ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal12m04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_475153.1| Oryza sativa (japonica cultivar-group), predic... 82 9e-13
2gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome... 82 9e-13
3gb|AC108874.2| Oryza sativa (japonica cultivar-group) chromosome... 82 9e-13
4dbj|AB110178.1| Oryza sativa (japonica cultivar-group) mRNA for ... 82 9e-13
5dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 82 9e-13
6dbj|AK058906.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 9e-13
7ref|NM_190087.1| Oryza sativa (japonica cultivar-group), predic... 58 1e-05
8dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 58 1e-05
9dbj|AP003412.4| Oryza sativa (japonica cultivar-group) genomic D... 58 1e-05
10dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic D... 58 1e-05
11dbj|AK109341.2| Oryza sativa (japonica cultivar-group) cDNA clon... 58 1e-05
12dbj|AK070627.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 1e-05
13dbj|AK101971.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 5e-05
14dbj|AK059437.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 8e-04
15gb|AY231744.1| Drosophila yakuba clone yak-em_Nacalpha mRNA sequ... 46 0.050
16gb|AY522625.1| Oreochromis mossambicus nascent polypeptide-assoc... 44 0.20
17emb|CR712159.2|CNS0GCGB Tetraodon nigroviridis full-length cDNA 44 0.20
18emb|CR722249.2|CNS0GK8F Tetraodon nigroviridis full-length cDNA 44 0.20
19emb|CR722169.2|CNS0GK67 Tetraodon nigroviridis full-length cDNA 44 0.20
20emb|CR717966.2|CNS0GGXG Tetraodon nigroviridis full-length cDNA 44 0.20
21emb|CR717497.2|CNS0GGKF Tetraodon nigroviridis full-length cDNA 44 0.20
22emb|CR716901.2|CNS0GG3Y Tetraodon nigroviridis full-length cDNA 44 0.20
23emb|CR716022.2|CNS0GFFM Tetraodon nigroviridis full-length cDNA 44 0.20
24emb|CR715618.2|CNS0GF4E Tetraodon nigroviridis full-length cDNA 44 0.20
25emb|CR715460.2|CNS0GF00 Tetraodon nigroviridis full-length cDNA 44 0.20
26emb|CR714862.2|CNS0GEJE Tetraodon nigroviridis full-length cDNA 44 0.20
27emb|CR714224.2|CNS0GE1O Tetraodon nigroviridis full-length cDNA 44 0.20
28emb|CR712921.2|CNS0GD1H Tetraodon nigroviridis full-length cDNA 44 0.20
29emb|CR712868.2|CNS0GD00 Tetraodon nigroviridis full-length cDNA 44 0.20
30emb|CR710910.2|CNS0GBHM Tetraodon nigroviridis full-length cDNA 44 0.20
31emb|CR710585.2|CNS0GB8L Tetraodon nigroviridis full-length cDNA 44 0.20
32emb|CR709573.2|CNS0GAGH Tetraodon nigroviridis full-length cDNA 44 0.20
33emb|CR706444.2|CNS0G81K Tetraodon nigroviridis full-length cDNA 44 0.20
34emb|CR704473.2|CNS0G6IT Tetraodon nigroviridis full-length cDNA 44 0.20
35emb|CR702894.2|CNS0G5AY Tetraodon nigroviridis full-length cDNA 44 0.20
36emb|CR702653.2|CNS0G549 Tetraodon nigroviridis full-length cDNA 44 0.20
37emb|CR702124.2|CNS0G4PK Tetraodon nigroviridis full-length cDNA 44 0.20
38emb|CR701979.2|CNS0G4LJ Tetraodon nigroviridis full-length cDNA 44 0.20
39emb|CR701629.2|CNS0G4BT Tetraodon nigroviridis full-length cDNA 44 0.20
40emb|CR699096.2|CNS0G2DG Tetraodon nigroviridis full-length cDNA 44 0.20
41emb|CR698619.2|CNS0G207 Tetraodon nigroviridis full-length cDNA 44 0.20
42emb|CR698352.2|CNS0G1SS Tetraodon nigroviridis full-length cDNA 44 0.20
43emb|CR697288.2|CNS0G0Z8 Tetraodon nigroviridis full-length cDNA 44 0.20
44emb|CR696825.2|CNS0G0MD Tetraodon nigroviridis full-length cDNA 44 0.20
45emb|CR696554.2|CNS0G0EU Tetraodon nigroviridis full-length cDNA 44 0.20
46emb|CR696276.2|CNS0G074 Tetraodon nigroviridis full-length cDNA 44 0.20
47emb|CR695626.2|CNS0FZP2 Tetraodon nigroviridis full-length cDNA 44 0.20
48emb|CR695732.2|CNS0FZS0 Tetraodon nigroviridis full-length cDNA 44 0.20
49emb|CR694436.2|CNS0FYS0 Tetraodon nigroviridis full-length cDNA 44 0.20
50emb|CR688523.2|CNS0FU7R Tetraodon nigroviridis full-length cDNA 44 0.20
51emb|CR688181.2|CNS0FTY9 Tetraodon nigroviridis full-length cDNA 44 0.20
52emb|CR688138.2|CNS0FTX2 Tetraodon nigroviridis full-length cDNA 44 0.20
53emb|CR687296.2|CNS0FT9O Tetraodon nigroviridis full-length cDNA 44 0.20
54emb|CR682385.2|CNS0FPH9 Tetraodon nigroviridis full-length cDNA 44 0.20
55emb|CR675609.2|CNS0FK9R Tetraodon nigroviridis full-length cDNA 44 0.20
56emb|CR664046.2|CNS0FBCK Tetraodon nigroviridis full-length cDNA 44 0.20
57emb|CR663607.2|CNS0FB0D Tetraodon nigroviridis full-length cDNA 44 0.20
58emb|CR661227.2|CNS0F969 Tetraodon nigroviridis full-length cDNA 44 0.20
59emb|CR660613.2|CNS0F8P7 Tetraodon nigroviridis full-length cDNA 44 0.20
60emb|CR660539.2|CNS0F8N5 Tetraodon nigroviridis full-length cDNA 44 0.20
61emb|CR655127.2|CNS0F4GT Tetraodon nigroviridis full-length cDNA 44 0.20
62emb|CR653087.2|CNS0F2W5 Tetraodon nigroviridis full-length cDNA 44 0.20
63emb|CR652468.2|CNS0F2EY Tetraodon nigroviridis full-length cDNA 44 0.20
64emb|CR651752.2|CNS0F1V2 Tetraodon nigroviridis full-length cDNA 44 0.20
65emb|CR651630.2|CNS0F1RO Tetraodon nigroviridis full-length cDNA 44 0.20
66emb|CR650255.2|CNS0F0PH Tetraodon nigroviridis full-length cDNA 44 0.20
67emb|CR647893.2|CNS0EYVV Tetraodon nigroviridis full-length cDNA 44 0.20
68emb|CR647713.2|CNS0EYQV Tetraodon nigroviridis full-length cDNA 44 0.20
69emb|CR639196.2|CNS0ES6A Tetraodon nigroviridis full-length cDNA 44 0.20
70emb|CR637873.2|CNS0ER5J Tetraodon nigroviridis full-length cDNA 44 0.20
71emb|CR636835.2|CNS0EQCP Tetraodon nigroviridis full-length cDNA 44 0.20
72emb|CR634963.2|CNS0EOWP Tetraodon nigroviridis full-length cDNA 44 0.20
73emb|CR632932.2|CNS0ENCA Tetraodon nigroviridis full-length cDNA 44 0.20
74emb|CR632678.2|CNS0EN58 Tetraodon nigroviridis full-length cDNA 44 0.20
75emb|CR632573.2|CNS0EN2B Tetraodon nigroviridis full-length cDNA 44 0.20
76emb|CR632323.2|CNS0EMVD Tetraodon nigroviridis full-length cDNA 44 0.20
77emb|CR632317.2|CNS0EMV7 Tetraodon nigroviridis full-length cDNA 44 0.20
78emb|CR631332.2|CNS0EM3T Tetraodon nigroviridis full-length cDNA 44 0.20
79emb|CR631747.2|CNS0EMFD Tetraodon nigroviridis full-length cDNA 44 0.20
80gb|AY168640.1| Oreochromis niloticus nascent polypeptide-associa... 44 0.20
81ref|XM_609695.2| PREDICTED: Bos taurus similar to Nascent polype... 42 0.79
82gb|AC083797.16| Homo sapiens 3 BAC RP11-114A6 (Roswell Park Canc... 42 0.79
83gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 42 0.79
84emb|CT033503.1| Platynereis dumerilii EST IB0AAA19AH12EM1 42 0.79
85emb|CT033502.1| Platynereis dumerilii EST IB0AAA19AH12FM1 42 0.79
86emb|CT033318.1| Platynereis dumerilii EST IB0AAA22CF02EM1 42 0.79
87emb|CT033317.1| Platynereis dumerilii EST IB0AAA22CF02FM1 42 0.79
88emb|CT032495.1| Platynereis dumerilii EST IB0AAA37BF03EM1 42 0.79
89emb|CT032494.1| Platynereis dumerilii EST IB0AAA37BF03FM1 42 0.79
90gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete... 40 3.1
91ref|XM_883486.1| Leishmania major strain Friedlin nascent polype... 40 3.1
92emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4,... 40 3.1
93ref|XM_847221.1| PREDICTED: Canis familiaris similar to nascent ... 40 3.1
94emb|CR688321.2|CNS0FU25 Tetraodon nigroviridis full-length cDNA 40 3.1
95emb|CR686631.2|CNS0FSR7 Tetraodon nigroviridis full-length cDNA 40 3.1
96ref|NM_165950.1| Drosophila melanogaster Nascent polypeptide ass... 40 3.1
97ref|NM_134312.2| Drosophila melanogaster Nascent polypeptide ass... 40 3.1
98ref|NM_057868.3| Drosophila melanogaster Nascent polypeptide ass... 40 3.1
99gb|AY075332.1| Drosophila melanogaster GH11940 full length cDNA 40 3.1
100gb|AE003821.4| Drosophila melanogaster chromosome 2R, section 29... 40 3.1
101gb|AF017783.2|AF017783 Drosophila melanogaster alpha NAC, diacyl... 40 3.1
102gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, r... 40 3.1
103emb|BX255901.3| Mouse DNA sequence from clone RP23-200D14 on chr... 40 3.1
104emb|Y08969.1|DMNACPRAL D.melanogaster mRNA for NAC protein alpha... 40 3.1 
>ref|XM_475153.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 108 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 167
           |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 605 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 546

                                                                       
Query: 168 ntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 227
            ||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 545 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 486

               
Query: 228 tcga 231
           ||||
Sbjct: 485 tcga 482
to top
>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0025P09,
              complete sequence
          Length = 167318

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                          
Query: 108    tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 167
              |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 129674 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 129615

                                                                          
Query: 168    ntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 227
               ||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 129614 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 129555

                  
Query: 228    tcga 231
              ||||
Sbjct: 129554 tcga 129551
to top
>gb|AC108874.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
           OJ1005_E12, complete sequence
          Length = 121293

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 108 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 167
           |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 469 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 410

                                                                       
Query: 168 ntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 227
            ||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 409 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 350

               
Query: 228 tcga 231
           ||||
Sbjct: 349 tcga 346
to top
>dbj|AB110178.1| Oryza sativa (japonica cultivar-group) mRNA for nascent polypeptide
           associated complex alpha chain, complete cds, clone:
           13YPG044
          Length = 878

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 108 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 167
           |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 622 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 563

                                                                       
Query: 168 ntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 227
            ||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 562 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 503

               
Query: 228 tcga 231
           ||||
Sbjct: 502 tcga 499
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                            
Query: 108      tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 167
                |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 17869720 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 17869661

                                                                            
Query: 168      ntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 227
                 ||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 17869660 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 17869601

                    
Query: 228      tcga 231
                ||||
Sbjct: 17869600 tcga 17869597
to top
>dbj|AK058906.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-D09, full
           insert sequence
          Length = 930

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 108 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 167
           |||||||||||  |||||||||||||||  ||||||||||| | || ||| ||| |||| 
Sbjct: 684 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 625

                                                                       
Query: 168 ntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 227
            ||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||||||| 
Sbjct: 624 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 565

               
Query: 228 tcga 231
           ||||
Sbjct: 564 tcga 561
to top
>ref|NM_190087.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 609

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 115/144 (79%)
 Strand = Plus / Minus

                                                                       
Query: 95  ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 154
           |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 609 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 550

                                                                       
Query: 155 cacagccctggatntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 214
           ||| ||||| ||| ||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 549 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 490

                                   
Query: 215 aacaccagtctcatcgatctcctc 238
            || |||| |||||||| ||||||
Sbjct: 489 gacgccagactcatcgacctcctc 466
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 115/144 (79%)
 Strand = Plus / Minus

                                                                            
Query: 95       ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 154
                |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 41209147 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 41209088

                                                                            
Query: 155      cacagccctggatntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 214
                ||| ||||| ||| ||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 41209087 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 41209028

                                        
Query: 215      aacaccagtctcatcgatctcctc 238
                 || |||| |||||||| ||||||
Sbjct: 41209027 gacgccagactcatcgacctcctc 41209004
to top
>dbj|AP003412.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1150F11
          Length = 130355

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 115/144 (79%)
 Strand = Plus / Minus

                                                                         
Query: 95    ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 154
             |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 26062 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 26003

                                                                         
Query: 155   cacagccctggatntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 214
             ||| ||||| ||| ||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 26002 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 25943

                                     
Query: 215   aacaccagtctcatcgatctcctc 238
              || |||| |||||||| ||||||
Sbjct: 25942 gacgccagactcatcgacctcctc 25919
to top
>dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0504E02
          Length = 137468

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 115/144 (79%)
 Strand = Plus / Minus

                                                                          
Query: 95     ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 154
              |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 106202 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 106143

                                                                          
Query: 155    cacagccctggatntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 214
              ||| ||||| ||| ||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 106142 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 106083

                                      
Query: 215    aacaccagtctcatcgatctcctc 238
               || |||| |||||||| ||||||
Sbjct: 106082 gacgccagactcatcgacctcctc 106059
to top
>dbj|AK109341.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-F04, full
           insert sequence
          Length = 909

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 115/144 (79%)
 Strand = Plus / Minus

                                                                       
Query: 95  ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 154
           |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 721 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 662

                                                                       
Query: 155 cacagccctggatntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 214
           ||| ||||| ||| ||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 661 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 602

                                   
Query: 215 aacaccagtctcatcgatctcctc 238
            || |||| |||||||| ||||||
Sbjct: 601 gacgccagactcatcgacctcctc 578
to top
>dbj|AK070627.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055N09, full
            insert sequence
          Length = 3171

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 115/144 (79%)
 Strand = Plus / Minus

                                                                        
Query: 95   ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 154
            |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 2979 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 2920

                                                                        
Query: 155  cacagccctggatntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 214
            ||| ||||| ||| ||||||||| ||||||  ||||||| || || | |||||||   ||
Sbjct: 2919 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 2860

                                    
Query: 215  aacaccagtctcatcgatctcctc 238
             || |||| |||||||| ||||||
Sbjct: 2859 gacgccagactcatcgacctcctc 2836
to top
>dbj|AK101971.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076L24, full
           insert sequence
          Length = 976

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 81/99 (81%)
 Strand = Plus / Minus

                                                                       
Query: 95  ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 154
           |||||| |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || 
Sbjct: 700 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 641

                                                  
Query: 155 cacagccctggatntcgacacggaggcctgcatcatcac 193
           ||| ||||| ||| ||||||||| ||||||  |||||||
Sbjct: 640 caccgccctcgatctcgacacggtggcctgtgtcatcac 602
to top
>dbj|AK059437.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G10, full
           insert sequence
          Length = 873

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 109/137 (79%)
 Strand = Plus / Minus

                                                                       
Query: 102 gtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagcc 161
           |||| ||||||||||||  |||| ||||| || |  |||||||| |||| || ||| |||
Sbjct: 692 gtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgccttcaccgcc 633

                                                                       
Query: 162 ctggatntcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacacca 221
           || ||| ||||||||| ||||||  ||||||| || || | |||||||   || || |||
Sbjct: 632 ctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctcgacgcca 573

                            
Query: 222 gtctcatcgatctcctc 238
           | |||||||| ||||||
Sbjct: 572 gactcatcgacctcctc 556
to top
>gb|AY231744.1| Drosophila yakuba clone yak-em_Nacalpha mRNA sequence
          Length = 198

 Score = 46.1 bits (23), Expect = 0.050
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 100 tagtcaactccatgatggcgctgacgatgtc 130
           |||||| ||||||||||||| ||||||||||
Sbjct: 193 tagtcagctccatgatggcgttgacgatgtc 163
to top
>gb|AY522625.1| Oreochromis mossambicus nascent polypeptide-associated complex
           alpha polypeptide-like mRNA, partial sequence
          Length = 461

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           |||||||||||||||||  |||||||||||
Sbjct: 348 gtcaactccatgatggcattgacgatgtcg 319
to top
>emb|CR712159.2|CNS0GCGB Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR722249.2|CNS0GK8F Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 645 gtcaattccatgatggcgttgacgatgtcg 616
to top
>emb|CR722169.2|CNS0GK67 Tetraodon nigroviridis full-length cDNA
          Length = 1366

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gtcaactccatgatggcgctgacgatgtcg 131
            ||||| |||||||||||| |||||||||||
Sbjct: 1263 gtcaattccatgatggcgttgacgatgtcg 1234
to top
>emb|CR717966.2|CNS0GGXG Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR717497.2|CNS0GGKF Tetraodon nigroviridis full-length cDNA
          Length = 456

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 347 gtcaattccatgatggcgttgacgatgtcg 318
to top
>emb|CR716901.2|CNS0GG3Y Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR716022.2|CNS0GFFM Tetraodon nigroviridis full-length cDNA
          Length = 520

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 411 gtcaattccatgatggcgttgacgatgtcg 382
to top
>emb|CR715618.2|CNS0GF4E Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 349 gtcaattccatgatggcgttgacgatgtcg 320
to top
>emb|CR715460.2|CNS0GF00 Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR714862.2|CNS0GEJE Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617
to top
>emb|CR714224.2|CNS0GE1O Tetraodon nigroviridis full-length cDNA
          Length = 757

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR712921.2|CNS0GD1H Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR712868.2|CNS0GD00 Tetraodon nigroviridis full-length cDNA
          Length = 751

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR710910.2|CNS0GBHM Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR710585.2|CNS0GB8L Tetraodon nigroviridis full-length cDNA
          Length = 754

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR709573.2|CNS0GAGH Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 411 gtcaattccatgatggcgttgacgatgtcg 382
to top
>emb|CR706444.2|CNS0G81K Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR704473.2|CNS0G6IT Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 354 gtcaattccatgatggcgttgacgatgtcg 325
to top
>emb|CR702894.2|CNS0G5AY Tetraodon nigroviridis full-length cDNA
          Length = 1294

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gtcaactccatgatggcgctgacgatgtcg 131
            ||||| |||||||||||| |||||||||||
Sbjct: 1184 gtcaattccatgatggcgttgacgatgtcg 1155
to top
>emb|CR702653.2|CNS0G549 Tetraodon nigroviridis full-length cDNA
          Length = 1355

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gtcaactccatgatggcgctgacgatgtcg 131
            ||||| |||||||||||| |||||||||||
Sbjct: 1261 gtcaattccatgatggcgttgacgatgtcg 1232
to top
>emb|CR702124.2|CNS0G4PK Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 354 gtcaattccatgatggcgttgacgatgtcg 325
to top
>emb|CR701979.2|CNS0G4LJ Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR701629.2|CNS0G4BT Tetraodon nigroviridis full-length cDNA
          Length = 1355

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gtcaactccatgatggcgctgacgatgtcg 131
            ||||| |||||||||||| |||||||||||
Sbjct: 1258 gtcaattccatgatggcgttgacgatgtcg 1229
to top
>emb|CR699096.2|CNS0G2DG Tetraodon nigroviridis full-length cDNA
          Length = 1361

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gtcaactccatgatggcgctgacgatgtcg 131
            ||||| |||||||||||| |||||||||||
Sbjct: 1264 gtcaattccatgatggcgttgacgatgtcg 1235
to top
>emb|CR698619.2|CNS0G207 Tetraodon nigroviridis full-length cDNA
          Length = 655

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 551 gtcaattccatgatggcgttgacgatgtcg 522
to top
>emb|CR698352.2|CNS0G1SS Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617
to top
>emb|CR697288.2|CNS0G0Z8 Tetraodon nigroviridis full-length cDNA
          Length = 1362

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gtcaactccatgatggcgctgacgatgtcg 131
            ||||| |||||||||||| |||||||||||
Sbjct: 1260 gtcaattccatgatggcgttgacgatgtcg 1231
to top
>emb|CR696825.2|CNS0G0MD Tetraodon nigroviridis full-length cDNA
          Length = 1370

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gtcaactccatgatggcgctgacgatgtcg 131
            ||||| |||||||||||| |||||||||||
Sbjct: 1261 gtcaattccatgatggcgttgacgatgtcg 1232
to top
>emb|CR696554.2|CNS0G0EU Tetraodon nigroviridis full-length cDNA
          Length = 545

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 436 gtcaattccatgatggcgttgacgatgtcg 407
to top
>emb|CR696276.2|CNS0G074 Tetraodon nigroviridis full-length cDNA
          Length = 435

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 326 gtcaattccatgatggcgttgacgatgtcg 297
to top
>emb|CR695626.2|CNS0FZP2 Tetraodon nigroviridis full-length cDNA
          Length = 1055

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617
to top
>emb|CR695732.2|CNS0FZS0 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR694436.2|CNS0FYS0 Tetraodon nigroviridis full-length cDNA
          Length = 1018

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 644 gtcaattccatgatggcgttgacgatgtcg 615
to top
>emb|CR688523.2|CNS0FU7R Tetraodon nigroviridis full-length cDNA
          Length = 420

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 311 gtcaattccatgatggcgttgacgatgtcg 282
to top
>emb|CR688181.2|CNS0FTY9 Tetraodon nigroviridis full-length cDNA
          Length = 981

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 648 gtcaattccatgatggcgttgacgatgtcg 619
to top
>emb|CR688138.2|CNS0FTX2 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR687296.2|CNS0FT9O Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR682385.2|CNS0FPH9 Tetraodon nigroviridis full-length cDNA
          Length = 1363

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gtcaactccatgatggcgctgacgatgtcg 131
            ||||| |||||||||||| |||||||||||
Sbjct: 1260 gtcaattccatgatggcgttgacgatgtcg 1231
to top
>emb|CR675609.2|CNS0FK9R Tetraodon nigroviridis full-length cDNA
          Length = 707

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 606 gtcaattccatgatggcgttgacgatgtcg 577
to top
>emb|CR664046.2|CNS0FBCK Tetraodon nigroviridis full-length cDNA
          Length = 1047

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 938 gtcaattccatgatggcgttgacgatgtcg 909
to top
>emb|CR663607.2|CNS0FB0D Tetraodon nigroviridis full-length cDNA
          Length = 1200

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gtcaactccatgatggcgctgacgatgtcg 131
            ||||| |||||||||||| |||||||||||
Sbjct: 1089 gtcaattccatgatggcgttgacgatgtcg 1060
to top
>emb|CR661227.2|CNS0F969 Tetraodon nigroviridis full-length cDNA
          Length = 1044

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 935 gtcaattccatgatggcgttgacgatgtcg 906
to top
>emb|CR660613.2|CNS0F8P7 Tetraodon nigroviridis full-length cDNA
          Length = 1051

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 645 gtcaattccatgatggcgttgacgatgtcg 616
to top
>emb|CR660539.2|CNS0F8N5 Tetraodon nigroviridis full-length cDNA
          Length = 948

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 839 gtcaattccatgatggcgttgacgatgtcg 810
to top
>emb|CR655127.2|CNS0F4GT Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR653087.2|CNS0F2W5 Tetraodon nigroviridis full-length cDNA
          Length = 750

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR652468.2|CNS0F2EY Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR651752.2|CNS0F1V2 Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR651630.2|CNS0F1RO Tetraodon nigroviridis full-length cDNA
          Length = 1056

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 648 gtcaattccatgatggcgttgacgatgtcg 619
to top
>emb|CR650255.2|CNS0F0PH Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR647893.2|CNS0EYVV Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR647713.2|CNS0EYQV Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR639196.2|CNS0ES6A Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR637873.2|CNS0ER5J Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR636835.2|CNS0EQCP Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR634963.2|CNS0EOWP Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR632932.2|CNS0ENCA Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR632678.2|CNS0EN58 Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR632573.2|CNS0EN2B Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR632323.2|CNS0EMVD Tetraodon nigroviridis full-length cDNA
          Length = 749

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR632317.2|CNS0EMV7 Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR631332.2|CNS0EM3T Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>emb|CR631747.2|CNS0EMFD Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           ||||| |||||||||||| |||||||||||
Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
to top
>gb|AY168640.1| Oreochromis niloticus nascent polypeptide-associated complex alpha
           polypeptide (naca) mRNA, complete cds
          Length = 808

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 102 gtcaactccatgatggcgctgacgatgtcg 131
           |||||||||||||||||  |||||||||||
Sbjct: 677 gtcaactccatgatggcattgacgatgtcg 648
to top
>ref|XM_609695.2| PREDICTED: Bos taurus similar to Nascent polypeptide-associated
            complex alpha subunit, muscle-specific form (Alpha-NAC,
            muscle-specific form) (LOC531208), mRNA
          Length = 8513

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 102  gtcaactccatgatggcgctgacgatgtc 130
            |||| ||||||||||||| ||||||||||
Sbjct: 8264 gtcagctccatgatggcgttgacgatgtc 8236
to top
>gb|AC083797.16| Homo sapiens 3 BAC RP11-114A6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 157113

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 74     cacaactccaccttccagaac 94
              |||||||||||||||||||||
Sbjct: 104829 cacaactccaccttccagaac 104849
to top
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 112    tgatggcgctgacgatgtcgccatc 136
              ||||||||||| |||||||||||||
Sbjct: 675148 tgatggcgctggcgatgtcgccatc 675172
to top
>emb|CT033503.1| Platynereis dumerilii EST IB0AAA19AH12EM1
          Length = 813

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 213 tcaacaccagtctcatcgatctcctcatc 241
           ||||| ||||| |||||||||||||||||
Sbjct: 593 tcaactccagtgtcatcgatctcctcatc 565
to top
>emb|CT033502.1| Platynereis dumerilii EST IB0AAA19AH12FM1
          Length = 655

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 213 tcaacaccagtctcatcgatctcctcatc 241
           ||||| ||||| |||||||||||||||||
Sbjct: 221 tcaactccagtgtcatcgatctcctcatc 249
to top
>emb|CT033318.1| Platynereis dumerilii EST IB0AAA22CF02EM1
          Length = 798

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 213 tcaacaccagtctcatcgatctcctcatc 241
           ||||| ||||| |||||||||||||||||
Sbjct: 586 tcaactccagtgtcatcgatctcctcatc 558
to top
>emb|CT033317.1| Platynereis dumerilii EST IB0AAA22CF02FM1
          Length = 782

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 213 tcaacaccagtctcatcgatctcctcatc 241
           ||||| ||||| |||||||||||||||||
Sbjct: 213 tcaactccagtgtcatcgatctcctcatc 241
to top
>emb|CT032495.1| Platynereis dumerilii EST IB0AAA37BF03EM1
          Length = 814

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 213 tcaacaccagtctcatcgatctcctcatc 241
           ||||| ||||| |||||||||||||||||
Sbjct: 590 tcaactccagtgtcatcgatctcctcatc 562
to top
>emb|CT032494.1| Platynereis dumerilii EST IB0AAA37BF03FM1
          Length = 804

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 213 tcaacaccagtctcatcgatctcctcatc 241
           ||||| ||||| |||||||||||||||||
Sbjct: 225 tcaactccagtgtcatcgatctcctcatc 253
to top
>gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete sequence
          Length = 182105

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 107   ctccatgatggcgctgacgatgtc 130
             ||||||||||||| ||||||||||
Sbjct: 23136 ctccatgatggcgttgacgatgtc 23159
to top
>ref|XM_883486.1| Leishmania major strain Friedlin nascent polypeptide associated
           complex subunit (L4830.08) partial mRNA
          Length = 735

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 102 gtcaactccatgatggcgctgacgatgtcgcc 133
           |||| ||||||||||| | |||||||||||||
Sbjct: 728 gtcagctccatgatggtgttgacgatgtcgcc 697
to top
>emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end
          Length = 247462

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 102   gtcaactccatgatggcgctgacgatgtcgcc 133
             |||| ||||||||||| | |||||||||||||
Sbjct: 79339 gtcagctccatgatggtgttgacgatgtcgcc 79370
to top
>ref|XM_847221.1| PREDICTED: Canis familiaris similar to nascent
           polypeptide-associated complex alpha polypeptide
           (LOC609875), mRNA
          Length = 360

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 107 ctccatgatggcgctgacgatgtc 130
           ||||||||||||| ||||||||||
Sbjct: 348 ctccatgatggcgttgacgatgtc 325
to top
>emb|CR688321.2|CNS0FU25 Tetraodon nigroviridis full-length cDNA
          Length = 1371

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 108  tccatgatggcgctgacgatgtcg 131
            |||||||||||| |||||||||||
Sbjct: 1257 tccatgatggcgttgacgatgtcg 1234
to top
>emb|CR686631.2|CNS0FSR7 Tetraodon nigroviridis full-length cDNA
          Length = 1357

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 108  tccatgatggcgctgacgatgtcg 131
            |||||||||||| |||||||||||
Sbjct: 1260 tccatgatggcgttgacgatgtcg 1237
to top
>ref|NM_165950.1| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RC, transcript variant C
           (Nacalpha), mRNA
          Length = 874

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 107 ctccatgatggcgctgacgatgtc 130
           ||||||||||||| ||||||||||
Sbjct: 695 ctccatgatggcgttgacgatgtc 672
to top
>ref|NM_134312.2| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RA, transcript variant A
           (Nacalpha), mRNA
          Length = 870

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 107 ctccatgatggcgctgacgatgtc 130
           ||||||||||||| ||||||||||
Sbjct: 686 ctccatgatggcgttgacgatgtc 663
to top
>ref|NM_057868.3| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RB, transcript variant B
           (Nacalpha), mRNA
          Length = 897

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 107 ctccatgatggcgctgacgatgtc 130
           ||||||||||||| ||||||||||
Sbjct: 713 ctccatgatggcgttgacgatgtc 690
to top
>gb|AY075332.1| Drosophila melanogaster GH11940 full length cDNA
          Length = 890

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 107 ctccatgatggcgctgacgatgtc 130
           ||||||||||||| ||||||||||
Sbjct: 684 ctccatgatggcgttgacgatgtc 661
to top
>gb|AE003821.4| Drosophila melanogaster chromosome 2R, section 29 of 73 of the complete
              sequence
          Length = 294168

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 107    ctccatgatggcgctgacgatgtc 130
              ||||||||||||| ||||||||||
Sbjct: 238219 ctccatgatggcgttgacgatgtc 238242
to top
>gb|AF017783.2|AF017783 Drosophila melanogaster alpha NAC, diacylglycerol kinase epsilon
           and ubiquinol-cytochrome C reductase complex genes,
           complete cds; and unknown gene
          Length = 4728

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 107 ctccatgatggcgctgacgatgtc 130
           ||||||||||||| ||||||||||
Sbjct: 779 ctccatgatggcgttgacgatgtc 756
to top
>gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, region 49C1-49D3, P1 clones
             DS04499, DS06146, and DS00455, complete sequence
          Length = 145055

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 107   ctccatgatggcgctgacgatgtc 130
             ||||||||||||| ||||||||||
Sbjct: 59899 ctccatgatggcgttgacgatgtc 59922
to top
>emb|BX255901.3| Mouse DNA sequence from clone RP23-200D14 on chromosome 4, complete
             sequence
          Length = 16695

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   ttgtcaacaccagtctcatc 229
             ||||||||||||||||||||
Sbjct: 14660 ttgtcaacaccagtctcatc 14679
to top
>emb|Y08969.1|DMNACPRAL D.melanogaster mRNA for NAC protein alpha subunit
          Length = 829

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 107 ctccatgatggcgctgacgatgtc 130
           ||||||||||||| ||||||||||
Sbjct: 646 ctccatgatggcgttgacgatgtc 623


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,412,512
Number of Sequences: 3902068
Number of extensions: 1412512
Number of successful extensions: 23242
Number of sequences better than 10.0: 104
Number of HSP's better than 10.0 without gapping: 103
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 23117
Number of HSP's gapped (non-prelim): 126
length of query: 242
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 220
effective length of database: 17,147,199,772
effective search space: 3772383949840
effective search space used: 3772383949840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top