| Clone Name | rbaal12l17 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT009182.1| Triticum aestivum clone wl1n.pk0124.e2:fis, full insert mRNA sequence Length = 1340 Score = 220 bits (111), Expect = 5e-54 Identities = 312/379 (82%) Strand = Plus / Minus Query: 305 tacaacagctagaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggct 364 |||||| |||||||||| |||||||| |||||||| |||||||||||||| | ||| ||| Sbjct: 1052 tacaacggctagaactgggacttgtcaaggctgttaaagtagggatgctccatcgcagct 993 Query: 365 ttggctgagatcctgttcgccgggtcaaactggagcattttcgatagcaggtcaattcct 424 ||||| |||||||| | || |||| ||| |||||||||||||| ||||||| |||| Sbjct: 992 aaagctgatatcctgtttgaaggatcaagctgaagcattttcgatagaaggtcaactcct 933 Query: 425 tctgtttccagtgttgggactgcacgcgtcattctttgtgctttccactgaggaaactcg 484 || | ||||||||||||||| |||| | || | || | |||||||| |||||||| Sbjct: 932 tcaggttccagtgttgggacgacacgtgccaaaccctggggcttccactgtggaaactca 873 Query: 485 tgccagtccctcagagcagttactccaggccaatcctcctcggtaggagttcccatcagc 544 ||||||||||| | | || | ||||||||||| | ||||| ||||| ||||||| || | Sbjct: 872 tgccagtcccttaaatcactcactccaggccactgttcctcagtaggtgttcccagcaac 813 Query: 545 ctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttctg 604 ||||| |||||||||| || || ||||| ||||||||||| || |||||||| || | Sbjct: 812 ctgaagatgtgaagcaactgttgcaactccgagtcaccaggaaagagagcctgccgtcgg 753 Query: 605 accatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgtt 664 |||| || |||||||||||||||| ||||| |||||||| |||||||||||||||||| Sbjct: 752 gccatttcagcaaagatgcatccaacagaccacatatcaacgccagttgagtaatgtgtt 693 Query: 665 gctccaagcagtacttcag 683 |||||||||| ||||||| Sbjct: 692 gctccaagcaaaacttcag 674
>gb|AY106440.1| Zea mays PCO134290 mRNA sequence Length = 1542 Score = 220 bits (111), Expect = 5e-54 Identities = 312/379 (82%) Strand = Plus / Minus Query: 305 tacaacagctagaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggct 364 |||||| |||||||||| |||||||| |||||||| |||||||||||||| | ||| ||| Sbjct: 1281 tacaacggctagaactgggacttgtcaaggctgttaaagtagggatgctccatcgcagct 1222 Query: 365 ttggctgagatcctgttcgccgggtcaaactggagcattttcgatagcaggtcaattcct 424 ||||| |||||||| | || |||| ||| |||||||||||||| ||||||| |||| Sbjct: 1221 aaagctgatatcctgtttgaaggatcaagctgaagcattttcgatagaaggtcaactcct 1162 Query: 425 tctgtttccagtgttgggactgcacgcgtcattctttgtgctttccactgaggaaactcg 484 || | ||||||||||||||| |||| | || | || | |||||||| |||||||| Sbjct: 1161 tcaggttccagtgttgggacgacacgtgccaaaccctggggcttccactgtggaaactca 1102 Query: 485 tgccagtccctcagagcagttactccaggccaatcctcctcggtaggagttcccatcagc 544 ||||||||||| | | || | ||||||||||| | ||||| ||||| ||||||| || | Sbjct: 1101 tgccagtcccttaaatcactcactccaggccactgttcctcagtaggtgttcccagcaac 1042 Query: 545 ctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttctg 604 ||||| |||||||||| || || ||||| ||||||||||| || |||||||| || | Sbjct: 1041 ctgaagatgtgaagcaactgttgcaactccgagtcaccaggaaagagagcctgccgtcgg 982 Query: 605 accatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgtt 664 |||| || |||||||||||||||| ||||| |||||||| |||||||||||||||||| Sbjct: 981 gccatttcagcaaagatgcatccaacagaccacatatcaacgccagttgagtaatgtgtt 922 Query: 665 gctccaagcagtacttcag 683 |||||||||| ||||||| Sbjct: 921 gctccaagcaaaacttcag 903
>ref|NM_190272.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 912 Score = 216 bits (109), Expect = 7e-53 Identities = 190/217 (87%) Strand = Plus / Minus Query: 467 ttccactgaggaaactcgtgccagtccctcagagcagttactccaggccaatcctcctcg 526 |||||||| |||||||| ||||||||||||| | |||||||||||||||| | |||||| Sbjct: 758 ttccactgtggaaactcatgccagtccctcaaatcagttactccaggccactgctcctca 699 Query: 527 gtaggagttcccatcagcctgaaaatgtgaagcagttgctgtaactcagagtcaccaggg 586 ||||||||||||| || ||||||||||||||||| || || |||||||||||||| || Sbjct: 698 gtaggagttcccaacaacctgaaaatgtgaagcaactgttgcaactcagagtcacctgga 639 Query: 587 aaaagagcctgttttctgaccatctcggcaaagatgcatccaatggaccaaatatcaaca 646 |||||||| ||| |||||||||| || || |||||||| |||| ||||||||| |||||| Sbjct: 638 aaaagagcttgtcttctgaccatttcagcgaagatgcaaccaacggaccaaatgtcaaca 579 Query: 647 ccagttgagtaatgtgttgctccaagcagtacttcag 683 || |||||||||||||||| |||||||| ||||||| Sbjct: 578 ccggttgagtaatgtgttgatccaagcaaaacttcag 542 Score = 75.8 bits (38), Expect = 2e-10 Identities = 95/114 (83%) Strand = Plus / Minus Query: 313 ctagaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctga 372 ||||||||| |||||||||||||||| ||||||||| || || | || || || ||||| Sbjct: 912 ctagaactgggacttgtcgaggctgtcgaagtaggggtgttccatagcagcctttgctga 853 Query: 373 gatcctgttcgccgggtcaaactggagcattttcgatagcaggtcaattccttc 426 ||||| || || |||| | |||||||||||||||||| ||||||| |||||| Sbjct: 852 gatccgatttgctgggttatactggagcattttcgataaaaggtcaactccttc 799
>dbj|AB239918.1| Oryza sativa (japonica cultivar-group) Os;CDKB1;1 mRNA for cyclin-dependent kinase, complete cds Length = 912 Score = 216 bits (109), Expect = 7e-53 Identities = 190/217 (87%) Strand = Plus / Minus Query: 467 ttccactgaggaaactcgtgccagtccctcagagcagttactccaggccaatcctcctcg 526 |||||||| |||||||| ||||||||||||| | |||||||||||||||| | |||||| Sbjct: 758 ttccactgtggaaactcatgccagtccctcaaatcagttactccaggccactgctcctca 699 Query: 527 gtaggagttcccatcagcctgaaaatgtgaagcagttgctgtaactcagagtcaccaggg 586 ||||||||||||| || ||||||||||||||||| || || |||||||||||||| || Sbjct: 698 gtaggagttcccaacaacctgaaaatgtgaagcaactgttgcaactcagagtcacctgga 639 Query: 587 aaaagagcctgttttctgaccatctcggcaaagatgcatccaatggaccaaatatcaaca 646 |||||||| ||| |||||||||| || || |||||||| |||| ||||||||| |||||| Sbjct: 638 aaaagagcttgtcttctgaccatttcagcgaagatgcaaccaacggaccaaatgtcaaca 579 Query: 647 ccagttgagtaatgtgttgctccaagcagtacttcag 683 || |||||||||||||||| |||||||| ||||||| Sbjct: 578 ccggttgagtaatgtgttgatccaagcaaaacttcag 542 Score = 75.8 bits (38), Expect = 2e-10 Identities = 95/114 (83%) Strand = Plus / Minus Query: 313 ctagaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctga 372 ||||||||| |||||||||||||||| ||||||||| || || | || || || ||||| Sbjct: 912 ctagaactgggacttgtcgaggctgtcgaagtaggggtgttccatagcagcctttgctga 853 Query: 373 gatcctgttcgccgggtcaaactggagcattttcgatagcaggtcaattccttc 426 ||||| || || |||| | |||||||||||||||||| ||||||| |||||| Sbjct: 852 gatccgatttgctgggttatactggagcattttcgataaaaggtcaactccttc 799
>ref|NM_129419.3| Arabidopsis thaliana CDKB1;2; kinase AT2G38620 (CDKB1;2) transcript variant AT2G38620.1 mRNA, complete cds Length = 1438 Score = 121 bits (61), Expect = 3e-24 Identities = 103/117 (88%) Strand = Plus / Minus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttct 603 ||||||||| ||||| |||||||| |||||||| ||||||||||||||||| || | || Sbjct: 751 cctgaaaatatgaagtagttgctgaaactcagaatcaccagggaaaagagcttgcctcct 692 Query: 604 gaccatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatg 660 | ||||||||||||||||||||||| ||||||||||||||| |||| |||||||| Sbjct: 691 aatcatctcggcaaagatgcatccaacagaccaaatatcaacagcagtagagtaatg 635 Score = 44.1 bits (22), Expect = 0.60 Identities = 49/58 (84%) Strand = Plus / Minus Query: 315 agaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctga 372 |||||||||| ||||| ||||||| ||||||||||| || || || ||||| ||||| Sbjct: 1278 agaactgagatttgtcaaggctgtcaaagtagggatgatcgagagctgcttttgctga 1221
>emb|BX818944.1|CNS0A8VV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB2ZB06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1438 Score = 121 bits (61), Expect = 3e-24 Identities = 103/117 (88%) Strand = Plus / Minus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttct 603 ||||||||| ||||| |||||||| |||||||| ||||||||||||||||| || | || Sbjct: 751 cctgaaaatatgaagtagttgctgaaactcagaatcaccagggaaaagagcttgcctcct 692 Query: 604 gaccatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatg 660 | ||||||||||||||||||||||| ||||||||||||||| |||| |||||||| Sbjct: 691 aatcatctcggcaaagatgcatccaacagaccaaatatcaacagcagtagagtaatg 635 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 315 agaactgagacttgtcgaggctgttgaagtagggatg 351 |||||||||| ||||| ||||||| ||||||||||| Sbjct: 1278 agaactgagatttgtcaaggctgtcaaagtagggatg 1242
>ref|NM_001036430.1| Arabidopsis thaliana CDKB1;2; kinase AT2G38620 (CDKB1;2) transcript variant AT2G38620.2 mRNA, complete cds Length = 1070 Score = 119 bits (60), Expect = 1e-23 Identities = 102/116 (87%) Strand = Plus / Minus Query: 545 ctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttctg 604 |||||||| ||||| |||||||| |||||||| ||||||||||||||||| || | || Sbjct: 723 ctgaaaatatgaagtagttgctgaaactcagaatcaccagggaaaagagcttgcctccta 664 Query: 605 accatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatg 660 | ||||||||||||||||||||||| ||||||||||||||| |||| |||||||| Sbjct: 663 atcatctcggcaaagatgcatccaacagaccaaatatcaacagcagtagagtaatg 608 Score = 44.1 bits (22), Expect = 0.60 Identities = 49/58 (84%) Strand = Plus / Minus Query: 315 agaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctga 372 |||||||||| ||||| ||||||| ||||||||||| || || || ||||| ||||| Sbjct: 953 agaactgagatttgtcaaggctgtcaaagtagggatgatcgagagctgcttttgctga 896
>emb|AJ297937.1|ATH297937 Arabidopsis thaliana mRNA for cyclin dependent kinase (CDKB1;2 gene) Length = 1074 Score = 119 bits (60), Expect = 1e-23 Identities = 102/116 (87%) Strand = Plus / Minus Query: 545 ctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttctg 604 |||||||| ||||| |||||||| |||||||| ||||||||||||||||| || | || Sbjct: 704 ctgaaaatatgaagtagttgctgaaactcagaatcaccagggaaaagagcttgcctccta 645 Query: 605 accatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatg 660 | ||||||||||||||||||||||| ||||||||||||||| |||| |||||||| Sbjct: 644 atcatctcggcaaagatgcatccaacagaccaaatatcaacagcagtagagtaatg 589 Score = 44.1 bits (22), Expect = 0.60 Identities = 49/58 (84%) Strand = Plus / Minus Query: 315 agaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctga 372 |||||||||| ||||| ||||||| ||||||||||| || || || ||||| ||||| Sbjct: 934 agaactgagatttgtcaaggctgtcaaagtagggatgatcgagagctgcttttgctga 877
>dbj|AK221669.1| Arabidopsis thaliana mRNA for putative cell division control protein kinase, complete cds, clone: RAFL09-97-P17 Length = 1185 Score = 111 bits (56), Expect = 3e-21 Identities = 101/116 (87%) Strand = Plus / Minus Query: 545 ctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttctg 604 |||||||| |||| |||||||| |||||||| ||||||||||||||||| || | || Sbjct: 723 ctgaaaatatgaattagttgctgaaactcagaatcaccagggaaaagagcttgcctccta 664 Query: 605 accatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatg 660 | ||||||||||||||||||||||| ||||||||||||||| |||| |||||||| Sbjct: 663 atcatctcggcaaagatgcatccaacagaccaaatatcaacagcagtagagtaatg 608 Score = 44.1 bits (22), Expect = 0.60 Identities = 49/58 (84%) Strand = Plus / Minus Query: 315 agaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctga 372 |||||||||| ||||| ||||||| ||||||||||| || || || ||||| ||||| Sbjct: 953 agaactgagatttgtcaaggctgtcaaagtagggatgatcgagagctgcttttgctga 896
>emb|AJ297916.1|LES297916 Lycopersicon esculentum mRNA for B1-type cyclin dependent kinase (cdkB1 gene) Length = 1261 Score = 93.7 bits (47), Expect = 7e-16 Identities = 110/131 (83%) Strand = Plus / Minus Query: 530 ggagttcccatcagcctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaa 589 |||||||| | || |||||| |||||||||| |||||| ||||||||||||||||| || Sbjct: 785 ggagttcctaacaacctgaatatgtgaagcaattgctggaactcagagtcaccaggaaat 726 Query: 590 agagcctgttttctgaccatctcggcaaagatgcatccaatggaccaaatatcaacacca 649 | || || |||| |||||||||||||| || ||||| | ||||| ||||||||| || Sbjct: 725 aaggcttgccttctaaccatctcggcaaaaatacatcccacagaccacatatcaacagca 666 Query: 650 gttgagtaatg 660 ||||||||||| Sbjct: 665 gttgagtaatg 655
>gb|AF289466.1|AF289466 Nicotiana tabacum cyclin-dependent kinase B1-2 (CdkB1-2) mRNA, complete cds Length = 1334 Score = 93.7 bits (47), Expect = 7e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 506 actccaggccaatcctcctcggtaggagttcccatcagcctgaaaatgtgaagcagttgc 565 ||||||||||| | || ||| || || ||||| | ||||||||| ||||||||||||||| Sbjct: 827 actccaggccactgcttctcagttggggttcctaacagcctgaatatgtgaagcagttgc 768 Query: 566 tgtaactcagagtcaccagggaaaagagcctgttttctgaccatctcggcaaagatgcat 625 || ||||||||||||||||| || | || || ||| |||||||||||||| || ||| Sbjct: 767 tgaaactcagagtcaccaggaaataaggcttgccttcgaaccatctcggcaaaaatacat 708 Query: 626 ccaatggaccaaatatcaacaccagttgagtaatg 660 || | ||||| |||||||| ||||||||||||| Sbjct: 707 cccacagaccacatatcaaccgcagttgagtaatg 673 Score = 46.1 bits (23), Expect = 0.15 Identities = 74/91 (81%) Strand = Plus / Minus Query: 317 aactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctgagatc 376 |||||||||||||| | ||| | |||||| ||||| || || || ||||| ||||| ||| Sbjct: 1016 aactgagacttgtccaagctatcgaagtatggatgatcaagtgcagcttttgctgaaatc 957 Query: 377 ctgttcgccgggtcaaactggagcattttcg 407 || | ||||| ||| | ||||||||||||| Sbjct: 956 ctatctgccggatcatattggagcattttcg 926
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 89.7 bits (45), Expect = 1e-14 Identities = 66/73 (90%) Strand = Plus / Plus Query: 467 ttccactgaggaaactcgtgccagtccctcagagcagttactccaggccaatcctcctcg 526 |||||||| |||||||| ||||||||||||| | |||||||||||||||| | |||||| Sbjct: 38975179 ttccactgtggaaactcatgccagtccctcaaatcagttactccaggccactgctcctca 38975238 Query: 527 gtaggagttccca 539 ||||||||||||| Sbjct: 38975239 gtaggagttccca 38975251 Score = 77.8 bits (39), Expect = 4e-11 Identities = 60/67 (89%) Strand = Plus / Plus Query: 617 aagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgttgctccaagcagt 676 |||||||| |||| ||||||||| |||||||| |||||||||||||||| |||||||| Sbjct: 38976026 aagatgcaaccaacggaccaaatgtcaacaccggttgagtaatgtgttgatccaagcaaa 38976085 Query: 677 acttcag 683 ||||||| Sbjct: 38976086 acttcag 38976092 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttct 603 ||||||||||||||||| || || |||||||||||||| || |||||||| ||| |||| Sbjct: 38975573 cctgaaaatgtgaagcaactgttgcaactcagagtcacctggaaaaagagcttgtcttct 38975632 Query: 604 gaccat 609 |||||| Sbjct: 38975633 gaccat 38975638 Score = 60.0 bits (30), Expect = 1e-05 Identities = 78/94 (82%) Strand = Plus / Plus Query: 313 ctagaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctga 372 ||||||||| |||||||||||||||| ||||||||| || || | || || || ||||| Sbjct: 38974803 ctagaactgggacttgtcgaggctgtcgaagtaggggtgttccatagcagcctttgctga 38974862 Query: 373 gatcctgttcgccgggtcaaactggagcattttc 406 ||||| || || |||| | |||||||||||||| Sbjct: 38974863 gatccgatttgctgggttatactggagcattttc 38974896
>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence Length = 268433 Score = 89.7 bits (45), Expect = 1e-14 Identities = 63/69 (91%) Strand = Plus / Plus Query: 615 caaagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgttgctccaagca 674 ||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||| Sbjct: 172582 caaagatgcatccaacagaccacatatcaaccccagttgagtaatgtgttgctccaagca 172641 Query: 675 gtacttcag 683 ||||||| Sbjct: 172642 aaacttcag 172650 Score = 46.1 bits (23), Expect = 0.15 Identities = 35/39 (89%) Strand = Plus / Plus Query: 406 cgatagcaggtcaattccttctgtttccagtgttgggac 444 |||||||||||||| ||||| | ||||||||||||||| Sbjct: 171658 cgatagcaggtcaacgccttcaggttccagtgttgggac 171696 Score = 44.1 bits (22), Expect = 0.60 Identities = 46/54 (85%) Strand = Plus / Plus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctg 597 |||||| |||||||||| || || |||||||||||||| || || |||||||| Sbjct: 172190 cctgaagatgtgaagcaactgttgcaactcagagtcaccgggaaagagagcctg 172243
>dbj|AP003349.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0674H09 Length = 142955 Score = 89.7 bits (45), Expect = 1e-14 Identities = 66/73 (90%) Strand = Plus / Plus Query: 467 ttccactgaggaaactcgtgccagtccctcagagcagttactccaggccaatcctcctcg 526 |||||||| |||||||| ||||||||||||| | |||||||||||||||| | |||||| Sbjct: 48812 ttccactgtggaaactcatgccagtccctcaaatcagttactccaggccactgctcctca 48871 Query: 527 gtaggagttccca 539 ||||||||||||| Sbjct: 48872 gtaggagttccca 48884 Score = 77.8 bits (39), Expect = 4e-11 Identities = 60/67 (89%) Strand = Plus / Plus Query: 617 aagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgttgctccaagcagt 676 |||||||| |||| ||||||||| |||||||| |||||||||||||||| |||||||| Sbjct: 49659 aagatgcaaccaacggaccaaatgtcaacaccggttgagtaatgtgttgatccaagcaaa 49718 Query: 677 acttcag 683 ||||||| Sbjct: 49719 acttcag 49725 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttct 603 ||||||||||||||||| || || |||||||||||||| || |||||||| ||| |||| Sbjct: 49206 cctgaaaatgtgaagcaactgttgcaactcagagtcacctggaaaaagagcttgtcttct 49265 Query: 604 gaccat 609 |||||| Sbjct: 49266 gaccat 49271 Score = 60.0 bits (30), Expect = 1e-05 Identities = 78/94 (82%) Strand = Plus / Plus Query: 313 ctagaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctga 372 ||||||||| |||||||||||||||| ||||||||| || || | || || || ||||| Sbjct: 48436 ctagaactgggacttgtcgaggctgtcgaagtaggggtgttccatagcagcctttgctga 48495 Query: 373 gatcctgttcgccgggtcaaactggagcattttc 406 ||||| || || |||| | |||||||||||||| Sbjct: 48496 gatccgatttgctgggttatactggagcattttc 48529
>dbj|AP003316.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0696G06 Length = 142571 Score = 89.7 bits (45), Expect = 1e-14 Identities = 66/73 (90%) Strand = Plus / Plus Query: 467 ttccactgaggaaactcgtgccagtccctcagagcagttactccaggccaatcctcctcg 526 |||||||| |||||||| ||||||||||||| | |||||||||||||||| | |||||| Sbjct: 139965 ttccactgtggaaactcatgccagtccctcaaatcagttactccaggccactgctcctca 140024 Query: 527 gtaggagttccca 539 ||||||||||||| Sbjct: 140025 gtaggagttccca 140037 Score = 77.8 bits (39), Expect = 4e-11 Identities = 60/67 (89%) Strand = Plus / Plus Query: 617 aagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgttgctccaagcagt 676 |||||||| |||| ||||||||| |||||||| |||||||||||||||| |||||||| Sbjct: 140812 aagatgcaaccaacggaccaaatgtcaacaccggttgagtaatgtgttgatccaagcaaa 140871 Query: 677 acttcag 683 ||||||| Sbjct: 140872 acttcag 140878 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttct 603 ||||||||||||||||| || || |||||||||||||| || |||||||| ||| |||| Sbjct: 140359 cctgaaaatgtgaagcaactgttgcaactcagagtcacctggaaaaagagcttgtcttct 140418 Query: 604 gaccat 609 |||||| Sbjct: 140419 gaccat 140424 Score = 60.0 bits (30), Expect = 1e-05 Identities = 78/94 (82%) Strand = Plus / Plus Query: 313 ctagaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctga 372 ||||||||| |||||||||||||||| ||||||||| || || | || || || ||||| Sbjct: 139589 ctagaactgggacttgtcgaggctgtcgaagtaggggtgttccatagcagcctttgctga 139648 Query: 373 gatcctgttcgccgggtcaaactggagcattttc 406 ||||| || || |||| | |||||||||||||| Sbjct: 139649 gatccgatttgctgggttatactggagcattttc 139682
>ref|NM_115278.2| Arabidopsis thaliana CDC2B (CDC2-LIKE GENE); kinase AT3G54180 (CDC2B) mRNA, complete cds Length = 1204 Score = 87.7 bits (44), Expect = 4e-14 Identities = 116/140 (82%) Strand = Plus / Minus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttct 603 |||||| || ||||||| |||||| |||||||| ||||||||||||||||| || | | Sbjct: 785 cctgaagatatgaagcaattgctgaaactcagaatcaccagggaaaagagcttgcctccg 726 Query: 604 gaccatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgt 663 |||||||| |||||||| || |||| ||||| || |||||||||||||| ||||| || Sbjct: 725 aaccatctcagcaaagatacaaccaacagaccacatgtcaacaccagttgaataatgagt 666 Query: 664 tgctccaagcagtacttcag 683 | |||||| || ||||||| Sbjct: 665 agatccaagaagaacttcag 646 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 agaactgagacttgtcgaggctgt 338 |||||||||||||||| ||||||| Sbjct: 1014 agaactgagacttgtcaaggctgt 991
>emb|AJ278885.1|CRU278885 Chenopodium rubrum mRNA for cyclin dependent kinase (cdc2b gene) Length = 1133 Score = 87.7 bits (44), Expect = 4e-14 Identities = 134/164 (81%) Strand = Plus / Minus Query: 497 agagcagttactccaggccaatcctcctcggtaggagttcccatcagcctgaaaatgtga 556 |||| ||||||||||||||| | ||| || || || ||||||| |||||| || ||||| Sbjct: 782 agagaagttactccaggccactgctcgtcagttggggttcccaacagcctaaagatgtgt 723 Query: 557 agcagttgctgtaactcagagtcaccagggaaaagagcctgttttctgaccatctcggca 616 | || || || || ||||| |||||||| || | |||||| |||||||||| || ||| Sbjct: 722 aatagctgttgaaattcagaatcaccaggaaacaaagcctgccttctgaccatttcagca 663 Query: 617 aagatgcatccaatggaccaaatatcaacaccagttgagtaatg 660 |||||||| |||| |||||||||||||||||||| || ||||| Sbjct: 662 aagatgcagccaacagaccaaatatcaacaccagtagaataatg 619
>gb|AY084810.1| Arabidopsis thaliana clone 118434 mRNA, complete sequence Length = 1183 Score = 87.7 bits (44), Expect = 4e-14 Identities = 116/140 (82%) Strand = Plus / Minus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttct 603 |||||| || ||||||| |||||| |||||||| ||||||||||||||||| || | | Sbjct: 786 cctgaagatatgaagcaattgctgaaactcagaatcaccagggaaaagagcttgcctccg 727 Query: 604 gaccatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgt 663 |||||||| |||||||| || |||| ||||| || |||||||||||||| ||||| || Sbjct: 726 aaccatctcagcaaagatacaaccaacagaccacatgtcaacaccagttgaataatgagt 667 Query: 664 tgctccaagcagtacttcag 683 | |||||| || ||||||| Sbjct: 666 agatccaagaagaacttcag 647 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 agaactgagacttgtcgaggctgt 338 |||||||||||||||| ||||||| Sbjct: 1015 agaactgagacttgtcaaggctgt 992
>gb|AF289465.1|AF289465 Nicotiana tabacum cyclin-dependent kinase B1-1 (CdkB1-1) mRNA, complete cds Length = 1173 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 506 actccaggccaatcctcctcggtaggagttcccatcagcctgaaaatgtgaagcagttgc 565 ||||||||||| | || ||| || || ||||| | || |||||| |||||||||| |||| Sbjct: 741 actccaggccactgcttctcagttggggttcctaacaacctgaatatgtgaagcaattgc 682 Query: 566 tgtaactcagagtcaccagggaaaagagcctgttttctgaccatctcggcaaagatgcat 625 || ||||||||||||||||| || | ||||| ||| |||||||||||||| || ||| Sbjct: 681 tgaaactcagagtcaccaggaaataaggcctgccttcgaaccatctcggcaaaaatacat 622 Query: 626 ccaatggaccaaatatcaacaccagttgagtaatg 660 || | ||||| |||||||| ||||||||||||| Sbjct: 621 cccacagaccacatatcaaccgcagttgagtaatg 587
>emb|AJ717830.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT1-33-410, cultivar Bright Yellow 2 Length = 368 Score = 81.8 bits (41), Expect = 3e-12 Identities = 115/140 (82%) Strand = Plus / Minus Query: 506 actccaggccaatcctcctcggtaggagttcccatcagcctgaaaatgtgaagcagttgc 565 ||||||||||| | || ||| || || ||||| | ||||||||| ||||||||||||||| Sbjct: 149 actccaggccactgcttctcagttggggttcctaacagcctgaatatgtgaagcagttgc 90 Query: 566 tgtaactcagagtcaccagggaaaagagcctgttttctgaccatctcggcaaagatgcat 625 || ||||||||||||||||| || | || || ||| |||||||||||||| || | | Sbjct: 89 tgaaactcagagtcaccaggaaanaaggcttgccttcgaaccatctcggcaaaaatacgt 30 Query: 626 ccaatggaccaaatatcaac 645 || | |||||| |||||||| Sbjct: 29 cccacggaccacatatcaac 10 Score = 46.1 bits (23), Expect = 0.15 Identities = 74/91 (81%) Strand = Plus / Minus Query: 317 aactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctgagatc 376 |||||||||||||| | ||| | |||||| ||||| || || || ||||| ||||| ||| Sbjct: 338 aactgagacttgtccaagctatcgaagtatggatgatcaagtgcagcttttgctgaaatc 279 Query: 377 ctgttcgccgggtcaaactggagcattttcg 407 || | ||||| ||| | ||||||||||||| Sbjct: 278 ctatctgccggatcatattggagcattttcg 248
>emb|AJ717869.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT12-3-410, cultivar Bright Yellow 2 Length = 362 Score = 79.8 bits (40), Expect = 1e-11 Identities = 70/80 (87%) Strand = Plus / Minus Query: 506 actccaggccaatcctcctcggtaggagttcccatcagcctgaaaatgtgaagcagttgc 565 ||||||||||| | || ||| || || ||||| | ||||||||| ||||||||||||||| Sbjct: 143 actccaggccactgcttctcagttggggttcctaacagcctgaatatgtgaagcagttgc 84 Query: 566 tgtaactcagagtcaccagg 585 || ||||||||||||||||| Sbjct: 83 tgaaactcagagtcaccagg 64 Score = 46.1 bits (23), Expect = 0.15 Identities = 74/91 (81%) Strand = Plus / Minus Query: 317 aactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctgagatc 376 |||||||||||||| | ||| | |||||| ||||| || || || ||||| ||||| ||| Sbjct: 332 aactgagacttgtccaagctatcgaagtatggatgatcaagtgcagcttttgctgaaatc 273 Query: 377 ctgttcgccgggtcaaactggagcattttcg 407 || | ||||| ||| | ||||||||||||| Sbjct: 272 ctatctgccggatcatattggagcattttcg 242
>emb|X57840.1|ATCDC2BP A.thaliana CDC2b gene for p34(cdc2) cell cycle protein Length = 703 Score = 71.9 bits (36), Expect = 3e-09 Identities = 114/140 (81%) Strand = Plus / Minus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttct 603 |||||| || ||||||| ||| | |||||||| ||||||||||||||||| || | | Sbjct: 284 cctgaagatatgaagcaattgtcgaaactcagaatcaccagggaaaagagcttgcctccg 225 Query: 604 gaccatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgt 663 |||||||| |||||||| || |||| ||||| || |||||||||||||| ||||| || Sbjct: 224 aaccatctcagcaaagatacaaccaacagaccacatgtcaacaccagttgaataatgagt 165 Query: 664 tgctccaagcagtacttcag 683 | |||||| || ||||||| Sbjct: 164 agatccaagaagaacttcag 145 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 agaactgagacttgtcgaggctgt 338 |||||||||||||||| ||||||| Sbjct: 513 agaactgagacttgtcaaggctgt 490
>gb|AC005499.3| Arabidopsis thaliana chromosome 2 clone T6A23 map ve018, complete sequence Length = 107541 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagc 594 ||||||||| ||||| |||||||| |||||||| ||||||||||||||||| Sbjct: 63803 cctgaaaatatgaagtagttgctgaaactcagaatcaccagggaaaagagc 63853 Score = 60.0 bits (30), Expect = 1e-05 Identities = 42/46 (91%) Strand = Plus / Plus Query: 615 caaagatgcatccaatggaccaaatatcaacaccagttgagtaatg 660 ||||||||||||||| ||||||||||||||| |||| |||||||| Sbjct: 63956 caaagatgcatccaacagaccaaatatcaacagcagtagagtaatg 64001 Score = 44.1 bits (22), Expect = 0.60 Identities = 49/58 (84%) Strand = Plus / Plus Query: 315 agaactgagacttgtcgaggctgttgaagtagggatgctctagcgcggctttggctga 372 |||||||||| ||||| ||||||| ||||||||||| || || || ||||| ||||| Sbjct: 63276 agaactgagatttgtcaaggctgtcaaagtagggatgatcgagagctgcttttgctga 63333
>emb|X97315.1|MSCDC2MSD M.sativa mRNA for cdc2 kinase homologue, cdc2MsD Length = 1274 Score = 61.9 bits (31), Expect = 3e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 592 agcctgttttctgaccatctcggcaaagatgcatccaatggaccaaatatcaacaccagt 651 ||||||| |||| ||||| || ||||| || ||||||| |||||||||||||||||||| Sbjct: 690 agcctgtcttctcaccatttcagcaaaaatacatccaacagaccaaatatcaacaccagt 631 Query: 652 tgagtaa 658 |||||| Sbjct: 630 agagtaa 624
>emb|AL132957.1|ATF24B22 Arabidopsis thaliana DNA chromosome 3, BAC clone F24B22 Length = 100285 Score = 61.9 bits (31), Expect = 3e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagc 594 |||||| || ||||||| |||||| |||||||| ||||||||||||||||| Sbjct: 45776 cctgaagatatgaagcaattgctgaaactcagaatcaccagggaaaagagc 45726 Score = 42.1 bits (21), Expect = 2.4 Identities = 57/69 (82%) Strand = Plus / Minus Query: 615 caaagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgttgctccaagca 674 ||||||| || |||| ||||| || |||||||||||||| ||||| || | |||||| | Sbjct: 45611 caaagatacaaccaacagaccacatgtcaacaccagttgaataatgagtagatccaagaa 45552 Query: 675 gtacttcag 683 | ||||||| Sbjct: 45551 gaacttcag 45543 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 agaactgagacttgtcgaggctgt 338 |||||||||||||||| ||||||| Sbjct: 46350 agaactgagacttgtcaaggctgt 46327
>dbj|D10851.1|ATHCDC2BG Arabidopsis thaliana CDC2b gene for p34 protein serine/threonine kinase-related protein Length = 2611 Score = 61.9 bits (31), Expect = 3e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagc 594 |||||| || ||||||| |||||| |||||||| ||||||||||||||||| Sbjct: 1429 cctgaagatatgaagcaattgctgaaactcagaatcaccagggaaaagagc 1379 Score = 42.1 bits (21), Expect = 2.4 Identities = 57/69 (82%) Strand = Plus / Minus Query: 615 caaagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgttgctccaagca 674 ||||||| || |||| ||||| || |||||||||||||| ||||| || | |||||| | Sbjct: 1264 caaagatacaaccaacagaccacatgtcaacaccagttgaataatgagtagatccaagaa 1205 Query: 675 gtacttcag 683 | ||||||| Sbjct: 1204 gaacttcag 1196 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 agaactgagacttgtcgaggctgt 338 |||||||||||||||| ||||||| Sbjct: 2003 agaactgagacttgtcaaggctgt 1980
>ref|XM_500733.1| Yarrowia lipolytica CLIB122, YALI0B10758g predicted mRNA Length = 951 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 605 accatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagta 657 ||||||||||||||||| || ||||||||||| || || |||||||| ||||| Sbjct: 608 accatctcggcaaagatacagccaatggaccacatgtccacaccagtggagta 556
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica Length = 3066374 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 605 accatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagta 657 ||||||||||||||||| || ||||||||||| || || |||||||| ||||| Sbjct: 1463859 accatctcggcaaagatacagccaatggaccacatgtccacaccagtggagta 1463911
>gb|AY063463.1| Helianthus tuberosus cyclin-dependent kinase (CdkB1;1) mRNA, complete cds Length = 1206 Score = 54.0 bits (27), Expect = 6e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 519 cctcctcggtaggagttcccatcagcctgaaaatgtgaagcagttgctgtaactcagagt 578 |||||||||| || || || | ||||||||| || ||||||||||| || |||||||| | Sbjct: 773 cctcctcggtcggtgtcccgagcagcctgaatatatgaagcagttgttggaactcagaat 714 Query: 579 caccagg 585 ||||||| Sbjct: 713 caccagg 707
>gb|AY518004.1| Sorghum bicolor clone 0543-SC0706 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY518003.1| Sorghum bicolor clone 0543-SC0599 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY518002.1| Sorghum bicolor clone 0543-SC0326 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY518001.1| Sorghum bicolor clone 0543-SC0155 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY518000.1| Sorghum bicolor clone 0543-SC0033 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517999.1| Sorghum bicolor clone 0543-RTx406 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517998.1| Sorghum arundinaceum clone 0543-LWA8 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517997.1| Sorghum arundinaceum clone 0543-LWA4 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517996.1| Sorghum bicolor clone 0543-92381 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517995.1| Sorghum bicolor clone 0543-82459b RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517994.1| Sorghum bicolor clone 0543-82459a RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517993.1| Sorghum bicolor clone 0543-77034 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517992.1| Sorghum bicolor clone 0543-56174 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517991.1| Sorghum bicolor clone 0543-56003 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517990.1| Sorghum bicolor clone 0543-514605 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517989.1| Sorghum bicolor clone 0543-51030 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517988.1| Sorghum bicolor clone 0543-267380 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517987.1| Sorghum bicolor clone 0543-257595 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517986.1| Sorghum bicolor clone 0543-246712 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517985.1| Sorghum bicolor clone 0543-22913 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517984.1| Sorghum arundinaceum clone 0543-225905 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517983.1| Sorghum bicolor clone 0543-152702 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517982.1| Sorghum bicolor clone 0543-102069 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517981.1| Sorghum bicolor clone 0543-RTx430 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>gb|AY517980.1| Sorghum bicolor clone 0543-BTx3197 RFLP probe pSB0543 Length = 385 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||| ||||| ||||| ||||| ||||| ||||||||||||||||| Sbjct: 201 tgaagatgtggagcagctgctgcaactcggagtcaccagggaaaag 156
>ref|XM_966689.1| PREDICTED: Tribolium castaneum similar to CG10572-PA (LOC660461), mRNA Length = 1398 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 611 tcggcaaagatgcatccaatggaccaaatatcaa 644 |||||||| ||||||||||||| ||||||||||| Sbjct: 677 tcggcaaaaatgcatccaatggcccaaatatcaa 644
>ref|XM_817272.1| Trypanosoma brucei TREU927 cell division protein kinase 2 homolog 1 (Tb10.70.7040) partial mRNA Length = 906 Score = 50.1 bits (25), Expect = 0.010 Identities = 37/41 (90%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatcaaca 646 ||||||| ||||||||||| |||| ||||||||||||||| Sbjct: 589 ccatctcagcaaagatgcacccaaccgaccaaatatcaaca 549
>emb|X64314.1|TBKIN1 T.brucei crk1 gene for cdc2-like protein kinase Length = 1091 Score = 50.1 bits (25), Expect = 0.010 Identities = 37/41 (90%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatcaaca 646 ||||||| ||||||||||| |||| ||||||||||||||| Sbjct: 708 ccatctcagcaaagatgcacccaaccgaccaaatatcaaca 668
>emb|AJ297917.1|LES297917 Lycopersicon esculentum mRNA for B2-type cyclin dependent kinase (cdkB2 gene) Length = 1279 Score = 48.1 bits (24), Expect = 0.038 Identities = 39/44 (88%) Strand = Plus / Minus Query: 545 ctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaa 588 |||||||||||||||||||| || | ||||||||| || ||||| Sbjct: 759 ctgaaaatgtgaagcagttgttgcagctcagagtctcctgggaa 716
>gb|AY107640.1| Zea mays PCO116745 mRNA sequence Length = 1386 Score = 48.1 bits (24), Expect = 0.038 Identities = 81/100 (81%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttctga 605 |||| ||||| ||||| ||||| | ||| ||||| ||||||||||| | ||| || ||| Sbjct: 907 tgaagatgtggagcagctgctgcagctccgagtcgccagggaaaagtggctggttagtga 848 Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatcaac 645 ||| |||||| || ||||| |||| |||||| || ||||| Sbjct: 847 ccagctcggcgaaaatgcagccaacggaccatatgtcaac 808
>gb|U18365.1|BNU18365 Brassica napus cyclin dependent protein kinase homolog gene, complete cds Length = 1240 Score = 48.1 bits (24), Expect = 0.038 Identities = 39/44 (88%) Strand = Plus / Minus Query: 602 ctgaccatctcggcaaagatgcatccaatggaccaaatatcaac 645 |||| |||||||||||| |||||||| | |||||||||||||| Sbjct: 695 ctgatcatctcggcaaatatgcatcccacagaccaaatatcaac 652
>ref|XM_955024.1| Neurospora crassa OR74A CELL DIVISION CONTROL PROTEIN 2 (CYCLIN-DEPENDENT PROTEIN KINASE) (NCU09778.1) partial mRNA Length = 987 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 611 tcggcaaagatgcatccaatggaccaaatatcaacaccagttgagta 657 |||||||||||||| |||| |||||| ||||| ||||| || ||||| Sbjct: 656 tcggcaaagatgcaaccaacggaccacatatcgacaccggtcgagta 610
>ref|XM_330427.1| Neurospora crassa OR74A CELL DIVISION CONTROL PROTEIN 2 (CYCLIN-DEPENDENT PROTEIN KINASE) (NCU09778.1) partial mRNA Length = 987 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 611 tcggcaaagatgcatccaatggaccaaatatcaacaccagttgagta 657 |||||||||||||| |||| |||||| ||||| ||||| || ||||| Sbjct: 656 tcggcaaagatgcaaccaacggaccacatatcgacaccggtcgagta 610
>ref|NM_101946.1| Arabidopsis thaliana CDKB2;2 (CYCLIN-DEPENDENT KINASE B2;2); kinase AT1G20930 (CDKB2;2) mRNA, complete cds Length = 1210 Score = 44.1 bits (22), Expect = 0.60 Identities = 43/50 (86%) Strand = Plus / Minus Query: 632 gaccaaatatcaacaccagttgagtaatgtgttgctccaagcagtacttc 681 ||||| ||||| || ||||| |||||||| ||||||||||| || ||||| Sbjct: 708 gaccacatatccactccagtagagtaatgggttgctccaagaagaacttc 659
>gb|BT009641.1| Triticum aestivum clone wre1n.pk191.c6:fis, full insert mRNA sequence Length = 1222 Score = 44.1 bits (22), Expect = 0.60 Identities = 40/46 (86%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaag 591 |||||||||| || || ||||| | ||||||||| ||||||||||| Sbjct: 623 tgaaaatgtgcaggagctgctgcacctcagagtctccagggaaaag 578
>ref|XM_776322.1| PREDICTED: Strongylocentrotus purpuratus similar to Cell division control protein 2 homolog (p34 protein kinase) (Cyclin-dependent kinase 1) (CDK1) (LOC575965), mRNA Length = 2166 Score = 44.1 bits (22), Expect = 0.60 Identities = 22/22 (100%) Strand = Plus / Minus Query: 603 tgaccatctcggcaaagatgca 624 |||||||||||||||||||||| Sbjct: 735 tgaccatctcggcaaagatgca 714
>gb|AC104982.7| Homo sapiens chromosome 17, clone RP11-338L22, complete sequence Length = 164107 Score = 44.1 bits (22), Expect = 0.60 Identities = 22/22 (100%) Strand = Plus / Minus Query: 59 aaataaaaaatcttctacatga 80 |||||||||||||||||||||| Sbjct: 137737 aaataaaaaatcttctacatga 137716
>dbj|AB247279.1| Camellia sinensis cdkb mRNA for cyclin dependent kinase B, complete cds Length = 915 Score = 44.1 bits (22), Expect = 0.60 Identities = 31/34 (91%) Strand = Plus / Minus Query: 345 agggatgctctagcgcggctttggctgagatcct 378 ||||||| ||||| || ||||||||||||||||| Sbjct: 883 agggatgatctagagctgctttggctgagatcct 850 Score = 44.1 bits (22), Expect = 0.60 Identities = 97/122 (79%) Strand = Plus / Minus Query: 544 cctgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttct 603 |||||| ||||||||||| ||||| ||||| ||||| ||||| || | ||| ||| | || Sbjct: 684 cctgaatatgtgaagcagctgctgaaactcggagtcgccaggaaataaagcttgtctcct 625 Query: 604 gaccatctcggcaaagatgcatccaatggaccaaatatcaacaccagttgagtaatgtgt 663 |||| || ||||| ||||| || | ||||| ||||| || ||||||||||||| || Sbjct: 624 tgccatttcagcaaaaatgcaacccacagaccacatatccacggcagttgagtaatgagt 565 Query: 664 tg 665 || Sbjct: 564 tg 563
>gb|AC104996.4| Homo sapiens chromosome 17, clone RP11-1148O4, complete sequence Length = 155848 Score = 44.1 bits (22), Expect = 0.60 Identities = 22/22 (100%) Strand = Plus / Minus Query: 59 aaataaaaaatcttctacatga 80 |||||||||||||||||||||| Sbjct: 31887 aaataaaaaatcttctacatga 31866
>gb|BT024780.1| Arabidopsis thaliana At1g20930 mRNA, complete cds Length = 948 Score = 44.1 bits (22), Expect = 0.60 Identities = 43/50 (86%) Strand = Plus / Minus Query: 632 gaccaaatatcaacaccagttgagtaatgtgttgctccaagcagtacttc 681 ||||| ||||| || ||||| |||||||| ||||||||||| || ||||| Sbjct: 626 gaccacatatccactccagtagagtaatgggttgctccaagaagaacttc 577
>emb|BX813510.1|CNS0ADKU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB21ZB02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1115 Score = 44.1 bits (22), Expect = 0.60 Identities = 43/50 (86%) Strand = Plus / Minus Query: 632 gaccaaatatcaacaccagttgagtaatgtgttgctccaagcagtacttc 681 ||||| ||||| || ||||| |||||||| ||||||||||| || ||||| Sbjct: 661 gaccacatatccactccagtagagtaatgggttgctccaagaagaacttc 612
>gb|AY084441.1| Arabidopsis thaliana clone 108339 mRNA, complete sequence Length = 1209 Score = 44.1 bits (22), Expect = 0.60 Identities = 43/50 (86%) Strand = Plus / Minus Query: 632 gaccaaatatcaacaccagttgagtaatgtgttgctccaagcagtacttc 681 ||||| ||||| || ||||| |||||||| ||||||||||| || ||||| Sbjct: 708 gaccacatatccactccagtagagtaatgggttgctccaagaagaacttc 659
>gb|AC158475.2| Postia placenta clone JGIACWS-5G19, complete sequence Length = 25716 Score = 44.1 bits (22), Expect = 0.60 Identities = 31/34 (91%) Strand = Plus / Minus Query: 603 tgaccatctcggcaaagatgcatccaatggacca 636 ||||||||||||||||||| || |||| |||||| Sbjct: 5562 tgaccatctcggcaaagatacacccaacggacca 5529
>gb|AC007369.2| Arabidopsis thaliana chromosome I BAC F9H16 genomic sequence, complete sequence Length = 103192 Score = 44.1 bits (22), Expect = 0.60 Identities = 43/50 (86%) Strand = Plus / Minus Query: 632 gaccaaatatcaacaccagttgagtaatgtgttgctccaagcagtacttc 681 ||||| ||||| || ||||| |||||||| ||||||||||| || ||||| Sbjct: 54526 gaccacatatccactccagtagagtaatgggttgctccaagaagaacttc 54477
>dbj|D82878.1| Hemicentrotus pulcherrimus mRNA for p34cdc2, complete cds Length = 1325 Score = 44.1 bits (22), Expect = 0.60 Identities = 22/22 (100%) Strand = Plus / Minus Query: 603 tgaccatctcggcaaagatgca 624 |||||||||||||||||||||| Sbjct: 698 tgaccatctcggcaaagatgca 677
>gb|AC120865.7| Mus musculus chromosome 5, clone RP23-88L6, complete sequence Length = 235287 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 204 ttcaagaaacatgggttggtg 224 ||||||||||||||||||||| Sbjct: 148627 ttcaagaaacatgggttggtg 148607
>ref|XM_323664.1| Neurospora crassa OR74A predicted protein (NCU04325.1) partial mRNA Length = 2283 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 84 gaagaacaagcatcttcagcc 104 ||||||||||||||||||||| Sbjct: 936 gaagaacaagcatcttcagcc 956
>ref|XM_955878.1| Neurospora crassa OR74A hypothetical protein (NCU04325.1) partial mRNA Length = 2283 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 84 gaagaacaagcatcttcagcc 104 ||||||||||||||||||||| Sbjct: 936 gaagaacaagcatcttcagcc 956
>ref|XM_568694.1| Cryptococcus neoformans var. neoformans JEC21 cyclin-dependent protein kinase (CNN01700) partial mRNA Length = 1321 Score = 42.1 bits (21), Expect = 2.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 508 tccaggccaatcctcctcggtaggagttcccat 540 |||||||||||||| ||||||||| || ||||| Sbjct: 831 tccaggccaatcctgctcggtaggtgtccccat 799
>ref|XM_568695.1| Cryptococcus neoformans var. neoformans JEC21 cyclin-dependent protein kinase (CNN01700) partial mRNA Length = 1403 Score = 42.1 bits (21), Expect = 2.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 508 tccaggccaatcctcctcggtaggagttcccat 540 |||||||||||||| ||||||||| || ||||| Sbjct: 913 tccaggccaatcctgctcggtaggtgtccccat 881
>ref|XM_762530.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_576_19385_20311) partial mRNA Length = 927 Score = 42.1 bits (21), Expect = 2.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 607 catctcggcaaagatgcatccaatggaccaaat 639 ||||||||| |||||||| ||||||||||||| Sbjct: 630 catctcggcccagatgcatgcaatggaccaaat 598
>ref|XM_738156.1| Plasmodium chabaudi chabaudi cell division control protein (PC000220.01.0) partial mRNA Length = 867 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 605 accatctcggcaaagatgcatccaa 629 |||||||||||||| |||||||||| Sbjct: 584 accatctcggcaaatatgcatccaa 560
>emb|AL034425.9|HS542H21 Human DNA sequence from clone RP4-542H21 on chromosome 20p11.21-12.1 Contains part of the SLC24A3 gene for solute carrier family 24 (sodium/potassium/calcium exchanger) member 3, complete sequence Length = 116732 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 542 agcctgaaaatgtgaagcagt 562 ||||||||||||||||||||| Sbjct: 83831 agcctgaaaatgtgaagcagt 83851
>emb|BX294026.1|NCB7H23 Neurospora crassa DNA linkage group V BAC contig B7H23 Length = 114377 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 84 gaagaacaagcatcttcagcc 104 ||||||||||||||||||||| Sbjct: 85105 gaagaacaagcatcttcagcc 85125
>gb|AC110607.7| Homo sapiens chromosome 15, clone CTD-2632K10, complete sequence Length = 160452 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 483 cgtgccagtccctcagagcag 503 ||||||||||||||||||||| Sbjct: 156365 cgtgccagtccctcagagcag 156345
>gb|AC046168.12| Homo sapiens chromosome 15, clone RP11-307C19, complete sequence Length = 180484 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 483 cgtgccagtccctcagagcag 503 ||||||||||||||||||||| Sbjct: 121183 cgtgccagtccctcagagcag 121203
>ref|NM_057449.3| Drosophila melanogaster cdc2 CG5363-RA (cdc2), mRNA Length = 1083 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 678 ccatctccgcgaatatgcatccaatggaccagatatc 642
>gb|AY061450.1| Drosophila melanogaster LD38718 full length cDNA Length = 1051 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 628 ccatctccgcgaatatgcatccaatggaccagatatc 592
>gb|S66810.1| cdc2 (cdc2E1-9)=cdc2-like kinase {C to T substitution at residue 1209} [Drosophila melanogaster, Genomic Mutant, 1466 nt] Length = 1466 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 1020 ccatctccgcgaatatgcatccaatggaccagatatc 984
>gb|S66807.1| cdc2 (cdc2E1-23)=cdc2-like kinase {G to A substitution at residue 1045} [Drosophila melanogaster, Genomic Mutant, 1466 nt] Length = 1466 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 1020 ccatctccgcgaatatgcatccaatggaccagatatc 984
>gb|S66804.1| cdc2 (cdc2D57)=cdc2c-like kinase {G to A substitution at residue 870} [Drosophila melanogaster, Genomic Mutant, 1466 nt] Length = 1466 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 1020 ccatctccgcgaatatgcatccaatggaccagatatc 984
>gb|S66801.1| cdc2 (cdc2216A)=cdc2-like kinase {C to T substitution at residue 862} [Drosophila melanogaster, Genomic Mutant, 1466 nt] Length = 1466 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 1020 ccatctccgcgaatatgcatccaatggaccagatatc 984
>gb|AC092237.1|AC092237 Drosophila melanogaster, chromosome 2L, region 31C-31D, BAC clone BACR30M19, complete sequence Length = 154779 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 16083 ccatctccgcgaatatgcatccaatggaccagatatc 16047
>gb|AY091645.1| Giardia intestinalis Cdc2 gene, complete cds Length = 1072 Score = 42.1 bits (21), Expect = 2.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 607 catctcggcaaagatgcatccaatggaccaaat 639 ||||||||| |||||||| ||||||||||||| Sbjct: 733 catctcggcccagatgcatgcaatggaccaaat 701
>gb|AF129886.1|AF129886 Vigna radiata cell division control protein 2 mRNA, partial cds Length = 1006 Score = 42.1 bits (21), Expect = 2.4 Identities = 36/41 (87%) Strand = Plus / Minus Query: 605 accatctcggcaaagatgcatccaatggaccaaatatcaac 645 |||||||| ||||| |||||||| | |||||||||||||| Sbjct: 563 accatctctgcaaatatgcatcccactgaccaaatatcaac 523
>gb|AF126737.1|AF126737 Phaseolus vulgaris cell division control protein 2 mRNA, partial cds Length = 1006 Score = 42.1 bits (21), Expect = 2.4 Identities = 36/41 (87%) Strand = Plus / Minus Query: 605 accatctcggcaaagatgcatccaatggaccaaatatcaac 645 |||||||| ||||| |||||||| | |||||||||||||| Sbjct: 563 accatctctgcaaatatgcatcccactgaccaaatatcaac 523
>gb|AC007451.1|AC007451 Drosophila melanogaster, chromosome 2L, region 31D1-31F4, BAC clones DS00953 and BACR48K04, complete sequence Length = 161754 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Plus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 45048 ccatctccgcgaatatgcatccaatggaccagatatc 45084
>gb|AE003628.2| Drosophila melanogaster chromosome 2L, section 37 of 83 of the complete sequence Length = 269102 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Plus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 147316 ccatctccgcgaatatgcatccaatggaccagatatc 147352
>emb|X57485.1|DMCDC2P24 D.melanogaster cdc2 mRNA for p34-cdc2 homologue, involved in cell cycle control Length = 1042 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 637 ccatctccgcgaatatgcatccaatggaccagatatc 601
>emb|X57496.1|DMCDC2 D.melanogaster mRNA CDC2 involved in cell cycle control Length = 1067 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatc 642 ||||||| || || ||||||||||||||||| ||||| Sbjct: 647 ccatctccgcgaatatgcatccaatggaccagatatc 611
>gb|M93140.1|SOYP34CDCB Glycine max cv Prize protein kinase mRNA Length = 1216 Score = 42.1 bits (21), Expect = 2.4 Identities = 36/41 (87%) Strand = Plus / Minus Query: 605 accatctcggcaaagatgcatccaatggaccaaatatcaac 645 |||||||| ||||| |||||||| | |||||||||||||| Sbjct: 748 accatctctgcaaatatgcatcccactgaccaaatatcaac 708
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence Length = 2090491 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 605 accatctcggcaaagatgca 624 |||||||||||||||||||| Sbjct: 1313617 accatctcggcaaagatgca 1313598
>ref|XM_457444.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0B11528g) partial mRNA Length = 2604 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 620 atgcatccaatggaccaaatatca 643 ||||||||||| |||||||||||| Sbjct: 2153 atgcatccaattgaccaaatatca 2130
>gb|AC154581.2| Mus musculus BAC clone RP23-381G5 from chromosome 13, complete sequence Length = 200156 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 562 ttgctgtaactcagagtcac 581 |||||||||||||||||||| Sbjct: 67015 ttgctgtaactcagagtcac 67034
>ref|XM_838331.1| Leishmania major strain Friedlin hypothetical protein (LMJ_1248) partial mRNA Length = 2709 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 605 accatctcggcaaagatgca 624 |||||||||||||||||||| Sbjct: 167 accatctcggcaaagatgca 186
>gb|AC133189.3| Mus musculus BAC clone RP23-354M9 from chromosome 15, complete sequence Length = 198577 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ttctgtttccagtgttggga 443 |||||||||||||||||||| Sbjct: 46836 ttctgtttccagtgttggga 46817
>gb|AC122407.4| Mus musculus BAC clone RP24-129G24 from chromosome 12, complete sequence Length = 137860 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 cacggggttgctgggtgtag 202 |||||||||||||||||||| Sbjct: 37940 cacggggttgctgggtgtag 37921
>gb|AC138133.26| Medicago truncatula clone mth2-9o2, complete sequence Length = 149166 Score = 40.1 bits (20), Expect = 9.3 Identities = 26/28 (92%) Strand = Plus / Plus Query: 617 aagatgcatccaatggaccaaatatcaa 644 ||||||||||||| |||||| ||||||| Sbjct: 119554 aagatgcatccaagggaccagatatcaa 119581
>gb|AC126790.38| Medicago truncatula clone mth2-10d14, complete sequence Length = 127447 Score = 40.1 bits (20), Expect = 9.3 Identities = 26/28 (92%) Strand = Plus / Plus Query: 617 aagatgcatccaatggaccaaatatcaa 644 ||||||||||||| |||||| ||||||| Sbjct: 69908 aagatgcatccaagggaccagatatcaa 69935
>emb|CR450710.5| Zebrafish DNA sequence from clone CH211-197O6 in linkage group 2, complete sequence Length = 201624 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 617 aagatgcatccaatggacca 636 |||||||||||||||||||| Sbjct: 177133 aagatgcatccaatggacca 177114
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 604 gaccatctcggcaaagatgc 623 |||||||||||||||||||| Sbjct: 3883603 gaccatctcggcaaagatgc 3883584
>ref|XM_504383.1| Yarrowia lipolytica CLIB122, YALI0E25135g predicted mRNA Length = 1161 Score = 40.1 bits (20), Expect = 9.3 Identities = 32/36 (88%) Strand = Plus / Minus Query: 607 catctcggcaaagatgcatccaatggaccaaatatc 642 ||||||||| |||||||| || ||||||||||||| Sbjct: 621 catctcggcgaagatgcagcccgtggaccaaatatc 586
>emb|AL356796.16| Human DNA sequence from clone RP11-82I1 on chromosome 9 Contains the 3' end of a novel gene (FLJ11985, MGC11337) (KIAA0870), the ORM1 gene for orosomucoid 1 (AGP1, AGP-A), the ORM2 gene for orosomucoid 2 (AGP2, AGP-B) and the gene for AT-hook transcription factor AKNA, complete sequence Length = 125673 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gagtcaccagggaaaagagcctgt 598 |||||||||||||| ||||||||| Sbjct: 38808 gagtcaccagggaagagagcctgt 38785
>emb|CR382134.1| Debaryomyces hansenii chromosome B of strain CBS767 of Debaryomyces hansenii Length = 1349926 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 620 atgcatccaatggaccaaatatca 643 ||||||||||| |||||||||||| Sbjct: 889655 atgcatccaattgaccaaatatca 889678
>emb|AL691481.15| Mouse DNA sequence from clone RP23-173C3 on chromosome 4 Contains a non-neuron enolase 1 alpha (Eno1) pseudogene, a mitochondrial H+ transporting ATP synthase F0 complex subunit d (Atp5h) pseudogene and a CpG island, complete sequence Length = 230127 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 548 aaaatgtgaagcagttgctg 567 |||||||||||||||||||| Sbjct: 28894 aaaatgtgaagcagttgctg 28913
>dbj|AB063283.1| Phormidium lapideum aspC gene for aspartate aminotransferase, complete cds Length = 1631 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 350 tgctctagcgcggctttggc 369 |||||||||||||||||||| Sbjct: 615 tgctctagcgcggctttggc 596
>gb|AC016136.21| Homo sapiens 12 BAC RP11-1036M20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 176704 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 571 ctcagagtcaccagggaaaa 590 |||||||||||||||||||| Sbjct: 108650 ctcagagtcaccagggaaaa 108631
>ref|NM_001038795.1| Drosophila melanogaster CG8683-PA (CG8683) mRNA, complete cds Length = 5772 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 118 acaaatcacctgctggaggt 137 |||||||||||||||||||| Sbjct: 2543 acaaatcacctgctggaggt 2562
>gb|AC090281.8| Homo sapiens chromosome 8, clone RP5-1009N12, complete sequence Length = 114875 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 526 ggtaggagttcccatcagcc 545 |||||||||||||||||||| Sbjct: 8559 ggtaggagttcccatcagcc 8540
>gb|AC008066.4| Homo sapiens BAC clone RP11-293D9 from 8, complete sequence Length = 174347 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 526 ggtaggagttcccatcagcc 545 |||||||||||||||||||| Sbjct: 173526 ggtaggagttcccatcagcc 173545
>gb|AC152059.4| Mus musculus BAC clone RP24-283B23 from chromosome 12, complete sequence Length = 180085 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 cacggggttgctgggtgtag 202 |||||||||||||||||||| Sbjct: 55958 cacggggttgctgggtgtag 55977
>gb|AC007696.5|AC007696 Drosophila melanogaster, chromosome 2L, region 28B, BAC clone BACR14I17, complete sequence Length = 157948 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 118 acaaatcacctgctggaggt 137 |||||||||||||||||||| Sbjct: 32505 acaaatcacctgctggaggt 32486
>gb|AY083747.1| Pinus densata clone Pd-t603 5S ribosomal RNA gene and nontranscribed spacer region, complete sequence Length = 728 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 580 accagggaaaagagcctgtt 599 |||||||||||||||||||| Sbjct: 304 accagggaaaagagcctgtt 285
>gb|AC009090.12| Homo sapiens chromosome 16 clone RP11-407G23, complete sequence Length = 198253 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 479 aactcgtgccagtccctcag 498 |||||||||||||||||||| Sbjct: 189663 aactcgtgccagtccctcag 189644
>gb|AC069550.4|AC069550 Sequence of chromosome 2 clone RP11-471B2 containing Homo sapiens NRXNI gene, partial cds, complete sequence Length = 166054 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 281 agttgagagaaatcacacgg 300 |||||||||||||||||||| Sbjct: 111423 agttgagagaaatcacacgg 111404
>gb|AC093008.10| Homo sapiens 3 BAC RP11-663C11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 187889 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 50 gtacagagcaaataaaaaatcttc 73 ||||||||||||||||||| |||| Sbjct: 173270 gtacagagcaaataaaaaaacttc 173293
>gb|AC068764.18| Homo sapiens 3 BAC RP11-138E24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 183965 Score = 40.1 bits (20), Expect = 9.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 50 gtacagagcaaataaaaaatcttc 73 ||||||||||||||||||| |||| Sbjct: 48640 gtacagagcaaataaaaaaacttc 48663
>gb|AC023825.8| Homo sapiens chromosome 16 clone RP11-322D14, complete sequence Length = 217521 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 479 aactcgtgccagtccctcag 498 |||||||||||||||||||| Sbjct: 105344 aactcgtgccagtccctcag 105325
>emb|BX537162.5| Zebrafish DNA sequence from clone DKEY-9A20 in linkage group 4, complete sequence Length = 223816 Score = 40.1 bits (20), Expect = 9.3 Identities = 26/28 (92%) Strand = Plus / Minus Query: 614 gcaaagatgcatccaatggaccaaatat 641 |||||||||||| |||| |||||||||| Sbjct: 130625 gcaaagatgcattcaattgaccaaatat 130598
>gb|AY106029.1| Zea mays PCO078926 mRNA sequence Length = 1194 Score = 40.1 bits (20), Expect = 9.3 Identities = 80/100 (80%) Strand = Plus / Minus Query: 546 tgaaaatgtgaagcagttgctgtaactcagagtcaccagggaaaagagcctgttttctga 605 |||| ||||| || || ||||| ||||| ||||| ||||||||||| | ||| || | | Sbjct: 779 tgaagatgtggaggagctgctgcaactcggagtcgccagggaaaagtggctgattagtaa 720 Query: 606 ccatctcggcaaagatgcatccaatggaccaaatatcaac 645 ||| ||| ||||| ||||| || | ||||||||| ||||| Sbjct: 719 ccaactcagcaaatatgcagcccacggaccaaatgtcaac 680
>emb|CT573071.1| Kuenenia stuttgartiensis genome fragment KUST_E (5 of 5) Length = 2199546 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 578 tcaccagggaaaagagcctg 597 |||||||||||||||||||| Sbjct: 525855 tcaccagggaaaagagcctg 525874
>gb|AE003620.3| Drosophila melanogaster chromosome 2L, section 29 of 83 of the complete sequence Length = 251142 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 118 acaaatcacctgctggaggt 137 |||||||||||||||||||| Sbjct: 10237 acaaatcacctgctggaggt 10218
>emb|CT009754.11| Mouse DNA sequence from clone RP23-5P19 on chromosome 13, complete sequence Length = 255133 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 562 ttgctgtaactcagagtcac 581 |||||||||||||||||||| Sbjct: 166770 ttgctgtaactcagagtcac 166751
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 40.1 bits (20), Expect = 9.3 Identities = 32/36 (88%) Strand = Plus / Plus Query: 607 catctcggcaaagatgcatccaatggaccaaatatc 642 ||||||||| |||||||| || ||||||||||||| Sbjct: 3010048 catctcggcgaagatgcagcccgtggaccaaatatc 3010083 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,579,975 Number of Sequences: 3902068 Number of extensions: 6579975 Number of successful extensions: 118447 Number of sequences better than 10.0: 133 Number of HSP's better than 10.0 without gapping: 133 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 118065 Number of HSP's gapped (non-prelim): 364 length of query: 683 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 660 effective length of database: 17,143,297,704 effective search space: 11314576484640 effective search space used: 11314576484640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)