ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal6j23
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF325196.1|AF325196 Triticum aestivum PST19 (Pst19), LRR19 (L... 94 4e-16
2gb|AF548379.1| Aegilops tauschii isoamylase gene, complete cds 78 3e-11
3gb|AF532104.1|AF532104S1 Aegilops tauschii strain TA1649 cosmid ... 70 6e-09
4gb|AY951945.1| Triticum monococcum TmBAC 60J11 FR-Am2 locus, gen... 70 6e-09
5gb|BT009606.1| Triticum aestivum clone wre1n.pk0091.d5:fis, full... 66 1e-07
6gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete se... 64 4e-07
7gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, comple... 62 1e-06
8gb|AF474072.1| Hordeum vulgare sp. vulgare cultivar Morex BAC cl... 56 9e-05
9gb|BT009083.1| Triticum aestivum clone wkm1c.pk0004.c7:fis, full... 56 9e-05
10gb|AY485643.1| Hordeum vulgare subsp. vulgare BAC 615K1, complet... 54 4e-04
11gb|AF459085.1| Hordeum vulgare SNF2P (Snf2P) gene, complete cds 54 4e-04
12dbj|AB095006.1| Triticum aestivum Wcor15 gene for chloroplast-ta... 54 4e-04
13gb|L41869.1|BLYBGQ6 Hordeum vulgare L. beta-glucosidase (BGQ60) ... 54 4e-04
14gb|AY029159.1| Triticum aestivum sucrose-6F-phosphate phosphohyd... 52 0.001
15gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxyl... 50 0.006
16gb|AY146587.1| Triticum turgidum subsp. durum BAC 107G22, comple... 50 0.006
17emb|CR626933.1| Triticum turgidum 42 1.4
18emb|CR626929.1| Triticum aestivum 42 1.4
19gb|AC123801.4| Mus musculus BAC clone RP24-374A1 from chromosome... 42 1.4
20gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, comple... 42 1.4
21gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, ... 42 1.4
22emb|BX276117.5| Zebrafish DNA sequence from clone CH211-112K18 i... 42 1.4
23gb|AC155237.2| Mus musculus BAC clone RP24-439K11 from 14, compl... 42 1.4
24gb|AC153728.1| Mus musculus BAC RP23-83N17 (Roswell Park Cancer... 40 5.5
25gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14... 40 5.5
26gb|AC108399.11| Mus musculus chromosome 19, clone RP24-375O7, co... 40 5.5
27gb|AC122446.4| Mus musculus BAC clone RP24-240N12 from chromosom... 40 5.5
28gb|AC005022.1| Homo sapiens BAC clone GS1-371A6 from 7, complete... 40 5.5
29gb|AC083893.33| Mus musculus strain C57BL/6J clone rp23-21l18 ma... 40 5.5
30gb|AC139034.7| Mus musculus chromosome 6, clone RP23-350J11, com... 40 5.5
31gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome 40 5.5
32emb|BX640496.10| Mouse DNA sequence from clone RP23-379O23 on ch... 40 5.5
33gb|AC164576.4| Mus musculus 10 BAC RP23-50F14 (Roswell Park Canc... 40 5.5
34dbj|AK143095.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 40 5.5
35gb|CP000236.1| Ehrlichia chaffeensis str. Arkansas, complete genome 40 5.5
36gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g... 40 5.5
37gb|AY251843.1| Euhadra peliomphala pel1 12S ribosomal RNA gene, ... 40 5.5
38gb|AC153485.9| Mus musculus 10 BAC RP23-319B13 (Roswell Park Can... 40 5.5
39gb|AC154346.3| Mus musculus BAC clone RP24-503E4 from chromosome... 40 5.5
40gb|AC145909.3| Gallus gallus BAC clone CH261-43H20 from chromoso... 40 5.5
41gb|AC132480.5| Mus musculus BAC clone RP23-11I14 from 6, complet... 40 5.5 
>gb|AF325196.1|AF325196 Triticum aestivum PST19 (Pst19), LRR19 (Lrr19), TAK19-1 (Tak19-1), and
             LRK19 (Lrk19) genes, complete cds
          Length = 35872

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 55/58 (94%)
 Strand = Plus / Minus

                                                                       
Query: 165   tacttgtcgcataaatggataaaaatgaatgtntctagaattaaaatacgtctagata 222
             ||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||
Sbjct: 33721 tacttgtcgcataaatggataaaaatggatgtatctagaattaaaatacatctagata 33664
to top
>gb|AF548379.1| Aegilops tauschii isoamylase gene, complete cds
          Length = 9643

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                      
Query: 165  tacttgtcgcataaatggataaaaatgaatgtntctagaattaaaatacgtctagata 222
            ||||||| ||| ||||||||||||||| |||| ||||||| |||||||||||||||||
Sbjct: 6069 tacttgttgcagaaatggataaaaatggatgtatctagaactaaaatacgtctagata 6012
to top
>gb|AF532104.1|AF532104S1 Aegilops tauschii strain TA1649 cosmid 69-7-1 Lr21 gene, complete cds;
             and unknown gene
          Length = 27960

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                           
Query: 177   aaatggataaaaatgaatgtntctagaattaaaatacgtctagata 222
             ||||||||||||| |||||| |||||||||||||||| ||||||||
Sbjct: 14852 aaatggataaaaaagaatgtatctagaattaaaatacatctagata 14897
to top
>gb|AY951945.1| Triticum monococcum TmBAC 60J11 FR-Am2 locus, genomic sequence
          Length = 103866

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                           
Query: 177   aaatggataaaaatgaatgtntctagaattaaaatacgtctagata 222
             |||||||||||||||||||| ||||||| |||||||| ||||||||
Sbjct: 36520 aaatggataaaaatgaatgtatctagaactaaaatacatctagata 36565



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 165   tacttgtcgcataaatggataaaaatgaatgtntctagaattaaaatac 213
             ||||||||||| ||||||||| ||||| |||| ||||||| ||||||||
Sbjct: 93560 tacttgtcgcagaaatggatataaatggatgtatctagaactaaaatac 93512
to top
>gb|BT009606.1| Triticum aestivum clone wre1n.pk0091.d5:fis, full insert mRNA
            sequence
          Length = 1469

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                        
Query: 156  gttctaaantacttgtcgcataaatggataaaaatgaatgtntctagaattaaaatacgt 215
            |||| ||| |||| ||| || ||||||||||||||| |||| |||| ||||||||||| |
Sbjct: 1310 gttcgaaattactcgtcacaaaaatggataaaaatggatgtatctacaattaaaatacat 1251

                   
Query: 216  ctagata 222
            |||||||
Sbjct: 1250 ctagata 1244
to top
>gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete sequence
          Length = 285506

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                     
Query: 165    tacttgtcgcataaatggataaaaatgaatgtntctagaattaaaatacgtctag 219
              ||||||||| | ||||| ||||||||| |||| ||||||| ||||||||||||||
Sbjct: 196615 tacttgtcggagaaatgcataaaaatggatgtatctagaactaaaatacgtctag 196669
to top
>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence
          Length = 124050

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                       
Query: 165   tacttgtcgcataaatggataaaaatgaatgtntctagaattaaaatacgtctagata 222
             |||||||| || ||||||||||||||| || | ||||||| |||||||| ||||||||
Sbjct: 52157 tacttgtcacacaaatggataaaaatggatatatctagaactaaaatacatctagata 52214
to top
>gb|AF474072.1| Hordeum vulgare sp. vulgare cultivar Morex BAC clone 773k14, complete
              sequence
          Length = 113510

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                 
Query: 177    aaatggataaaaatgaatgtntctagaattaaaat 211
              ||||| |||||||||||||| ||||||||||||||
Sbjct: 104641 aaatgtataaaaatgaatgtatctagaattaaaat 104675
to top
>gb|BT009083.1| Triticum aestivum clone wkm1c.pk0004.c7:fis, full insert mRNA
           sequence
          Length = 1186

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/59 (88%), Gaps = 1/59 (1%)
 Strand = Plus / Plus

                                                                      
Query: 165 tacttgtcgcataaatggataaaaatgaatgtntctagaa-ttaaaatacgtctagata 222
           ||||||||| | |||||| ||||||||||||| ||||||| | ||||||||| ||||||
Sbjct: 886 tacttgtcgtagaaatgggtaaaaatgaatgtatctagaactaaaaatacgtttagata 944
to top
>gb|AY485643.1| Hordeum vulgare subsp. vulgare BAC 615K1, complete sequence
          Length = 114996

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                           
Query: 177   aaatggataaaaatgaatgtntctagaattaaaatacgtctagata 222
             ||||||| | ||||| |||| ||||||| |||||||||||||||||
Sbjct: 69880 aaatggaaagaaatggatgtatctagaactaaaatacgtctagata 69835
to top
>gb|AF459085.1| Hordeum vulgare SNF2P (Snf2P) gene, complete cds
          Length = 7963

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                          
Query: 177  aaatggataaaaatgaatgtntctagaattaaaatacgtctagata 222
            ||||||| | ||||| |||| ||||||| |||||||||||||||||
Sbjct: 1832 aaatggaaagaaatggatgtatctagaactaaaatacgtctagata 1787
to top
>dbj|AB095006.1| Triticum aestivum Wcor15 gene for chloroplast-targeted COR protein,
            complete cds
          Length = 4549

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 165  tacttgtcgcataaatggataaaaatgaatgtntctagaattaaaatacgtcta 218
            ||||||||| | ||| ||||||||||| |||| | ||||| |||||||||||||
Sbjct: 1972 tacttgtcggagaaacggataaaaatggatgtatgtagaactaaaatacgtcta 2025
to top
>gb|L41869.1|BLYBGQ6 Hordeum vulgare L. beta-glucosidase (BGQ60) gene, complete cds
          Length = 4152

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                      
Query: 165  tacttgtcgcataaatggataaaaatgaatgtntctagaattaaaatacgtctagata 222
            ||||||||||| ||||| ||| ||||| |||| |||| || |||||||| ||||||||
Sbjct: 3111 tacttgtcgcaaaaatgaatagaaatggatgtatctataactaaaatacatctagata 3054
to top
>gb|AY029159.1| Triticum aestivum sucrose-6F-phosphate phosphohydrolase SPP3 mRNA,
            complete cds
          Length = 1743

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 168  ttgtcgcataaatggataaaaatgaatgtntct 200
            |||||||| |||||||||||||||||||| |||
Sbjct: 1700 ttgtcgcaaaaatggataaaaatgaatgtatct 1668
to top
>gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxylase, ZCCT2, ZCCT1, and
              SNF2P genes, complete cds; nucellin pseudogene, complete
              sequence; putative transposase, phosphatidylinositol
              phosphatidylcholine transfer protein sec14 cytosolic-like
              protein, and phytochrome P450-like protein genes, complete
              cds; and unknown genes
          Length = 438828

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 169    tgtcgcataaatggataaaaatgaatgtntctagaattaaaatacgtctaga 220
              ||||||| |||||||||||| || |||| |||| || ||||||||| |||||
Sbjct: 116814 tgtcgcagaaatggataaaactggatgtatctaaaactaaaatacgcctaga 116865



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                           
Query: 177    aaatggataaaaatgaatgtntctagaattaaaatacgtctagat 221
              |||||||||||||||||||| | || || ||||  ||||||||||
Sbjct: 203652 aaatggataaaaatgaatgtgtataaaactaaagcacgtctagat 203696
to top
>gb|AY146587.1| Triticum turgidum subsp. durum BAC 107G22, complete sequence
          Length = 142018

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 187    aaatgaatgtntctagaattaaaatacgtctagata 222
              |||||||||| |||||||||||||||  ||||||||
Sbjct: 109515 aaatgaatgtatctagaattaaaataaatctagata 109480
to top
>emb|CR626933.1| Triticum turgidum
          Length = 25216

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 177  aaatggataaaaatgaatgtntctagaattaaaata 212
            |||||||||||| ||||||| | ||||| |||||||
Sbjct: 8893 aaatggataaaattgaatgtatttagaactaaaata 8858
to top
>emb|CR626929.1| Triticum aestivum
          Length = 20745

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 177   aaatggataaaaatgaatgtntctagaattaaaata 212
             |||||||||||||| ||||| | ||||| |||||||
Sbjct: 11607 aaatggataaaaataaatgtatttagaactaaaata 11572
to top
>gb|AC123801.4| Mus musculus BAC clone RP24-374A1 from chromosome 15, complete sequence
          Length = 150979

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 103   tgttaatacactgtttcatacaaac 127
             |||||||||| ||||||||||||||
Sbjct: 99492 tgttaatacagtgtttcatacaaac 99516
to top
>gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, complete sequence
          Length = 203855

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 103   tgttaatacactgtttcatacaaac 127
             |||||||||| ||||||||||||||
Sbjct: 34756 tgttaatacagtgtttcatacaaac 34780
to top
>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence
          Length = 439641

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 186    aaaatgaatgtntctagaattaaaatacgtctagat 221
              ||||||||||| ||||  ||||||||| ||||||||
Sbjct: 147740 aaaatgaatgtatctattattaaaataagtctagat 147705



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                         
Query: 186    aaaatgaatgtntctagaattaaaatacgtctagatatgtcta 228
              ||||||||||| ||||  ||||| ||| |||||||||| ||||
Sbjct: 147650 aaaatgaatgtatctattattaagataagtctagatatatcta 147608
to top
>emb|BX276117.5| Zebrafish DNA sequence from clone CH211-112K18 in linkage group 17,
             complete sequence
          Length = 181677

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 174   cataaatggataaaaatgaat 194
             |||||||||||||||||||||
Sbjct: 99954 cataaatggataaaaatgaat 99934
to top
>gb|AC155237.2| Mus musculus BAC clone RP24-439K11 from 14, complete sequence
          Length = 170906

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 214    gtctagatatgtctagacact 234
              |||||||||||||||||||||
Sbjct: 112561 gtctagatatgtctagacact 112541
to top
>gb|AC153728.1| Mus musculus  BAC RP23-83N17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 226417

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    taaatggataaaaatgaatg 195
              ||||||||||||||||||||
Sbjct: 109081 taaatggataaaaatgaatg 109062
to top
>gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14, complete sequence
          Length = 153766

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                     
Query: 184    taaaaatgaatgtntctagaattaaaatacgtctagata 222
              ||||||||| | | ||||||||||||| | |||||||||
Sbjct: 105048 taaaaatgattatatctagaattaaaacaagtctagata 105086
to top
>gb|AC108399.11| Mus musculus chromosome 19, clone RP24-375O7, complete sequence
          Length = 180312

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 179   atggataaaaatgaatgtntctagaat 205
             ||||| |||||||||||| ||||||||
Sbjct: 77364 atggaaaaaaatgaatgtatctagaat 77338
to top
>gb|AC122446.4| Mus musculus BAC clone RP24-240N12 from chromosome 17, complete
             sequence
          Length = 182820

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   aaatggataaaaatgaatgt 196
             ||||||||||||||||||||
Sbjct: 24362 aaatggataaaaatgaatgt 24381
to top
>gb|AC005022.1| Homo sapiens BAC clone GS1-371A6 from 7, complete sequence
          Length = 103565

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 95    aatatccttgttaatacactgttt 118
             ||||||||| ||||||||||||||
Sbjct: 63768 aatatcctttttaatacactgttt 63745
to top
>gb|AC083893.33| Mus musculus strain C57BL/6J clone rp23-21l18 map 4, complete sequence
          Length = 244349

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 177   aaatggataaaaatgaatgt 196
             ||||||||||||||||||||
Sbjct: 74230 aaatggataaaaatgaatgt 74211
to top
>gb|AC139034.7| Mus musculus chromosome 6, clone RP23-350J11, complete sequence
          Length = 247394

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   taaatggataaaaatgaatg 195
             ||||||||||||||||||||
Sbjct: 60008 taaatggataaaaatgaatg 59989
to top
>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 122     acaaacgtcccgaaatgcaggtcg 145
               |||||||| |||||||||||||||
Sbjct: 1640021 acaaacgtaccgaaatgcaggtcg 1639998
to top
>emb|BX640496.10| Mouse DNA sequence from clone RP23-379O23 on chromosome 4, complete
            sequence
          Length = 172320

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 177  aaatggataaaaatgaatgt 196
            ||||||||||||||||||||
Sbjct: 5322 aaatggataaaaatgaatgt 5341
to top
>gb|AC164576.4| Mus musculus 10 BAC RP23-50F14 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 205209

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   cataaatggataaaaatgaa 193
             ||||||||||||||||||||
Sbjct: 56006 cataaatggataaaaatgaa 56025
to top
>dbj|AK143095.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130020K17 product:unclassifiable, full
           insert sequence
          Length = 5403

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 taaatggataaaaatgaatg 195
           ||||||||||||||||||||
Sbjct: 713 taaatggataaaaatgaatg 732
to top
>gb|CP000236.1| Ehrlichia chaffeensis str. Arkansas, complete genome
          Length = 1176248

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 43     taaccctactacacctacag 62
              ||||||||||||||||||||
Sbjct: 361952 taaccctactacacctacag 361933
to top
>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 327     aagaaagatggatatccttg 346
               ||||||||||||||||||||
Sbjct: 2376968 aagaaagatggatatccttg 2376949
to top
>gb|AY251843.1| Euhadra peliomphala pel1 12S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 613

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 185 aaaaatgaatgtntctagaatta 207
           |||||||||||| ||||||||||
Sbjct: 28  aaaaatgaatgtatctagaatta 6
to top
>gb|AC153485.9| Mus musculus 10 BAC RP23-319B13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 213412

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    cataaatggataaaaatgaa 193
              ||||||||||||||||||||
Sbjct: 150530 cataaatggataaaaatgaa 150549
to top
>gb|AC154346.3| Mus musculus BAC clone RP24-503E4 from chromosome 17, complete sequence
          Length = 167603

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 177    aaatggataaaaatgaatgt 196
              ||||||||||||||||||||
Sbjct: 140945 aaatggataaaaatgaatgt 140964
to top
>gb|AC145909.3| Gallus gallus BAC clone CH261-43H20 from chromosome unknown, complete
             sequence
          Length = 213402

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 91    cagaaatatccttgttaata 110
             ||||||||||||||||||||
Sbjct: 22645 cagaaatatccttgttaata 22664
to top
>gb|AC132480.5| Mus musculus BAC clone RP23-11I14 from 6, complete sequence
          Length = 230313

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    taaatggataaaaatgaatg 195
              ||||||||||||||||||||
Sbjct: 177798 taaatggataaaaatgaatg 177817


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,581,607
Number of Sequences: 3902068
Number of extensions: 2581607
Number of successful extensions: 45933
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45847
Number of HSP's gapped (non-prelim): 86
length of query: 410
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 388
effective length of database: 17,147,199,772
effective search space: 6653113511536
effective search space used: 6653113511536
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top