccatcctcgtggtcgccgccaccgacggcccgatgccgcagaccaaggag 771

              
Query: 72  cac 74
           |||
Sbjct: 772 cac 774



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 141 gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
           |||||||||||| | || ||||||||||| || ||||||||||||||||||
Sbjct: 841 gacgacgaggagatcctggagctcgtcgagcttgaggtccgtgagctgctc 891



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
            ||||| |||||| | |||||||||||||| || || | ||| ||||| |||||||||||
Sbjct: 1063 gaggacgtcttcacgatcaccggtcgtggcaccgtcgtcaccggccgcatcgagcgtgg 1121



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 128/158 (81%)
 Strand = Plus / Plus

                                                                          
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
              ||||||||||| || ||||| ||||||| |||||||||||||||||| ||||||   |||
Sbjct: 699069 atggacggcgcgattctcgttgtctccgccgccgacggccccatgccccagacccgcgag 699128

                                                                          
Query: 72     cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
              ||||| || || |||   ||||| || || |||  ||| ||||| ||||| ||||||   
Sbjct: 699129 cacattctgcttgctcgtcaggtaggggttccctacatcgttgtgttccttaacaaggct 699188

                                                    
Query: 132    gaccaggtcgacgacgaggagctgcttgagctcgtcga 169
              |||  |||||| ||||| ||||| ||||||||||||||
Sbjct: 699189 gacatggtcgatgacgaagagcttcttgagctcgtcga 699226



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 128/158 (81%)
 Strand = Plus / Plus

                                                                          
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
              ||||||||||| || ||||| ||||||| |||||||||||||||||| ||||||   |||
Sbjct: 682775 atggacggcgcgattctcgttgtctccgccgccgacggccccatgccccagacccgcgag 682834

                                                                          
Query: 72     cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
              ||||| || || |||   ||||| || || |||  ||| ||||| ||||| ||||||   
Sbjct: 682835 cacattctgcttgctcgtcaggtaggggttccctacatcgttgtgttccttaacaaggct 682894

                                                    
Query: 132    gaccaggtcgacgacgaggagctgcttgagctcgtcga 169
              |||  |||||| ||||| ||||| ||||||||||||||
Sbjct: 682895 gacatggtcgatgacgaagagcttcttgagctcgtcga 682932



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 399    gtcttctccatcaccggtcgtggtacagttgccactgg 436
              ||||| |||||| ||||||| ||||| |||||||||||
Sbjct: 699432 gtcttttccatctccggtcgcggtaccgttgccactgg 699469



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 399    gtcttctccatcaccggtcgtggtacagttgccactgg 436
              ||||| |||||| ||||||| ||||| |||||||||||
Sbjct: 683138 gtcttttccatctccggtcgcggtaccgttgccactgg 683175



to top

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                           
Query: 564     gacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtg 623
               ||||| ||||| || ||||| || ||||| |||||||||||||| ||| | |||||||||
Sbjct: 1929975 gacaacgttggtctcctgcttcgcggtattcagaaggaagacatcgagcgcggcatggtg 1930034

                                                     
Query: 624     ttggcaaagccgggttccatcacgccacacaccaagtt 661
               ||||  ||||| || |||||||| || |||||||||||
Sbjct: 1930035 ttggtgaagcctggctccatcacacctcacaccaagtt 1930072



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                           
Query: 378     ttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggc 437
               |||||| | ||| |||| ||||| ||||||||||| || || || || ||||| || || 
Sbjct: 1929789 ttcttgatggctattgaagatgtgttctccatcacgggccgaggcacggttgctaccggt 1929848

                                            
Query: 438     cgtatcgagcgtggcaccgtcaaggttgg 466
               |||||||||||||||| |||||| |||||
Sbjct: 1929849 cgtatcgagcgtggcatcgtcaaagttgg 1929877



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                           
Query: 48      ggccccatgccgcagaccaaggagcacatccttctcgctaagca 91
               ||||| ||| |||| ||||||||||||||||| || ||||||||
Sbjct: 1929489 ggcccgatggcgcaaaccaaggagcacatcctcctagctaagca 1929532



to top

>gb|U09443.1|PEU09443 Phormidium ectocarpi PCC 7375 protein synthesis elongation factor
           Tu (tufA) gene, partial cds
          Length = 706

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 378 ttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggc 437
           |||||| | ||||||||||| ||||||||||| || ||||||||||| || || ||||||
Sbjct: 394 ttcttgatggctgttgaggacgtcttctccattactggtcgtggtactgtagctactggc 453

                         
Query: 438 cgtatcgagcgtgg 451
           || |||||||||||
Sbjct: 454 cgaatcgagcgtgg 467



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 522 gttgagatgttccagaagacc 542
           |||||||||||||||||||||
Sbjct: 538 gttgagatgttccagaagacc 558



to top

>gb|AY372038.1| Lactobacillus casei strain NCC 2508 Tuf gene, partial cds
          Length = 700

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 396 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggcacc 455
           ||||||||| ||||||| ||||||||||| |||||  ||||||||||||| ||||| |||
Sbjct: 342 gatgtcttcaccatcactggtcgtggtactgttgcttctggccgtatcgatcgtggtacc 401

                   
Query: 456 gtcaaggt 463
           || |||||
Sbjct: 402 gttaaggt 409



to top

>emb|X76871.1|TCHOE5TUF T.cuprinus (Hoe5) tuf gene
          Length = 1191

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           ||||||||||||||||| ||||| |||| |||||||||||||||||| || |||   |||
Sbjct: 295 atggacggcgccatcctggtcgtgtccgccgccgacggccccatgccccaaacccgcgag 354

                   
Query: 72  cacatcct 79
           ||||||||
Sbjct: 355 cacatcct 362



to top

>emb|AJ459390.1|LCA459390 Lactobacillus casei subsp. casei partial mRNA for putative
           elongation factor Tu (tuf gene), strain NCDO173
          Length = 761

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 396 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggcacc 455
           ||||||||| ||||||| ||||||||||| |||||  ||||||||||||| ||||| |||
Sbjct: 355 gatgtcttcaccatcactggtcgtggtactgttgcttctggccgtatcgatcgtggtacc 414

                   
Query: 456 gtcaaggt 463
           || |||||
Sbjct: 415 gttaaggt 422



to top

>emb|AJ418933.2|LZE418933 Lactobacillus zeae partial mRNA for putative elongation factor Tu
           (tuf gene), strain ATCC 393
          Length = 761

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 396 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggcacc 455
           ||||||||| ||||||| ||||||||||| |||||  ||||||||||||| ||||| |||
Sbjct: 355 gatgtcttcaccatcactggtcgtggtactgttgcttctggccgtatcgatcgtggtacc 414

                   
Query: 456 gtcaaggt 463
           || |||||
Sbjct: 415 gttaaggt 422



to top

>gb|AY860112.1| Micromonospora sp. ATCC 39149 RpsL (rpsL), RpsG (rpsG), FusA (fusA),
            Tuf1 (tuf1), RpsJ (rpsJ), RplC (rplC), RplD (rplD), and
            RplW (rplW) genes, complete cds; and RplB (rplB) gene,
            partial cds
          Length = 8196

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                        
Query: 120  ctcaacaagaaggaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtc 179
            ||||||||||  |||  |||||||||||||||||| || ||||||||||| |||||||| 
Sbjct: 4757 ctcaacaagagcgacatggtcgacgacgaggagctcctggagctcgtcgagctcgaggtg 4816

                        
Query: 180  cgtgagctgctc 191
            || |||||||||
Sbjct: 4817 cgcgagctgctc 4828



to top

>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                         
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgc 430
              ||||||||||||||||||||||| ||||||||||||| |||||
Sbjct: 836025 ctgttgaggatgtcttctccatctccggtcgtggtactgttgc 836067



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                          
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
              ||||||||||||| ||||||||| |||||||||| || |||||||| || ||| | ||||
Sbjct: 852342 ctgttgaggatgttttctccatctccggtcgtggcacggttgccaccggtcgtgttgagc 852401

                  
Query: 448    gtgg 451
              ||||
Sbjct: 852402 gtgg 852405



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 44      cgacggccccatgccgcagacc 65
               ||||||||||||||||||||||
Sbjct: 1418988 cgacggccccatgccgcagacc 1418967



to top

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                          
Query: 390    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
              |||||||| || ||||| ||||| ||||||||||||||||| ||||||||| | ||||||
Sbjct: 181693 gttgaggacgtattctctatcactggtcgtggtacagttgcgactggccgtgtagagcgt 181752

                 
Query: 450    ggc 452
              |||
Sbjct: 181753 ggc 181755



to top

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               |||||||||||||||||||| ||| ||| | |||||||||| ||| | ||||||   |||
Sbjct: 2090184 atggacggcgccatcctcgtggtcgccgccaccgacggcccgatggcccagacccgcgag 2090125

                                         
Query: 72      cacatccttctcgctaagcaggtcgg 97
               ||| |||| ||||| |||||||||||
Sbjct: 2090124 cacgtcctgctcgccaagcaggtcgg 2090099



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                  
Query: 141     gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
               |||||||||||| | || ||||||||||| || ||||||||||||||||||
Sbjct: 2090055 gacgacgaggagatcctggagctcgtcgagcttgaggtccgtgagctgctc 2090005



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                     
Query: 137     ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
               ||||||||||||||||||||||||||| ||||| || |||||||| ||| ||||
Sbjct: 3126375 ggtcgacgacgaggagctgcttgagctggtcgagcttgaggtccgcgagttgct 3126322



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                         
Query: 137     ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggt 178
               ||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 3109144 ggtcgacgacgaggagctgcttgagctggtcgagctcgaggt 3109103



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               |||||||| || ||||| || || || | |||||||||||| ||||||||||||   |||
Sbjct: 3126500 atggacggggcgatcctggtggtttcggccgccgacggcccgatgccgcagacccgcgag 3126441

                          
Query: 72      cacatccttct 82
               ||||| |||||
Sbjct: 3126440 cacattcttct 3126430



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               |||||||| || ||||| || || || | |||||||||||| ||||||||||||   |||
Sbjct: 3109269 atggacggggcgatcctggtggtttcggccgccgacggcccgatgccgcagacccgcgag 3109210

                          
Query: 72      cacatccttct 82
               ||||| |||||
Sbjct: 3109209 cacattcttct 3109199



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 625     tggcaaagccgggttccatcacgccacacaccaagtt 661
               |||| ||||||||||| ||||| || |||||||||||
Sbjct: 3125911 tggccaagccgggttcgatcaccccgcacaccaagtt 3125875



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 625     tggcaaagccgggttccatcacgccacacaccaagtt 661
               |||| ||||||||||| ||||| || |||||||||||
Sbjct: 3108680 tggccaagccgggttcgatcaccccgcacaccaagtt 3108644



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                     
Query: 137     ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
               ||||||||||||||||||||| |||||||||||  | |||||||| ||||||||
Sbjct: 4621371 ggtcgacgacgaggagctgctcgagctcgtcgagatggaggtccgcgagctgct 4621424



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                     
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagacc 65
               ||||||||||| ||||| || ||| ||| | |||||||||| ||||||||||||
Sbjct: 4621246 atggacggcgcgatcctggtggtcgccgccaccgacggcccgatgccgcagacc 4621299



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                       
Query: 393     gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 448
               ||||| |||||| |||||||||||||||| || || | ||| |||||| |||||||
Sbjct: 4621594 gaggacgtcttcaccatcaccggtcgtggcacggtggtcaccggccgtgtcgagcg 4621649



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||||||||||||||||  |  ||| |||||||||||||| ||||||   |||
Sbjct: 2063116 atggacggcgccatcctcgtcgtcagctccgctgacggccccatgccccagacccgcgag 2063057

                             
Query: 72      cacatccttctcgc 85
               |||||||| |||||
Sbjct: 2063056 cacatcctcctcgc 2063043



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                          
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
              ||||||||||||||||||||||||  |  ||| |||||||||||||| ||||||   |||
Sbjct: 311439 atggacggcgccatcctcgtcgtcagctccgctgacggccccatgccccagacccgcgag 311498

                            
Query: 72     cacatccttctcgc 85
              |||||||| |||||
Sbjct: 311499 cacatcctcctcgc 311512



to top

>gb|U09444.1|PBU09444 Plectonema boryanum PCC 73110 protein synthesis elongation factor
           Tu (tufA) gene, partial cds
          Length = 706

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 121/150 (80%)
 Strand = Plus / Plus

                                                                       
Query: 516 actggtgttgagatgttccagaagaccatggatgatgccattgctggggacaatgttggc 575
           ||||| ||||||||||||||||||||  |||||  ||  || ||||| ||||| || |||
Sbjct: 532 actggcgttgagatgttccagaagacattggattctggtatggctggcgacaacgtgggc 591

                                                                       
Query: 576 ctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtgttggcaaagccg 635
            | ||||| |||||| | ||||| |||||||| ||| | ||||||||  |||| ||| | 
Sbjct: 592 gtactgcttcgtggtgttcagaaagaagacatcgagcgtggcatggtactggcgaagtcc 651

                                         
Query: 636 ggttccatcacgccacacaccaagtttgag 665
           || |||||||| || |||||| ||||||||
Sbjct: 652 ggctccatcacacctcacaccgagtttgag 681



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 107 cattgttgttttcctcaacaagaaggaccaggtcgacgacgaggagctgcttgagct 163
           ||||||||| ||| | |||||| | ||||| || |||||||| ||||||||||||||
Sbjct: 123 cattgttgtgttcatgaacaagcaagaccaagtagacgacgaagagctgcttgagct 179



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccac 433
           |||||||| || ||||| || || ||||||||||| ||||||||
Sbjct: 406 gttgaggacgtgttctctattacgggtcgtggtacggttgccac 449



to top

>ref|NM_118155.2| Arabidopsis thaliana ATP binding / GTP binding / translation
           elongation factor AT4G20360 mRNA, complete cds
          Length = 1758

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 580 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 639

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           || |||||| | ||||||||||| |||||
Sbjct: 640 catatccttttggctaagcaggttggtgt 668



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 373 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 941 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 992



to top

>gb|BT000998.1| Arabidopsis thaliana clone U19264 putative translation elongation
           factor EF-Tu precursor, chloroplast (At4g20360) mRNA,
           complete cds
          Length = 1462

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 496 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 555

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           || |||||| | ||||||||||| |||||
Sbjct: 556 catatccttttggctaagcaggttggtgt 584



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 373 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 857 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 908



to top

>gb|BT000699.1| Arabidopsis thaliana putative chloroplast translation elongation
           factor EF-Tu precursor (At4g20360) mRNA, complete cds
          Length = 1670

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 561 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 620

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           || |||||| | ||||||||||| |||||
Sbjct: 621 catatccttttggctaagcaggttggtgt 649



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 373 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 922 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 973



to top

>gb|BT000687.1| Arabidopsis thaliana clone RAFL09-18-H05 (R09411) putative
           chloroplast translation elongation factor EF-Tu
           precursor (At4g20360) mRNA, complete cds
          Length = 1671

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 559 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 618

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           || |||||| | ||||||||||| |||||
Sbjct: 619 catatccttttggctaagcaggttggtgt 647



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 373 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 920 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 971



to top

>gb|AY074355.1| Arabidopsis thaliana putative translation elongation factor EF-Tu
           precursor, chloroplast (At4g20360) mRNA, complete cds
          Length = 1688

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 580 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 639

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           || |||||| | ||||||||||| |||||
Sbjct: 640 catatccttttggctaagcaggttggtgt 668



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 373 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 941 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 992



to top

>emb|X52256.1|ATTUFA A.thaliana tufA gene for elongation factor Tu
          Length = 2272

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 910 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 969

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           || |||||| | ||||||||||| |||||
Sbjct: 970 catatccttttggctaagcaggttggtgt 998



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 373  tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
            |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 1271 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 1322



to top

>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                       
Query: 624    ttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgtg 680
              ||||||||||| ||| |||||| |||||||||||||||||| ||||  |||||||||
Sbjct: 455641 ttggcaaagccaggtaccatcaagccacacaccaagtttgaagcagaagtgtatgtg 455697



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                       
Query: 624    ttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgtg 680
              ||||||||||| ||| |||||| |||||||||||||||||| ||||  |||||||||
Sbjct: 439358 ttggcaaagccaggtaccatcaagccacacaccaagtttgaagcagaagtgtatgtg 439414



to top

>emb|AL161552.2|ATCHRIV52 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 52
          Length = 198427

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                          
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
              |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 188103 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 188162

                                           
Query: 72     cacatccttctcgctaagcaggtcggtgt 100
              || |||||| | ||||||||||| |||||
Sbjct: 188163 catatccttttggctaagcaggttggtgt 188191



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 373    tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
              |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 188464 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 188515



to top

>emb|AL080253.2|ATF9F13 Arabidopsis thaliana DNA chromosome 4, BAC clone F9F13 (ESSA project)
          Length = 109936

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 9129 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 9188

                                         
Query: 72   cacatccttctcgctaagcaggtcggtgt 100
            || |||||| | ||||||||||| |||||
Sbjct: 9189 catatccttttggctaagcaggttggtgt 9217



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 373  tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
            |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 9490 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 9541



to top

>gb|AF419609.1|AF419609 Arabidopsis thaliana AT4g20360/F9F13_10 mRNA, complete cds
          Length = 1663

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 562 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 621

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           || |||||| | ||||||||||| |||||
Sbjct: 622 catatccttttggctaagcaggttggtgt 650



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 373 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 923 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 974



to top

>gb|AF410329.1|AF410329 Arabidopsis thaliana AT4g20360/F9F13_10 mRNA, complete cds
          Length = 1669

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 560 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 619

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           || |||||| | ||||||||||| |||||
Sbjct: 620 catatccttttggctaagcaggttggtgt 648



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 373 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 921 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 972



to top

>emb|BX827505.1|CNS0A2SS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS66ZD02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1617

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 541 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 600

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           || |||||| | ||||||||||| |||||
Sbjct: 601 catatccttttggctaagcaggttggtgt 629



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 373 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 902 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 953



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 119/152 (78%)
 Strand = Plus / Plus

                                                                        
Query: 513  gtcactggtgttgagatgttccagaagaccatggatgatgccattgctggggacaatgtt 572
            |||||||| ||||| ||||| |||||||   | ||||| ||  | ||||| |||||||| 
Sbjct: 1042 gtcactggggttgaaatgtttcagaagattcttgatgaggctttagctggtgacaatgta 1101

                                                                        
Query: 573  ggcctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtgttggcaaag 632
            ||  || |||| || ||||| || ||||  || ||| ||||||| ||||| || || |||
Sbjct: 1102 gggttgttgcttcggggtattcaaaaggctgatattcagagaggtatggttttagctaag 1161

                                            
Query: 633  ccgggttccatcacgccacacaccaagtttga 664
            ||||| || || || ||||| |||||||||||
Sbjct: 1162 ccgggatcgattactccacataccaagtttga 1193



to top

>gb|BT002642.1| Arabidopsis thaliana At4g20360/F9F13_10 gene, complete cds
          Length = 1431

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           |||||||| || |||||||| || ||||||||||| || || ||||| ||||| || |||
Sbjct: 496 atggacggagctatcctcgttgtttccggcgccgatggtcctatgcctcagactaaagag 555

                                        
Query: 72  cacatccttctcgctaagcaggtcggtgt 100
           || |||||| | ||||||||||| |||||
Sbjct: 556 catatccttttggctaagcaggttggtgt 584



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 373 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 424
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 857 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 908



to top

>emb|X17442.1|ANORF150 A.nidulans DNA for a region containing ORF150, rps12, rps7, fus, tufA
          Length = 5139

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                    
Query: 411  accggtcgtggtacagttgccactggccgtatcgagcgtggcaccgtcaaggttgg 466
            ||||||||||| || || || |||||||| ||||||||||||| ||||||||||||
Sbjct: 4515 accggtcgtggcacggtggcgactggccggatcgagcgtggcagcgtcaaggttgg 4570



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgcc 58
            |||||||||||||||||||| || || |  || ||||||||||||||
Sbjct: 4116 atggacggcgccatcctcgtggtgtcggctgctgacggccccatgcc 4162



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                            
Query: 618  atggtgttggcaaagccgggttccatcacgccacacaccaagtttgag 665
            ||||| ||||| || || ||||| || ||||| |||||||||||||||
Sbjct: 4722 atggtcttggccaaacccggttcgattacgcctcacaccaagtttgag 4769



to top

>dbj|AP007154.1| Aspergillus oryzae RIB40 genomic DNA, SC001
          Length = 2005935

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                          
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
              |||| ||||| |||||||||||| ||||||||||||| |||||| | |||||| |||| |
Sbjct: 834275 ctgtcgaggaagtcttctccatcgccggtcgtggtaccgttgcctccggccgtgtcgaac 834216

                  
Query: 448    gtgg 451
              ||||
Sbjct: 834215 gtgg 834212



to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                      
Query: 411    accggtcgtggtacagttgccactggccgtatcgagcgtggcaccgtcaaggttgg 466
              ||||||||||| || || || |||||||| ||||||||||||| ||||||||||||
Sbjct: 730632 accggtcgtggcacggtggcgactggccggatcgagcgtggcagcgtcaaggttgg 730687



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                             
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgcc 58
              |||||||||||||||||||| || || |  || ||||||||||||||
Sbjct: 730233 atggacggcgccatcctcgtggtgtcggctgctgacggccccatgcc 730279



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                              
Query: 618    atggtgttggcaaagccgggttccatcacgccacacaccaagtttgag 665
              ||||| ||||| || || ||||| || ||||| |||||||||||||||
Sbjct: 730839 atggtcttggccaaacccggttcgattacgcctcacaccaagtttgag 730886



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||||||||| || || || | |||||||||||||||||| ||||||   |||
Sbjct: 3398336 atggacggcgccatcctggtggtttcggccgccgacggccccatgccccagacccgcgag 3398277

                       
Query: 72      cacatcct 79
               ||||||||
Sbjct: 3398276 cacatcct 3398269



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||||||||| || || || | |||||||||||||||||| ||||||   |||
Sbjct: 3378329 atggacggcgccatcctggtggtgtcggccgccgacggccccatgccccagacccgcgag 3378270

                       
Query: 72      cacatcct 79
               ||||||||
Sbjct: 3378269 cacatcct 3378262



to top

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               |||||||| |||||||| ||||| ||||  ||||||||||| ||||||||||||  ||| 
Sbjct: 2554414 atggacggtgccatcctggtcgtgtccgcagccgacggcccgatgccgcagacccgggaa 2554355

                       
Query: 72      cacatcct 79
               ||||||||
Sbjct: 2554354 cacatcct 2554347



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               |||||||| |||||||| ||||| ||||  ||||||||||| ||||||||||||  ||| 
Sbjct: 1110065 atggacggtgccatcctggtcgtgtccgcagccgacggcccgatgccgcagacccgggaa 1110124

                       
Query: 72      cacatcct 79
               ||||||||
Sbjct: 1110125 cacatcct 1110132



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 143/180 (79%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||| ||||| ||||| || | ||| |||||||| ||||||||||||   |||
Sbjct: 5937884 atggacggcgcgatcctggtcgtgtcggccgctgacggcccgatgccgcagacccgcgag 5937825

                                                                           
Query: 72      cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
               |||||||| |||||    |||||||| || |||    | || || ||||||||||||   
Sbjct: 5937824 cacatcctgctcgcccgccaggtcggcgtgcccgcgctcgtcgtgttcctcaacaagtgc 5937765

                                                                           
Query: 132     gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
               |||  |||||||||    |||||||| ||||||||||| ||||| ||||| |||||||||
Sbjct: 5937764 gacatggtcgacgatcccgagctgctcgagctcgtcgagctcgaagtccgcgagctgctc 5937705



to top

>emb|X76869.1|PN20475 P.niger (DSM 20475) tuf gene
          Length = 1053

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           ||||||||||||||||||||||||||||  || ||||| |||||||| || |||   |||
Sbjct: 295 atggacggcgccatcctcgtcgtctccgcagcagacggtcccatgccccaaacccgcgag 354

                   
Query: 72  cacatcct 79
           ||||||||
Sbjct: 355 cacatcct 362



to top

>gb|AF153617.1|AF153617 Streptomyces mobaraensis elongation factor G (fus) gene, partial cds;
            and elongation factor Tu1 (tuf1) gene, complete cds
          Length = 1770

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                
Query: 141  gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctca 192
            |||||||||||| | || ||||||||||| ||||||||||||||||| ||||
Sbjct: 976  gacgacgaggagatcctggagctcgtcgagctcgaggtccgtgagctcctca 1027



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           ||||||||||| |||||||| ||| |||   ||||||| || ||||||||||||||||||
Sbjct: 847 atggacggcgcgatcctcgtggtcgccgcgaccgacggtccgatgccgcagaccaaggag 906

              
Query: 72  cac 74
           |||
Sbjct: 907 cac 909



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 393  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 448
            ||||| |||||| | |||||||||||||| || || | ||| ||||||||||||||
Sbjct: 1198 gaggacgtcttcacgatcaccggtcgtggcaccgtcgtcaccggccgtatcgagcg 1253



to top

>gb|U78300.1|TCU78300 Thiobacillus cuprinus complete streptomycin operon, ribosomal protein
             S12 (rpsL), ribosomal protein S7 (rpsG), elongation
            factor G (fus) and elongation factor Tu (tuf) genes,
            complete cds
          Length = 5203

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            ||||||||||||||||| ||||| |||| || ||||||||||||||| || |||   |||
Sbjct: 3946 atggacggcgccatcctggtcgtgtccgccggcgacggccccatgccccaaacccgcgag 4005

                    
Query: 72   cacatcct 79
            ||||||||
Sbjct: 4006 cacatcct 4013



to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                      
Query: 411    accggtcgtggtacagttgccactggccgtatcgagcgtggcaccgtcaaggttgg 466
              ||||||||||| || || || |||||||| ||||||||||||| ||||||||||||
Sbjct: 890233 accggtcgtggcacggtggcgactggccggatcgagcgtggcagcgtcaaggttgg 890178



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgcc 58
              |||||||||||||||||||| || || |  || ||||||||||||||
Sbjct: 890632 atggacggcgccatcctcgtggtgtcggctgctgacggccccatgcc 890586



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                              
Query: 618    atggtgttggcaaagccgggttccatcacgccacacaccaagtttgag 665
              ||||| ||||| || || ||||| || ||||| |||||||||||||||
Sbjct: 890026 atggtcttggccaaacccggttcgattacgcctcacaccaagtttgag 889979



to top

>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                             
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgcc 58
              ||||||||||||||||||||||| ||||  || ||||||||||||||
Sbjct: 286766 atggacggcgccatcctcgtcgtatccgctgcagacggccccatgcc 286812



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgca 61
              |||||||||||||||||||| || ||||  || |||||||||||||||||
Sbjct: 270397 atggacggcgccatcctcgttgtatccgctgcagacggccccatgccgca 270446



to top

>emb|Z99104.2|BSUB0001 Bacillus subtilis complete genome (section 1 of 21): from 1 to 213080
          Length = 213080

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                 
Query: 390    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
              |||||||| || ||||| ||||| ||||||||||||||||| |||||||||
Sbjct: 133526 gttgaggacgtattctcaatcactggtcgtggtacagttgctactggccgt 133576



to top

>emb|X98831.1|SCFUSTUF S.cinnamoneus fus and tuf genes
          Length = 1794

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           ||||||||||| |||||||| ||| |||   ||||||| || ||||||||||||||||||
Sbjct: 662 atggacggcgcgatcctcgtggtcgccgcgaccgacggtccgatgccgcagaccaaggag 721

              
Query: 72  cac 74
           |||
Sbjct: 722 cac 724



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 141 gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||| |  | ||||||||||| |||||||||||||||||
Sbjct: 791 gacgacgaggagatcatggagctcgtcgagctcgaggtccgtgagct 837



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                    
Query: 393  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 448
            ||||| |||||| | |||||||||||||| || || | ||| || |||||||||||
Sbjct: 1013 gaggacgtcttcacgatcaccggtcgtggcaccgtcgtcaccggtcgtatcgagcg 1068



to top

>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome
          Length = 4202352

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                             
Query: 390    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
              ||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 167281 gttgaggatgtattctctatcactggtcgtggtacagttgctactgg 167327



to top

>dbj|D64127.1| Bacillus subtilis genes for RNA polymerase beta subunit, ribosomal
            proteins L12 and S7, elongation factors G and Tu and
            ribosomal proteins S10 and L3, partial and complete cds
          Length = 8977

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 390  gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
            |||||||| || ||||| ||||| ||||||||||||||||| |||||||||
Sbjct: 6614 gttgaggacgtattctcaatcactggtcgtggtacagttgctactggccgt 6664



to top

>dbj|AB017508.1| Bacillus halodurans C-125 genomic DNA, 32 kb fragment, complete cds
          Length = 32050

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 390   gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
             ||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 11795 gttgaggatgtattctctatcactggtcgtggtacagttgctactgg 11841



to top

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 67/78 (85%), Gaps = 1/78 (1%)
 Strand = Plus / Minus

                                                                          
Query: 2      gctgcccagnatggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgca 61
              ||||||||| ||||||||||| ||||| || ||||||   ||||||||||||||||| ||
Sbjct: 699534 gctgcccag-atggacggcgcgatcctggtggtctcctcggccgacggccccatgcccca 699476

                                
Query: 62     gaccaaggagcacatcct 79
              ||||   |||||||||||
Sbjct: 699475 gacccgcgagcacatcct 699458



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||| ||||| || ||||||   ||||||||||||||||| ||||||   |||
Sbjct: 1966722 atggacggcgcgatcctggtggtctcctcggccgacggccccatgccccagacccgcgag 1966663

                       
Query: 72      cacatcct 79
               ||||||||
Sbjct: 1966662 cacatcct 1966655



to top

>emb|AJ781773.3| Lactobacillus buchneri partial tuf gene for elongation factor Tu
          Length = 518

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
           ||||| ||||||||| | ||||| ||||||||||| |||||  ||||||||||||| |||
Sbjct: 202 gttgaagatgtcttcactatcactggtcgtggtactgttgcatctggccgtatcgatcgt 261

             
Query: 450 gg 451
           ||
Sbjct: 262 gg 263



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||| ||||| || || || | |||||||||||| ||||||||||||   |||
Sbjct: 3825900 atggacggcgcgatcctggtggtttcggccgccgacggcccgatgccgcagacccgcgag 3825841

                             
Query: 72      cacatccttctcgc 85
               |||||||| |||||
Sbjct: 3825840 cacatcctgctcgc 3825827



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                 
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgca 61
               |||||||||||||| || ||||| |||| ||| |||||||||||||||||
Sbjct: 4010540 atggacggcgccattctggtcgtgtccgccgctgacggccccatgccgca 4010491



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                 
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgca 61
               |||||||||||||| || ||||| |||| ||| ||||| |||||||||||
Sbjct: 4237755 atggacggcgccattctggtcgtgtccgccgctgacggtcccatgccgca 4237706



to top

>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               |||||||| |||||| |||||||| ||| | ||||||| |||||||| ||||||   |||
Sbjct: 3019797 atggacggtgccatcatcgtcgtcgccgccaccgacggtcccatgccccagacccgtgag 3019856

                             
Query: 72      cacatccttctcgc 85
               |||||||| |||||
Sbjct: 3019857 cacatcctgctcgc 3019870



to top

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 67/78 (85%), Gaps = 1/78 (1%)
 Strand = Plus / Plus

                                                                          
Query: 2      gctgcccagnatggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgca 61
              ||||||||| |||||||||||||| || |||||||||   |||||||| |||||||| ||
Sbjct: 436293 gctgcccag-atggacggcgccattcttgtcgtctcctctgccgacggtcccatgcccca 436351

                                
Query: 62     gaccaaggagcacatcct 79
              ||||   |||||||||||
Sbjct: 436352 gacccgcgagcacatcct 436369



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 67/78 (85%), Gaps = 1/78 (1%)
 Strand = Plus / Plus

                                                                          
Query: 2      gctgcccagnatggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgca 61
              ||||||||| |||||||||||||| || |||||||||   |||||||| |||||||| ||
Sbjct: 419772 gctgcccag-atggacggcgccattcttgtcgtctcctctgccgacggtcccatgcccca 419830

                                
Query: 62     gaccaaggagcacatcct 79
              ||||   |||||||||||
Sbjct: 419831 gacccgcgagcacatcct 419848



to top

>emb|AL111934.1|CNS019PI Botrytis cinerea strain T4 cDNA library
          Length = 780

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
           ||||||||||| ||||||||| | |||||||| || || ||| |||||||| ||||||||
Sbjct: 335 gttgaggatgttttctccatcccaggtcgtggaactgtcgcctctggccgtgtcgagcgt 394

             
Query: 450 gg 451
           ||
Sbjct: 395 gg 396



to top

>dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete genome
          Length = 3630528

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                          
Query: 390    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
              ||||||||||| ||||| ||||| |||||||| |||||||| ||||| ||| | ||||||
Sbjct: 140371 gttgaggatgtattctcaatcactggtcgtggaacagttgcaactggacgtgttgagcgt 140430

                
Query: 450    gg 451
              ||
Sbjct: 140431 gg 140432



to top

>gb|U09445.1|PHU09445 Prochlorothrix hollandica protein synthesis elongation factor Tu
           (tufA) gene, cds
          Length = 703

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 391 ttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 448
           ||||||||||||||||||| ||||||||||| || || ||||| || ||||| |||||
Sbjct: 407 ttgaggatgtcttctccattaccggtcgtggaaccgtggccaccggtcgtattgagcg 464



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                               
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
              |||| |||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 120017 ctgtagaggatgtattctctatcacaggtcgtggtacagttgctactgg 120065



to top

>gb|U09434.1|GSU09434 Gloeothece PCC6501 protein synthesis elongation factor Tu (tufA)
           gene, partial cds
          Length = 706

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 396 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 448
           ||||||||||| ||||||||||| || |||||||| ||||| || ||||||||
Sbjct: 412 gatgtcttctctatcaccggtcggggaacagttgctactggacggatcgagcg 464



to top

>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome
          Length = 2201561

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                          
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
              ||||||| ||||| ||||| ||| | |||||||| |||||||  ||||| ||||||||||
Sbjct: 343785 ctgttgaagatgttttctcaatctctggtcgtggaacagttgtaactggtcgtatcgagc 343844

                  
Query: 448    gtgg 451
              ||||
Sbjct: 343845 gtgg 343848



to top

>gb|AY372037.1| Lactobacillus rhamnosus strain NCC 2504 Tuf gene, partial cds
          Length = 701

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| |||| || ||||||||||| |||||  |||| |||||||| |
Sbjct: 335 ctgttgaagatgtcttcaccattactggtcgtggtaccgttgcttctggtcgtatcgatc 394

               
Query: 448 gtgg 451
           ||||
Sbjct: 395 gtgg 398



to top

>gb|AY305397.1| Synthetic construct reconstructed ancestral elongation factor Tu
           Alt-stem gene, complete cds
          Length = 1185

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 625 tggcaaagccgggttccatcacgccacacaccaagtttga 664
           |||| |||||||||  ||||||||||||||||||||||||
Sbjct: 878 tggctaagccgggtagcatcacgccacacaccaagtttga 917



to top

>emb|Y15107.1|GMTUFA2 Glycine max tufA2 gene
          Length = 890

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 402 ttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggcaccgtcaag 461
           |||||||||||||| ||||| || || ||||| |||||  | ||||||||||||||||| 
Sbjct: 202 ttctccatcaccggccgtgggaccgtcgccaccggccgcgtagagcgtggcaccgtcaaa 261

                   
Query: 462 gttgggga 469
           || |||||
Sbjct: 262 gtagggga 269



to top

>emb|X77033.1|CVTUF Chlorobium vibrioforme tuf gene for elongation factor Tu
          Length = 1182

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 71/84 (84%), Gaps = 1/84 (1%)
 Strand = Plus / Plus

                                                                       
Query: 2   gctgcccagnatggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgca 61
           ||||||||| ||||||||||| |||||||||||  ||||  |||||||||| ||||| ||
Sbjct: 286 gctgcccag-atggacggcgctatcctcgtcgttgccggtaccgacggcccgatgcctca 344

                                   
Query: 62  gaccaaggagcacatccttctcgc 85
           |||    ||||||||||| |||||
Sbjct: 345 gactcgtgagcacatcctgctcgc 368



to top

>emb|X76867.1|FF13524 F.ferrugineum (DSM 13524) tuf gene
          Length = 1188

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| || ||||| ||||| ||||||||||| ||||| || || |||||||||||||||
Sbjct: 646 gaggacgtattctctatcactggtcgtggtactgttgctaccggtcgtatcgagcgtggc 705



to top

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                           
Query: 388     ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
               ||||||| ||||||||||| ||| ||||||||||||| ||||| || || ||| | ||||
Sbjct: 1271748 ctgttgaagatgtcttctctatctccggtcgtggtactgttgcaaccggtcgtgttgagc 1271807

                   
Query: 448     gtgg 451
               ||||
Sbjct: 1271808 gtgg 1271811



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                           
Query: 388     ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
               ||||||||||||| ||||| ||| |||||||||| || || || || || ||| | ||||
Sbjct: 1254879 ctgttgaggatgtattctctatctccggtcgtggaactgtagcaaccggtcgtgttgagc 1254938

                                  
Query: 448     gtggcaccgtcaaggttgg 466
               |||| | | ||||||||||
Sbjct: 1254939 gtggtatcatcaaggttgg 1254957



to top

>emb|AJ786714.1| Lactobacillus kimchii partial tuf gene for elongation factor Tu
          Length = 525

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| | ||||| ||||||||||| |||||  |||| |||||||| |
Sbjct: 203 ctgttgaagatgtcttcactatcactggtcgtggtactgttgcatctggtcgtatcgatc 262

               
Query: 448 gtgg 451
           ||||
Sbjct: 263 gtgg 266



to top

>emb|AJ786713.1| Lactobacillus alimentarius partial tuf gene for elongation factor
           Tu
          Length = 510

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| | ||||| ||||||||||| |||||  |||| |||||||| |
Sbjct: 185 ctgttgaagatgtcttcactatcactggtcgtggtactgttgcatctggtcgtatcgacc 244

               
Query: 448 gtgg 451
           ||||
Sbjct: 245 gtgg 248



to top

>emb|AJ459829.1|LRH459829 Lactobacillus rhamnosus partial tuf gene for putative elongation
           factor Tu, strain ATCC 11981
          Length = 761

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| |||| || ||||||||||| |||||  |||| |||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccattactggtcgtggtaccgttgcttctggtcgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ459828.1|LRH459828 Lactobacillus rhamnosus partial tuf gene for putative elongation
           factor Tu, strain ATCC 11443
          Length = 761

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| |||| || ||||||||||| |||||  |||| |||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccattactggtcgtggtaccgttgcttctggtcgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ418939.2|LRH418939 Lactobacillus rhamnosus partial mRNA for putative elongation factor
           Tu (tuf gene), strain ATCC 7469
          Length = 761

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| |||| || ||||||||||| |||||  |||| |||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccattactggtcgtggtaccgttgcttctggtcgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ418930.2|LAG418930 Lactobacillus agilis partial mRNA for putative elongation factor Tu
           (tuf gene), strain NCIB 11716
          Length = 761

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||| | ||||| ||||||||||| |||||  |||| |||||||| |
Sbjct: 347 ctgttgaagatgtcttcactatcacaggtcgtggtactgttgcttctggtcgtatcgacc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>emb|AJ418920.2|LPE418920 Lactobacillus pentosus partial mRNA for putative elongation factor
           Tu (tuf gene), strain ATCC 8041
          Length = 761

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           ||||||| ||||||||||| ||||| |||||||| || |||||  |||| |||||||| |
Sbjct: 347 ctgttgaagatgtcttctcaatcactggtcgtgggactgttgcttctggtcgtatcgatc 406

               
Query: 448 gtgg 451
           ||||
Sbjct: 407 gtgg 410



to top

>gb|AE006470.1| Chlorobium tepidum TLS, complete genome
          Length = 2154946

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||| |||||||||||  ||||  |||||||||| ||||| ||||||   |||
Sbjct: 2065711 atggacggcgctatcctcgtcgttgccggtaccgacggcccgatgccccagacccgtgag 2065652

                       
Query: 72      cacatcct 79
               ||||||||
Sbjct: 2065651 cacatcct 2065644



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 630     aagccgggttccatcacgccacacaccaagtt 661
               ||||||||||| || || ||||||||||||||
Sbjct: 2065126 aagccgggttcgattaccccacacaccaagtt 2065095



to top

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||||||||| |||||   ||  ||||||||||| ||||||||||||   |||
Sbjct: 1687682 atggacggcgccatcctggtcgtgaacgctgccgacggcccgatgccgcagacccgcgag 1687623

                       
Query: 72      cacatcct 79
               ||||||||
Sbjct: 1687622 cacatcct 1687615



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 139/176 (78%)
 Strand = Plus / Plus

                                                                          
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
              ||||||||||| ||||| || || || | |||||||||||| ||||||||||||   |||
Sbjct: 208247 atggacggcgcgatcctggtggtgtcggccgccgacggcccgatgccgcagacccgcgag 208306

                                                                          
Query: 72     cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
              |||||||| || ||    |||||||| || ||    || || || ||||| ||||||   
Sbjct: 208307 cacatcctgcttgcccgtcaggtcggcgtgccgtcgatcgtggtgttcctgaacaaggtc 208366

                                                                      
Query: 132    gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
              ||||||||||||||||  |||||||| || || ||||| |||||||| || |||||
Sbjct: 208367 gaccaggtcgacgacgctgagctgctcgaactggtcgagctcgaggttcgcgagct 208422



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 139/176 (78%)
 Strand = Plus / Plus

                                                                          
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
              ||||||||||| ||||| || || || | |||||||||||| ||||||||||||   |||
Sbjct: 185376 atggacggcgcgatcctggtggtgtcggccgccgacggcccgatgccgcagacccgcgag 185435

                                                                          
Query: 72     cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
              |||||||| || ||    |||||||| || ||    || || || ||||| ||||||   
Sbjct: 185436 cacatcctgcttgcccgtcaggtcggcgtgccgtcgatcgtggtgttcctgaacaaggtc 185495

                                                                      
Query: 132    gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
              ||||||||||||||||  |||||||| || || ||||| |||||||| || |||||
Sbjct: 185496 gaccaggtcgacgacgctgagctgctcgaactggtcgagctcgaggttcgcgagct 185551



to top

>gb|DQ098151.1| Uncultured Pseudonocardia sp. clone colony 30 Tuf1 (tuf1) gene,
           partial cds
          Length = 691

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 459 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 518

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 519 atcgtcaaggt 529



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098149.1| Uncultured Pseudonocardia sp. clone colony 168 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098148.1| Uncultured Pseudonocardia sp. clone colony 167 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098147.1| Uncultured Pseudonocardia sp. clone colony SP011026-1 Tuf1 (tuf1)
           gene, partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098146.1| Uncultured Pseudonocardia sp. clone colony CC030106-15 Tuf1 (tuf1)
           gene, partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098143.1| Uncultured Pseudonocardia sp. clone colony CC010325-7 Tuf1 (tuf1)
           gene, partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098141.1| Uncultured Pseudonocardia sp. clone colony 33 Tuf1 (tuf1) gene,
           partial cds
          Length = 691

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098140.1| Uncultured Pseudonocardia sp. clone colony 101 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098139.1| Uncultured Pseudonocardia sp. clone colony 12 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098138.1| Uncultured Pseudonocardia sp. clone colony 21 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098136.1| Uncultured Pseudonocardia sp. clone colony 31 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098135.1| Uncultured Pseudonocardia sp. clone colony 113 Tuf1 (tuf1) gene,
           partial cds
          Length = 681

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||||||
Sbjct: 223 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagctgctc 277



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 62/76 (81%)
 Strand = Plus / Plus

                                                                       
Query: 388 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 447
           |||| ||||| |||||| | ||||||||||| || || || | ||| |||||| ||||||
Sbjct: 444 ctgtcgaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtgtcgagc 503

                           
Query: 448 gtggcaccgtcaaggt 463
           | |||| ||| |||||
Sbjct: 504 gcggcatcgtgaaggt 519



to top

>gb|DQ098134.1| Uncultured Pseudonocardia sp. clone colony 174 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098133.1| Uncultured Pseudonocardia sp. clone colony 38 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098132.1| Uncultured Pseudonocardia sp. clone colony 43 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098129.1| Uncultured Pseudonocardia sp. clone colony 48 Tuf1 (tuf1) gene,
           partial cds
          Length = 540

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 308 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 367

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 368 atcgtcaaggt 378



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 82  ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 135



to top

>gb|DQ098126.1| Uncultured Pseudonocardia sp. clone colony 117 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098123.1| Uncultured Pseudonocardia sp. clone colony 20 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||||||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagctgct 287



to top

>gb|DQ098122.1| Uncultured Pseudonocardia sp. clone colony 44 Tuf1 (tuf1) gene,
           partial cds
          Length = 679

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 447 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 506

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 507 atcgtcaaggt 517



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 221 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 274



to top

>gb|DQ098121.1| Uncultured Pseudonocardia sp. clone colony 170 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098120.1| Uncultured Pseudonocardia sp. clone colony 24 Tuf1 (tuf1) gene,
           partial cds
          Length = 636

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 404 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 463

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 464 atcgtcaaggt 474



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 178 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 231



to top

>gb|DQ098119.1| Uncultured Pseudonocardia sp. clone colony 10 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 520 atcgtcaaggt 530



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 287



to top

>gb|DQ098118.1| Uncultured Pseudonocardia sp. clone colony 13 Tuf1 (tuf1) gene,
           partial cds
          Length = 675

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 443 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 502

                      
Query: 453 accgtcaaggt 463
           | |||||||||
Sbjct: 503 atcgtcaaggt 513



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           |||||||||||||||| |  | |||||||||||  | |||||||| ||||||||
Sbjct: 217 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgcgagctgct 270



to top

>ref|XM_387358.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07182.1)
           partial mRNA
          Length = 1338

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
           |||||||||||||||||  |||| |||||||| || | | |||||||| ||||||||||
Sbjct: 781 gaggatgtcttctccattgccggccgtggtactgtcgtctctggccgtgtcgagcgtgg 839



to top

>emb|X76863.1|BL20425 B.linens (DSM 20425) tuf gene
          Length = 1194

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
           |||||| ||||||||||| || |||||||||||  |||||||||| || ||||||
Sbjct: 426 ggtcgatgacgaggagctcctcgagctcgtcgaattcgaggtccgcgacctgctc 480



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 630 aagccgggttccatcacgccacacaccaagtttgaggc 667
           ||||||||||| ||||| || ||||||||||| |||||
Sbjct: 892 aagccgggttcgatcaccccgcacaccaagttcgaggc 929



to top

>emb|AL596173.1| Listeria innocua Clip11262 complete genome, segment 11/12
          Length = 305050

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 390    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
              ||||||||||| ||||| ||||| |||||||| |||||||| |||||
Sbjct: 207503 gttgaggatgtattctcaatcactggtcgtggaacagttgcaactgg 207457



to top

>emb|AL591984.1| Listeria monocytogenes strain EGD, complete genome, segment 12/12
          Length = 225528

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 390  gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
            ||||||||||| ||||| ||||| |||||||| |||||||| |||||
Sbjct: 7553 gttgaggatgtattctcaatcactggtcgtggaacagttgcaactgg 7507



to top

>gb|AF274746.1|AF274746 Listeria monocytogenes elongation factor Tu (tuf) gene, partial cds
          Length = 835

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
           ||||||||||| ||||| ||||| |||||||| |||||||| |||||
Sbjct: 344 gttgaggatgtattctcaatcactggtcgtggaacagttgcaactgg 390



to top

>gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete genome
          Length = 2905187

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                              
Query: 390     gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
               ||||||||||| ||||| ||||| |||||||| |||||||| |||||
Sbjct: 2678294 gttgaggatgtattctcaatcactggtcgtggaacagttgcaactgg 2678248



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 141    gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
              ||||||||||||||||| || ||||||||  | |||||||| ||||||||
Sbjct: 787224 gacgacgaggagctgctcgaactcgtcgagatggaggtccgcgagctgct 787273



to top

>ref|XM_362579.1| Magnaporthe grisea 70-15 hypothetical protein (MG08162.4) partial
           mRNA
          Length = 1332

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagt 427
           ||||||||||||||| |||||  |||||||||||||||
Sbjct: 772 gttgaggatgtcttcaccatcggcggtcgtggtacagt 809



to top

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                 
Query: 141     gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
               ||||| ||||||||||| |||||||||||  | |||||||| ||||||||
Sbjct: 2139301 gacgatgaggagctgctggagctcgtcgagatggaggtccgcgagctgct 2139252



to top

>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12
          Length = 329100

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 132   gaccaggtcgacgacgaggagctgcttgagctcgtcga 169
             |||||||||||||||| ||| ||||| |||||||||||
Sbjct: 25324 gaccaggtcgacgacgcggaactgctcgagctcgtcga 25361



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 132  gaccaggtcgacgacgaggagctgcttgagctcgtcga 169
            |||||||||||||||| ||| ||||| |||||||||||
Sbjct: 5001 gaccaggtcgacgacgcggaactgctcgagctcgtcga 5038



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                  
Query: 12    atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagac 64
             ||||||||||| ||||| || || || | ||| |||||||| |||||||||||
Sbjct: 25204 atggacggcgcgatcctggttgtttcggccgctgacggcccgatgccgcagac 25256



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                 
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagac 64
            ||||||||||| ||||| || || || | ||| |||||||| |||||||||||
Sbjct: 4881 atggacggcgcgatcctggttgtttcggccgctgacggcccgatgccgcagac 4933



to top

>gb|AY305396.1| Synthetic construct reconstructed ancestral elongation factor Tu
           ML-stem gene, complete cds
          Length = 1185

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 625 tggcaaagccgggttccatcacgccacacaccaagttt 662
           |||| |||||||||  ||||||||||||||||||||||
Sbjct: 878 tggctaagccgggtagcatcacgccacacaccaagttt 915



to top

>emb|X63539.1|MTTUF M.tuberculosis tuf gene for elongation factor TU
          Length = 1586

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 141 gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
           ||||||||||||||||| || ||||||||  | |||||||| ||||||||
Sbjct: 722 gacgacgaggagctgctcgaactcgtcgagatggaggtccgcgagctgct 771



to top

>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence
          Length = 3281944

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 414     ggtcgtggtacagttgccactggccgtatcgagcgtgg 451
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 1324599 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 1324636



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 414     ggtcgtggtacagttgccactggccgtatcgagcgtgg 451
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 1183146 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 1183183



to top

>emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome; segment 3/13
          Length = 349564

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 141    gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
              ||||||||||||||||| || ||||||||  | |||||||| ||||||||
Sbjct: 100977 gacgacgaggagctgctcgaactcgtcgagatggaggtccgcgagctgct 101026



to top

>emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 3/14
          Length = 320050

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 141    gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
              ||||||||||||||||| || ||||||||  | |||||||| ||||||||
Sbjct: 120019 gacgacgaggagctgctcgaactcgtcgagatggaggtccgcgagctgct 120068



to top

>emb|AJ786715.1| Lactobacillus farciminis partial tuf gene for elongation factor Tu,
           strain ATCC 29644
          Length = 525

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
           ||||| ||||||||| | ||||| ||||||||||| |||||  |||| |||||||| |||
Sbjct: 205 gttgaagatgtcttcactatcacaggtcgtggtactgttgcatctggtcgtatcgatcgt 264

             
Query: 450 gg 451
           ||
Sbjct: 265 gg 266



to top

>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence
          Length = 3354505

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 414     ggtcgtggtacagttgccactggccgtatcgagcgtgg 451
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 3250399 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 3250362



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 414     ggtcgtggtacagttgccactggccgtatcgagcgtgg 451
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 3108297 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 3108260



to top

>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 414     ggtcgtggtacagttgccactggccgtatcgagcgtgg 451
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 3121410 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 3121373



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 414     ggtcgtggtacagttgccactggccgtatcgagcgtgg 451
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 2939032 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 2938995



to top

>gb|AE004843.1| Pseudomonas aeruginosa PAO1, section 404 of 529 of the complete
            genome
          Length = 11171

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 42   gccgacggccccatgccgcagaccaaggagcacatcct 79
            ||||||||||||||||||||||||   |||||||||||
Sbjct: 4488 gccgacggccccatgccgcagacccgcgagcacatcct 4451



to top

>gb|AE004842.1| Pseudomonas aeruginosa PAO1, section 403 of 529 of the complete
            genome
          Length = 13486

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 42   gccgacggccccatgccgcagaccaaggagcacatcct 79
            ||||||||||||||||||||||||   |||||||||||
Sbjct: 1409 gccgacggccccatgccgcagacccgcgagcacatcct 1372



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                     
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagacc 65
               ||||||||||||||||| || ||| |||   |||||||||| ||||||||||||
Sbjct: 5374718 atggacggcgccatcctggtggtcgccgcgaccgacggcccgatgccgcagacc 5374665



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                     
Query: 137     ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
               |||||||||||||||| | || |||||||||||  | |||||||| ||||||||
Sbjct: 5374593 ggtcgacgacgaggagatcctcgagctcgtcgagatggaggtccgcgagctgct 5374540



to top

>gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequence
          Length = 2906179

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 414     ggtcgtggtacagttgccactggccgtatcgagcgtgg 451
               ||||||||||||||||  ||||| ||||||||||||||
Sbjct: 2715925 ggtcgtggtacagttgtaactggtcgtatcgagcgtgg 2715888



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 414    ggtcgtggtacagttgccactggccgtatcgagcgtgg 451
              ||||||||||||||||  ||||| ||||||||||||||
Sbjct: 252729 ggtcgtggtacagttgtaactggtcgtatcgagcgtgg 252766



to top

>gb|AD000005.1|MSGY42 Mycobacterium tuberculosis sequence from clone y42
          Length = 36526

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 141   gacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgct 190
             ||||||||||||||||| || ||||||||  | |||||||| ||||||||
Sbjct: 34957 gacgacgaggagctgctcgaactcgtcgagatggaggtccgcgagctgct 34908



to top

>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 68/81 (83%), Gaps = 1/81 (1%)
 Strand = Plus / Plus

                                                                          
Query: 2      gctgcccagnatggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgca 61
              ||||||||| ||||||||||| |||||||| ||  ||||  | |||||||| ||||| ||
Sbjct: 186670 gctgcccag-atggacggcgcgatcctcgtggttgccggtactgacggcccgatgcccca 186728

                                   
Query: 62     gaccaaggagcacatccttct 82
              ||||   ||||||||||||||
Sbjct: 186729 gacccgcgagcacatccttct 186749



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 48      ggccccatgccgcagaccaag 68
               |||||||||||||||||||||
Sbjct: 1607781 ggccccatgccgcagaccaag 1607761



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 125748 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 125796



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 120016 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 120064



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 120017 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 120065



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 120011 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 120059



to top

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 142/181 (78%)
 Strand = Plus / Minus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||| ||||| || ||| |||   | ||||| || ||||||||||||||||||
Sbjct: 3110025 atggacggcgcgatcctggtggtcgccgctactgacggtccgatgccgcagaccaaggag 3109966

                                                                           
Query: 72      cacatccttctcgctaagcaggtcggtgtccccagcattgttgttttcctcaacaagaag 131
               ||| | || || |||   |||||||| ||||||  |||||| ||    |||||||||   
Sbjct: 3109965 cacgtgctcctggctcgccaggtcggcgtcccctacattgtcgtggctctcaacaagtcc 3109906

                                                                           
Query: 132     gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagctgctc 191
               |||  ||| |||||||||||| |  | || ||||| || ||||||||||| |||||||||
Sbjct: 3109905 gacatggtggacgacgaggagatcttcgacctcgttgagctcgaggtccgcgagctgctc 3109846

                
Query: 192     a 192
               |
Sbjct: 3109845 a 3109845



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                       
Query: 393     gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 448
               ||||| || ||||| ||||||||||| ||||| || | ||| ||||||||||||||
Sbjct: 3109674 gaggacgtgttctcgatcaccggtcgcggtaccgtcgtcaccggccgtatcgagcg 3109619



to top

>emb|AJ544131.1|PCA544131 Pleurochrysis carterae chloroplast partial tufA gene for elongation
           factor Tu, isolate HAP1
          Length = 747

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 387 gctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgag 446
           ||||| |||||||| ||||| || || ||||||||||||||||| || || || || |||
Sbjct: 406 gctgtagaggatgtattctctattacaggtcgtggtacagttgcaacgggtcgaatagag 465

                
Query: 447 cgtgg 451
           |||||
Sbjct: 466 cgtgg 470



to top

>emb|AJ418919.2|LDE418919 Lactobacillus delbrueckii subsp. lactis partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 12315
          Length = 761

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
           ||||| || |||||| | ||||| ||||||||||| |||||  | ||||||||||| |||
Sbjct: 349 gttgaagacgtcttcactatcactggtcgtggtactgttgcttcaggccgtatcgaccgt 408

                            
Query: 450 ggcaccgtcaaggttgg 466
           || || || ||||||||
Sbjct: 409 ggtactgttaaggttgg 425



to top

>emb|AJ418911.2|LDE418911 Lactobacillus delbrueckii subsp. delbrueckii partial mRNA for
           putative elongation factor Tu (tuf gene), strain ATCC
           9649
          Length = 761

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
           ||||| || |||||| | ||||| ||||||||||| |||||  | ||||||||||| |||
Sbjct: 349 gttgaagacgtcttcactatcactggtcgtggtactgttgcttcaggccgtatcgaccgt 408

                            
Query: 450 ggcaccgtcaaggttgg 466
           || || || ||||||||
Sbjct: 409 ggtactgttaaggttgg 425



to top

>emb|AJ418910.2|LDE418910 Lactobacillus delbrueckii subsp. bulgaricus partial mRNA for
           putative elongation factor Tu (tuf gene), strain ATCC
           11842
          Length = 761

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 449
           ||||| || |||||| | ||||| ||||||||||| |||||  | ||||||||||| |||
Sbjct: 349 gttgaagacgtcttcactatcactggtcgtggtactgttgcttcaggccgtatcgaccgt 408

                            
Query: 450 ggcaccgtcaaggttgg 466
           || || || ||||||||
Sbjct: 409 ggtactgttaaggttgg 425



to top

>gb|AE005800.1| Caulobacter crescentus CB15 section 126 of 359 of the complete
           genome
          Length = 7934

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcga 169
           |||||||||||| |||||||| |||||||||||
Sbjct: 860 ggtcgacgacgaagagctgctggagctcgtcga 892



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
           ||||||||||| ||||| || || || | ||| |||||||| ||||||||||||   |||
Sbjct: 735 atggacggcgcgatcctggtggtttcggccgctgacggcccgatgccgcagacccgcgag 794

                   
Query: 72  cacatcct 79
           ||||||||
Sbjct: 795 cacatcct 802



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 630  aagccgggttccatcacgccacacaccaagtt 661
            ||||||||||| ||||| || |||||||||||
Sbjct: 1329 aagccgggttcgatcaccccgcacaccaagtt 1360



to top

>gb|AE005984.1| Caulobacter crescentus CB15 section 310 of 359 of the complete
           genome
          Length = 10212

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcga 169
           |||||||||||| |||||||| |||||||||||
Sbjct: 913 ggtcgacgacgaagagctgctggagctcgtcga 881



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            ||||||||||| ||||| || || || | ||| |||||||| ||||||||||||   |||
Sbjct: 1038 atggacggcgcgatcctggtggtttcggccgctgacggcccgatgccgcagacccgcgag 979

                    
Query: 72   cacatcct 79
            ||||||||
Sbjct: 978  cacatcct 971



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 630 aagccgggttccatcacgccacacaccaagtt 661
           ||||||||||| ||||| || |||||||||||
Sbjct: 444 aagccgggttcgatcaccccgcacaccaagtt 413



to top

>gb|AF176664.1|AF176664 EDTA-degrading bacterium BNC1 EDTA degradation gene cluster, partial
             sequence
          Length = 15603

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 12    atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagac 64
             ||||||||||| ||||| || || || | |||||||||||| |||||||||||
Sbjct: 12116 atggacggcgcgatccttgttgtttcggccgccgacggcccgatgccgcagac 12168



to top

>gb|AF274736.1|AF274736 Enterococcus saccharolyticus elongation factor Tu (tuf) gene,
           partial cds
          Length = 835

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgc 430
           ||||||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 344 gttgaggatgtattctcaatcactggtcgtggtactgttgc 384



to top

>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 125534 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 125582



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 388    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 436
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 120016 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 120064



to top

>emb|AM049970.1| Udotea orientalis plastid partial tufA gene for elongation factor
           Tu, specimen voucher HV817
          Length = 859

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 391 ttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtg 450
           |||| ||||||||||| || || ||||||||||| || || || ||||| || |||||||
Sbjct: 407 ttgaagatgtcttctcaattacaggtcgtggtactgtwgcgacaggccgwattgagcgtg 466

            
Query: 451 g 451
           |
Sbjct: 467 g 467



to top

>gb|M94204.1|TOBTEFTU Nicotiana tabacum translation elongation factor EF-Tu gene, complete
            cds
          Length = 2342

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                        
Query: 610  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 669
            ||||||| |||||||||||||| || ||  | || || || |||||||||||||| ||  
Sbjct: 1443 agagaggaatggtgttggcaaaacccggaacaattacccctcacaccaagtttgaagcta 1502

                                 
Query: 670  ttgtgtatgtgctcaagaagg 690
            ||||||||||| | |||||||
Sbjct: 1503 ttgtgtatgtgttgaagaagg 1523



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 51  cccatgccgcagaccaaggagcacatccttctcgctaagcaggtcggtgtccccagcatt 110
           |||||||| ||||| ||||| |||||  | || |||||||| || |||||||||| ||| 
Sbjct: 884 cccatgccacagactaaggaacacattttgcttgctaagcaagtaggtgtccccaacatg 943

                                                                
Query: 111 gttgttttcctcaacaagaaggaccaggtcgacgacgaggagctgcttgagct 163
           ||||| ||| | |||||  | || ||||| || || |||||||||||| ||||
Sbjct: 944 gttgtgttcttgaacaaacaagatcaggttgatgatgaggagctgcttcagct 996



to top

>dbj|D11469.1|TOBTUFA2 Nicotiana sylvestris tufA gene for chloroplast elongation factor TuA,
            complete cds
          Length = 2667

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                        
Query: 610  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 669
            ||||||| |||||||||||||| || ||  | || || || |||||||||||||| ||  
Sbjct: 1767 agagaggaatggtgttggcaaaacccggaacaattacccctcacaccaagtttgaagcga 1826

                                 
Query: 670  ttgtgtatgtgctcaagaagg 690
            ||||||||||| | |||||||
Sbjct: 1827 ttgtgtatgtgttgaagaagg 1847



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                        
Query: 51   cccatgccgcagaccaaggagcacatccttctcgctaagcaggtcggtgtccccagcatt 110
            |||||||| ||||| ||||| |||||  | || |||||||| || |||||||||| ||| 
Sbjct: 1208 cccatgccacagactaaggaacacattttgcttgctaagcaagtaggtgtccccaacatg 1267

                                                                 
Query: 111  gttgttttcctcaacaagaaggaccaggtcgacgacgaggagctgcttgagct 163
            ||||| ||| | |||||  | || ||||| || || |||||||||||| ||||
Sbjct: 1268 gttgtgttcttgaacaaacaagatcaggttgatgatgaggagctgcttcagct 1320



to top

>dbj|D11375.1|TOBTUFA N. sylvestris tufA gene for chloroplast elongation factor TuA
            (EF-TuA), partial sequence
          Length = 1390

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                        
Query: 610  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 669
            ||||||| |||||||||||||| || ||  | || || || |||||||||||||| ||  
Sbjct: 1119 agagaggaatggtgttggcaaaacccggaacaattacccctcacaccaagtttgaagcga 1178

                                 
Query: 670  ttgtgtatgtgctcaagaagg 690
            ||||||||||| | |||||||
Sbjct: 1179 ttgtgtatgtgttgaagaagg 1199



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 51  cccatgccgcagaccaaggagcacatccttctcgctaagcaggtcggtgtccccagcatt 110
           |||||||| ||||| ||||| |||||  | || |||||||| || |||||||||| ||| 
Sbjct: 560 cccatgccacagactaaggaacacattttgcttgctaagcaagtaggtgtccccaacatg 619

                                                                
Query: 111 gttgttttcctcaacaagaaggaccaggtcgacgacgaggagctgcttgagct 163
           ||||| ||| | |||||  | || ||||| || || |||||||||||| ||||
Sbjct: 620 gttgtgttcttgaacaaacaagatcaggttgatgatgaggagctgcttcagct 672



to top

>ref|XM_631056.1| Dictyostelium discoideum hypothetical protein (DDB0219464), partial
           mRNA
          Length = 1290

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 402 ttctccatcaccggtcgtggtacagttgccactggccgtatcga 445
           ||||||||| | ||||||||||| || |||||||| ||||||||
Sbjct: 760 ttctccatctctggtcgtggtactgtcgccactggtcgtatcga 803



to top

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
              genome
          Length = 3397754

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 640    ccatcacgccacacaccaagtttgaggcagttgtgtatgt 679
              |||||| |||||||||||||||||| ||||  ||||||||
Sbjct: 382615 ccatcaagccacacaccaagtttgaagcagaagtgtatgt 382654



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 640    ccatcacgccacacaccaagtttgaggcagttgtgtatgt 679
              |||||| |||||||||||||||||| ||||  ||||||||
Sbjct: 366333 ccatcaagccacacaccaagtttgaagcagaagtgtatgt 366372



to top

>gb|AY582542.1| Streptococcus dysgalactiae strain CCRI-14550 elongation factor Tu
           (tuf) gene, partial cds
          Length = 761

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 396 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
           ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 319 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 374



to top

>gb|AY582541.1| Streptococcus dysgalactiae strain CCRI-14549 elongation factor Tu
           (tuf) gene, partial cds
          Length = 761

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 396 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
           ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 319 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 374



to top

>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome
          Length = 1899877

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                      
Query: 396    gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
              ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 520690 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 520745



to top

>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome
          Length = 1937111

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                      
Query: 396    gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
              ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 509232 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 509287



to top

>gb|BT014591.1| Lycopersicon esculentum clone 134061F, mRNA sequence
          Length = 1873

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 612  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 671
            ||||| ||||||||||| || |||||  | ||||| || |||||||||||||| ||  ||
Sbjct: 1257 agaggaatggtgttggcgaaaccgggaacaatcactcctcacaccaagtttgaagctctt 1316

                    
Query: 672  gtgtatgt 679
            ||||||||
Sbjct: 1317 gtgtatgt 1324



to top

>gb|AY372042.1| Bifidobacterium longum strain ATCC 15707 Tuf gene, partial cds
          Length = 990

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 393 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
           ||||| |||||| ||||| |||| |||||||| |||| ||| || ||| |||||||||||
Sbjct: 491 gaggacgtcttcaccatctccggccgtggtaccgttgtcaccggtcgtgtcgagcgtggc 550



to top

>gb|AE004124.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 32
            of 251 of the complete chromosome
          Length = 11069

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 414  ggtcgtggtacagttgccactggccgtatcgagcgtggca 453
            |||||||||||||| |  ||||||||||||||||| ||||
Sbjct: 6935 ggtcgtggtacagtagtaactggccgtatcgagcgcggca 6974



to top

>gb|AE004120.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 28
            of 251 of the complete chromosome
          Length = 9995

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 414  ggtcgtggtacagttgccactggccgtatcgagcgtggca 453
            |||||||||||||| |  ||||||||||||||||| ||||
Sbjct: 6880 ggtcgtggtacagtagtaactggccgtatcgagcgcggca 6919



to top

>gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome
          Length = 1897573

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                      
Query: 396    gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
              ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 492367 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 492422



to top

>emb|X52383.1|TCEF1A Thermococcus celer EF-1a gene for elongation factor-1-alpha
          Length = 1287

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 27  ctcgtcgtctccggcgccgacggccccatgccgcagaccaaggagcac 74
           ||||||||| ||| | |||||||   ||||||||||||||||||||||
Sbjct: 334 ctcgtcgtcgccgtcaccgacggtgtcatgccgcagaccaaggagcac 381



to top

>gb|AY845412.1| Neochlamydia hartmannellae translation elongation factor TU gene,
           partial cds
          Length = 810

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 515 cactggtgttgagatgttccagaagaccatggatga 550
           ||||||||||||||||||| | ||| ||||||||||
Sbjct: 513 cactggtgttgagatgttcaataagtccatggatga 548



to top

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 640    ccatcacgccacacaccaagtttgaggcagttgtgtatgt 679
              |||||| |||||||||||||||||| ||||  ||||||||
Sbjct: 431571 ccatcaagccacacaccaagtttgaagcagaagtgtatgt 431610



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 640    ccatcacgccacacaccaagtttgaggcagttgtgtatgt 679
              |||||| |||||||||||||||||| ||||  ||||||||
Sbjct: 415289 ccatcaagccacacaccaagtttgaagcagaagtgtatgt 415328



to top

>emb|BX572603.1| Rhodopseudomonas palustris CGA009 complete genome; segment 11/16
          Length = 349635

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                          
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
              ||||||||||| ||||| || || || |  ||||||||||| ||||||||||||   |||
Sbjct: 213010 atggacggcgcgatcctggtggtgtcggcggccgacggcccgatgccgcagacccgcgag 212951

                      
Query: 72     cacatcct 79
              ||||||||
Sbjct: 212950 cacatcct 212943



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                          
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
              ||||||||||| ||||| || || || |  ||||||||||| ||||||||||||   |||
Sbjct: 170875 atggacggcgcgatcctggtggtgtcggcggccgacggcccgatgccgcagacccgcgag 170816

                      
Query: 72     cacatcct 79
              ||||||||
Sbjct: 170815 cacatcct 170808



to top

>emb|BX572100.1| Prochlorococcus marinus MIT9313 complete genome; segment 6/7
          Length = 348071

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 63     accaaggagcacatccttctcgctaagcaggt 94
              |||||||||||||||||||| || ||||||||
Sbjct: 137185 accaaggagcacatccttcttgccaagcaggt 137216



to top

>emb|AJ555814.1|PGI555814 Porphyromonas gingivalis partial ef-tu gene, strain GDR11
          Length = 380

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcga 445
           ||||| ||||| ||||| ||||| ||||||||||| ||||| || || ||||||||
Sbjct: 3   gttgaagatgtgttctctatcacgggtcgtggtacggttgctacaggacgtatcga 58



to top

>emb|AJ544132.1|PDE544132 Pleurochrysis dentata chloroplast partial tufA gene for elongation
           factor Tu, isolate HAP6
          Length = 747

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 387 gctgttgaggatgtcttctccatcaccggtcgtggtacagttgc 430
           ||||| |||||||| ||||| || || |||||||||||||||||
Sbjct: 406 gctgtagaggatgtattctctattacaggtcgtggtacagttgc 449



to top

>gb|AE011727.1| Xanthomonas axonopodis pv. citri str. 306,  section 105 of 469 of the
            complete genome
          Length = 9150

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            ||||||||||| ||||| ||   ||| | |||||||||||| ||||||||||||   |||
Sbjct: 7991 atggacggcgcgatcctggtgtgctcggccgccgacggcccgatgccgcagacccgtgag 8050

                    
Query: 72   cacatcct 79
            ||||||||
Sbjct: 8051 cacatcct 8058



to top

>gb|AE011726.1| Xanthomonas axonopodis pv. citri str. 306,  section 104 of 469 of the
            complete genome
          Length = 13867

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 12   atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
            ||||||||||| ||||| ||   ||| | |||||||||||| ||||||||||||   |||
Sbjct: 4400 atggacggcgcgatcctggtgtgctcggccgccgacggcccgatgccgcagacccgtgag 4459

                    
Query: 72   cacatcct 79
            ||||||||
Sbjct: 4460 cacatcct 4467



to top

>gb|AE010001.1| Streptococcus pyogenes strain MGAS8232, section 49 of 173 of the
            complete genome
          Length = 10344

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 396  gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
            ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 5345 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 5400



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                           
Query: 132     gaccaggtcgacgacgaggagctgcttgagctcgtcgatctcga 175
               ||||||||||||||||||||  | || ||||||||||| |||||
Sbjct: 1297120 gaccaggtcgacgacgaggaaatcctcgagctcgtcgaactcga 1297163



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                           
Query: 12      atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
               ||||||||||| ||||| |||||   ||  || |||||||| ||||||||||||   |||
Sbjct: 1297000 atggacggcgcgatcctggtcgtgaacgctgctgacggcccgatgccgcagacccgcgag 1297059

                       
Query: 72      cacatcct 79
               ||||||||
Sbjct: 1297060 cacatcct 1297067



to top

>gb|AF274733.1|AF274733 Enterococcus pseudoavium strain ATCC49372 elongation factor Tu
           (tufB) gene, partial cds
          Length = 669

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 396 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 451
           ||||||||||| ||||| || |||||||| |||||  |||| |||||||| |||||
Sbjct: 349 gatgtcttctcaatcacaggacgtggtacggttgcatctggtcgtatcgatcgtgg 404



to top

>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome
          Length = 3573470

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 402     ttctccatcaccggtcgtggtacagttgccac 433
               ||||||||||| ||||||||||| ||||||||
Sbjct: 1915819 ttctccatcactggtcgtggtaccgttgccac 1915788



to top

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                          
Query: 12     atggacggcgccatcctcgtcgtctccggcgccgacggccccatgccgcagaccaaggag 71
              ||||||||||| ||||||||||| ||||  || || || || ||||||||||||   |||
Sbjct: 395846 atggacggcgcgatcctcgtcgtgtccgctgctgatggtccgatgccgcagacccgcgag 395787

                      
Query: 72     cacatcct 79
              ||||||||
Sbjct: 395786 cacatcct 395779



to top

>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome
          Length = 2256640

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                          
Query: 393    gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 452
              ||||| |||||| ||||| |||| |||||||| |||| ||| || ||| |||||||||||
Sbjct: 931057 gaggacgtcttcaccatctccggccgtggtaccgttgtcaccggtcgtgtcgagcgtggc 930998



to top

>gb|DQ098150.1| Uncultured Pseudonocardia sp. clone colony 219 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 284



to top

>gb|DQ098145.1| Uncultured Pseudonocardia sp. clone colony UGM020518-15 Tuf1 (tuf1)
           gene, partial cds
          Length = 672

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 214 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 264



to top

>gb|DQ098144.1| Uncultured Pseudonocardia sp. clone colony CC011213-25 Tuf1 (tuf1)
           gene, partial cds
          Length = 692

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 284



to top

>gb|DQ098142.1| Uncultured Pseudonocardia sp. clone colony CC030106-13 Tuf1 (tuf1)
           gene, partial cds
          Length = 676

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 218 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 268



to top

>gb|DQ098137.1| Uncultured Pseudonocardia sp. clone colony 34 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 284



to top

>gb|DQ098131.1| Uncultured Pseudonocardia sp. clone colony 112 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 284



to top

>gb|DQ098130.1| Uncultured Pseudonocardia sp. clone colony 35 Tuf1 (tuf1) gene,
           partial cds
          Length = 691

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 284



to top

>gb|DQ098128.1| Uncultured Pseudonocardia sp. clone colony 134 Tuf1 (tuf1) gene,
           partial cds
          Length = 686

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 229 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 279



to top

>gb|DQ098127.1| Uncultured Pseudonocardia sp. clone colony 26 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 284



to top

>gb|DQ098125.1| Uncultured Pseudonocardia sp. clone colony 168 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 284



to top

>gb|DQ098124.1| Uncultured Pseudonocardia sp. clone colony 47 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 137 ggtcgacgacgaggagctgcttgagctcgtcgatctcgaggtccgtgagct 187
           |||||||||||||||| |  | |||||||||||  | ||||||||||||||
Sbjct: 234 ggtcgacgacgaggagatcatggagctcgtcgagatggaggtccgtgagct 284



to top

>gb|DQ414204.1| Staphylococcus aureus strain H116 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414203.1| Staphylococcus aureus strain D547 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414202.1| Staphylococcus aureus strain H591 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414201.1| Staphylococcus aureus strain C2 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414200.1| Staphylococcus aureus strain H466 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414199.1| Staphylococcus aureus strain EMRSA3 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414198.1| Staphylococcus aureus strain D535 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414197.1| Staphylococcus aureus strain D97 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414196.1| Staphylococcus aureus strain H560 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414195.1| Staphylococcus aureus strain H417 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414194.1| Staphylococcus aureus strain H707 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414193.1| Staphylococcus aureus strain H295 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414192.1| Staphylococcus aureus strain H831 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330



to top

>gb|DQ414191.1| Staphylococcus aureus strain C101 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 390 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 440
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,417,373
Number of Sequences: 3902068
Number of extensions: 5417373
Number of successful extensions: 121458
Number of sequences better than 10.0: 528
Number of HSP's better than 10.0 without gapping: 514
Number of HSP's successfully gapped in prelim test: 18
Number of HSP's that attempted gapping in prelim test: 116029
Number of HSP's gapped (non-prelim): 5434
length of query: 690
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 667
effective length of database: 17,143,297,704
effective search space: 11434579568568
effective search space used: 11434579568568
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top