>ref|XM_550309.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1998

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 486  tgaacggcatttgaatggacctgaaggtgtctttcttcacgatggct 532
            |||| ||| |||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 1958 tgaatggcgtttgaatgcacctgcaggtgcctttcttcacggtggct 1912

>gb|DQ421408.1| Oryza sativa (japonica cultivar-group) boron transporter (BOR2) mRNA,
            complete cds
          Length = 2019

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 486  tgaacggcatttgaatggacctgaaggtgtctttcttcacgatggct 532
            |||| ||| |||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 1979 tgaatggcgtttgaatgcacctgcaggtgcctttcttcacggtggct 1933

>gb|AC163436.3| Mus musculus chromosome 1, clone RP23-102H12, complete sequence
          Length = 198253

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 500    atggacctgaaggtgtctttct 521
              ||||||||||||||||||||||
Sbjct: 115833 atggacctgaaggtgtctttct 115812

>gb|AC102900.12| Mus musculus chromosome 1, clone RP24-315J13, complete sequence
          Length = 192545

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 500   atggacctgaaggtgtctttct 521
             ||||||||||||||||||||||
Sbjct: 81362 atggacctgaaggtgtctttct 81341

>gb|AC174384.2| Gallus gallus BAC clone CH261-128H23 from chromosome ul, complete
            sequence
          Length = 206900

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 175  aacagaacaaagccaggcacac 196
            ||||||||||||||||||||||
Sbjct: 7414 aacagaacaaagccaggcacac 7393

>gb|AC116327.4| Mus musculus BAC clone RP24-68L14 from 7, complete sequence
          Length = 194290

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 576   tccaatatctcagcgtcaatcctgc 600
             ||||||||||||| |||||||||||
Sbjct: 20297 tccaatatctcagtgtcaatcctgc 20273

>gb|AC182752.1| Gasterosteus aculeatus clone VMRC26-161K14, complete sequence
          Length = 162574

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 424   tagaatcattgatgaaatcct 444
             |||||||||||||||||||||
Sbjct: 91049 tagaatcattgatgaaatcct 91069

>gb|AC007175.1|AC007175 Drosophila melanogaster, chromosome 2R, region 57D3-57E2, BAC clones
             DS01261 and BACR48K03, complete sequence
          Length = 188633

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 188   caggcacacaagcaacaacag 208
             |||||||||||||||||||||
Sbjct: 98957 caggcacacaagcaacaacag 98977

>gb|AE003453.3| Drosophila melanogaster chromosome 2R, section 61 of 73 of the complete
              sequence
          Length = 305143

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 188    caggcacacaagcaacaacag 208
              |||||||||||||||||||||
Sbjct: 267354 caggcacacaagcaacaacag 267374

>gb|AC126049.3| Mus musculus BAC clone RP23-224I16 from 1, complete sequence
          Length = 224972

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    agaacaaagccaggcacacaa 198
              |||||||||||||||||||||
Sbjct: 157931 agaacaaagccaggcacacaa 157911

>emb|AL929275.8| Mouse DNA sequence from clone RP23-65P13 on chromosome 2, complete
             sequence
          Length = 197356

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 215   gagggacagttttcctccaatacca 239
             |||||||||||||||||||| ||||
Sbjct: 78098 gagggacagttttcctccaaaacca 78074

>gb|AC162528.5| Mus musculus BAC clone RP23-4P1 from chromosome 5, complete sequence
          Length = 219218

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 168   acactcaaacagaacaaagc 187
             ||||||||||||||||||||
Sbjct: 72702 acactcaaacagaacaaagc 72683

>gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosome 5, complete sequence
          Length = 206735

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 168    acactcaaacagaacaaagc 187
              ||||||||||||||||||||
Sbjct: 200685 acactcaaacagaacaaagc 200704

>gb|AE013121.1| Thermoanaerobacter tengcongensis MB4, section 148 of 244 of the
            complete genome
          Length = 12232

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 492  gcatttgaatggacctgaag 511
            ||||||||||||||||||||
Sbjct: 1561 gcatttgaatggacctgaag 1542

>gb|AC142146.3| Mus musculus BAC clone RP24-74D8 from chromosome 9, complete sequence
          Length = 170429

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 607    agcttcctgaaatggagcca 626
              ||||||||||||||||||||
Sbjct: 165447 agcttcctgaaatggagcca 165428

>emb|CT025568.7| Mouse DNA sequence from clone RP23-374L19 on chromosome 9, complete
             sequence
          Length = 183916

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 607   agcttcctgaaatggagcca 626
             ||||||||||||||||||||
Sbjct: 96443 agcttcctgaaatggagcca 96462

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 101     ccggtagttggtggcgggga 120
               ||||||||||||||||||||
Sbjct: 2358154 ccggtagttggtggcgggga 2358135

>gb|AF322256.1| Streptomyces antibioticus simocyclinone biosynthetic gene cluster,
             partial sequence
          Length = 39428

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    cttcaccggcgaacccgtgg 80
             ||||||||||||||||||||
Sbjct: 11109 cttcaccggcgaacccgtgg 11128

>gb|AF324838.1| Streptomyces antibioticus simocyclinone biosynthetic gene cluster,
             partial sequence
          Length = 34869

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    cttcaccggcgaacccgtgg 80
             ||||||||||||||||||||
Sbjct: 15393 cttcaccggcgaacccgtgg 15412

>gb|AC118632.7| Mus musculus chromosome 18, clone RP24-94D24, complete sequence
          Length = 198636

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 614   tgaaatggagccatcttcct 633
             ||||||||||||||||||||
Sbjct: 99552 tgaaatggagccatcttcct 99533

>ref|NM_001007502.1| Xenopus tropicalis oit1 protein (oit1), mRNA
          Length = 1742

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 206  cagatcacagagggacagtt 225
            ||||||||||||||||||||
Sbjct: 1607 cagatcacagagggacagtt 1626

>gb|BC079939.1| Xenopus tropicalis oit1 protein, mRNA (cDNA clone MGC:79616
            IMAGE:6979723), complete cds
          Length = 1742

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 206  cagatcacagagggacagtt 225
            ||||||||||||||||||||
Sbjct: 1607 cagatcacagagggacagtt 1626

>emb|AL513475.13| Human DNA sequence from clone RP11-277I20 on chromosome 6 Contains part
             of the UTRN gene for utrophin (homologous to dystrophin)
             (DRP, DRP1, DMDL), a novel pseudogene similar to
             hypothetical protein HT023 and a novel pseudogene,
             complete sequence
          Length = 191752

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 310   gctacctgtcttatggaaag 329
             ||||||||||||||||||||
Sbjct: 90018 gctacctgtcttatggaaag 90037

>emb|AL158831.15| Human DNA sequence from clone RP11-564A4 on chromosome 9, complete
              sequence
          Length = 162700

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 627    tcttcctccaatgtgtgttc 646
              ||||||||||||||||||||
Sbjct: 114958 tcttcctccaatgtgtgttc 114977

>emb|AL604065.7| Mouse DNA sequence from clone RP23-20M18 on chromosome 11 Contains the
             genes for olfactory receptors MOR255-4, -5, -6 and
             MOR125-1, the Olfr43 gene for olfactory receptor 43, six
             olfactory receptor pseudogenes, the Olfr59 gene for
             olfactory receptor 59, a glyceraldehyde-3-phosphate
             dehydrogenase (Gapd) pseudogene, the gene for a novel
             olfactory receptor, the 3' end of the gene for a novel
             protein similar to human RAP1 GTPase activating protein 1
             RAP1GA1 and two CpG islands, complete sequence
          Length = 254938

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 623   gccatcttcctccaatgtgt 642
             ||||||||||||||||||||
Sbjct: 47951 gccatcttcctccaatgtgt 47970

>dbj|AK220411.1| Mus musculus mRNA for mKIAA1671 protein
          Length = 5058

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  acactcaaacagaacaaagc 187
            ||||||||||||||||||||
Sbjct: 2646 acactcaaacagaacaaagc 2665

>dbj|AK154484.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630038N22
            product:hypothetical Serine-rich region profile
            containing protein, full insert sequence
          Length = 4403

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  acactcaaacagaacaaagc 187
            ||||||||||||||||||||
Sbjct: 3240 acactcaaacagaacaaagc 3259

>dbj|AK171617.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F730320A09
            product:hypothetical Serine-rich region profile
            containing protein, full insert sequence
          Length = 3965

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  acactcaaacagaacaaagc 187
            ||||||||||||||||||||
Sbjct: 3200 acactcaaacagaacaaagc 3219

>emb|CR760189.2| Xenopus tropicalis finished cDNA, clone TNeu126o21
          Length = 1743

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 206  cagatcacagagggacagtt 225
            ||||||||||||||||||||
Sbjct: 1604 cagatcacagagggacagtt 1623

>emb|AL808112.34| Mouse DNA sequence from clone RP23-57N22 on chromosome 4, complete
             sequence
          Length = 236158

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 177   cagaacaaagccaggcacac 196
             ||||||||||||||||||||
Sbjct: 91922 cagaacaaagccaggcacac 91903


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,439,599
Number of Sequences: 3902068
Number of extensions: 5439599
Number of successful extensions: 106115
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 106045
Number of HSP's gapped (non-prelim): 70
length of query: 681
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 658
effective length of database: 17,143,297,704
effective search space: 11280289889232
effective search space used: 11280289889232
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)