ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal11l07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|S68729.1| LHC Ib-20=light-harvesting complex I [Hordeum vulga... 391 e-106
2gb|AF287276.1|AF287276 Hordeum vulgare chlorophyll a/b-binding p... 70 4e-09
3gb|AC019013.2|AC019013 Genomic Sequence For Arabidopsis thaliana... 46 0.052
4gb|AC007852.9| Drosophila melanogaster clone BACR33A10, complete... 42 0.81
5gb|AC007588.5| Drosophila melanogaster clone BACR30O03, complete... 42 0.81
6gb|BC036687.1| Homo sapiens cDNA clone IMAGE:5259465 42 0.81
7gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 42 0.81
8gb|AC159237.2| Mus musculus BAC clone RP24-464G10 from chromosom... 42 0.81
9gb|AC090883.1|AC090883 Homo sapiens chromosome 3 clone RP11-117G... 42 0.81
10gb|AF276663.1|AF276663 Drosophila melanogaster comb (cg) gene, c... 42 0.81
11gb|AC027125.5| Homo sapiens chromosome 3 clone RP11-584M7 map 3p... 42 0.81
12dbj|AK027185.1| Homo sapiens cDNA: FLJ23532 fis, clone LNG06911 42 0.81
13emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 42 0.81
14gb|AE003815.4| Drosophila melanogaster chromosome 2R, section 35... 42 0.81
15gb|AC127582.4| Mus musculus BAC clone RP24-89J3 from 12, complet... 42 0.81
16gb|AC024608.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 40 3.2
17ref|XM_535195.2| PREDICTED: Canis familiaris similar to inter-al... 40 3.2
18emb|BX469902.7| Zebrafish DNA sequence from clone CH211-277G23 i... 40 3.2
19gb|AC097525.3| Homo sapiens BAC clone RP11-627E8 from 2, complet... 40 3.2
20dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 3.2
21gb|AY109341.1| Zea mays CL4601_3 mRNA sequence 40 3.2

>gb|S68729.1| LHC Ib-20=light-harvesting complex I [Hordeum vulgare=barley,
           Prato, mRNA Chloroplast, 939 nt]
          Length = 939

 Score =  391 bits (197), Expect = e-106
 Identities = 238/248 (95%), Gaps = 9/248 (3%)
 Strand = Plus / Minus

                                                                       
Query: 1   ttttaaaataacacgcatgggtg-atattacaagtacagcctccgtcggaagccatgggc 59
           ||||||||||||||||||||||  |||||||||||||||| |||||||||||||||||||
Sbjct: 901 ttttaaaataacacgcatgggtatatattacaagtacagc-tccgtcggaagccatgggc 843

                                                                       
Query: 60  gaatccacaaggacaaagtttcaccaccggaactttaagattacaacacgtttttgcact 119
           |||||||||||||||||||||||||||||||||      |||||||||||||||||||||
Sbjct: 842 gaatccacaaggacaaagtttcaccaccggaac------attacaacacgtttttgcact 789

                                                                       
Query: 120 gccacctactcctccacactttgtacatcctcagcaccccaaaataataattcagaccac 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 788 gccacctactcctccacactttgtacatcctcagcaccccaaaataataattcagaccac 729

                                                                       
Query: 180 ctgaaacctccttggtcggtgaaatcgacggatttattggccggagatggtctggatgat 239
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 728 ct-aaacctccttggtcggtgaaatcgacggatttattggccggagatggtctggatgat 670

                   
Query: 240 ggtgttgt 247
           ||||||||
Sbjct: 669 ggtgttgt 662



to top

>gb|AF287276.1|AF287276 Hordeum vulgare chlorophyll a/b-binding protein precursor (Lhca4)
           mRNA, partial cds; nuclear gene for chloroplast product
          Length = 687

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 213 ttattggccggagatggtctggatgatggtgttgt 247
           |||||||||||||||||||||||||||||||||||
Sbjct: 687 ttattggccggagatggtctggatgatggtgttgt 653



to top

>gb|AC019013.2|AC019013 Genomic Sequence For Arabidopsis thaliana, Clone T5E15, Chromosome V,
             complete sequence
          Length = 114056

 Score = 46.1 bits (23), Expect = 0.052
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 124   cctactcctccacactttgtaca 146
             |||||||||||||||||||||||
Sbjct: 37526 cctactcctccacactttgtaca 37504



to top

>gb|AC007852.9| Drosophila melanogaster clone BACR33A10, complete sequence
          Length = 186333

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 118   ctgccacctactcctccacac 138
             |||||||||||||||||||||
Sbjct: 11776 ctgccacctactcctccacac 11756



to top

>gb|AC007588.5| Drosophila melanogaster clone BACR30O03, complete sequence
          Length = 165177

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 118   ctgccacctactcctccacac 138
             |||||||||||||||||||||
Sbjct: 60657 ctgccacctactcctccacac 60677



to top

>gb|BC036687.1| Homo sapiens cDNA clone IMAGE:5259465
          Length = 3993

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 67   caaggacaaagtttcaccacc 87
            |||||||||||||||||||||
Sbjct: 3765 caaggacaaagtttcaccacc 3785



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 228    ggtctggatgatggtgttgtc 248
              |||||||||||||||||||||
Sbjct: 172999 ggtctggatgatggtgttgtc 172979



to top

>gb|AC159237.2| Mus musculus BAC clone RP24-464G10 from chromosome 12, complete
             sequence
          Length = 222209

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 151   cagcaccccaaaataataatt 171
             |||||||||||||||||||||
Sbjct: 97909 cagcaccccaaaataataatt 97929



to top

>gb|AC090883.1|AC090883 Homo sapiens chromosome 3 clone RP11-117G9 map 3p, complete sequence
          Length = 172400

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 67     caaggacaaagtttcaccacc 87
              |||||||||||||||||||||
Sbjct: 170063 caaggacaaagtttcaccacc 170083



to top

>gb|AF276663.1|AF276663 Drosophila melanogaster comb (cg) gene, complete cds, alternatively
            spliced
          Length = 9504

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 118  ctgccacctactcctccacac 138
            |||||||||||||||||||||
Sbjct: 4304 ctgccacctactcctccacac 4324



to top

>gb|AC027125.5| Homo sapiens chromosome 3 clone RP11-584M7 map 3p, complete sequence
          Length = 173842

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 67     caaggacaaagtttcaccacc 87
              |||||||||||||||||||||
Sbjct: 111543 caaggacaaagtttcaccacc 111563



to top

>dbj|AK027185.1| Homo sapiens cDNA: FLJ23532 fis, clone LNG06911
          Length = 3189

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 67   caaggacaaagtttcaccacc 87
            |||||||||||||||||||||
Sbjct: 2950 caaggacaaagtttcaccacc 2970



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 225    gatggtctggatgatggtgtt 245
              |||||||||||||||||||||
Sbjct: 631602 gatggtctggatgatggtgtt 631582



to top

>gb|AE003815.4| Drosophila melanogaster chromosome 2R, section 35 of 73 of the complete
             sequence
          Length = 229685

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 118   ctgccacctactcctccacac 138
             |||||||||||||||||||||
Sbjct: 31518 ctgccacctactcctccacac 31538



to top

>gb|AC127582.4| Mus musculus BAC clone RP24-89J3 from 12, complete sequence
          Length = 217949

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 151  cagcaccccaaaataataatt 171
            |||||||||||||||||||||
Sbjct: 9849 cagcaccccaaaataataatt 9829



to top

>gb|AC024608.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-333I24, complete
              sequence
          Length = 215829

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    catcctcagcaccccaaaat 164
              ||||||||||||||||||||
Sbjct: 132164 catcctcagcaccccaaaat 132183



to top

>ref|XM_535195.2| PREDICTED: Canis familiaris similar to inter-alpha globulin
           inhibitor H2 polypeptide (LOC478011), mRNA
          Length = 2941

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 227 tggtctggatgatggtgttg 246
           ||||||||||||||||||||
Sbjct: 377 tggtctggatgatggtgttg 358



to top

>emb|BX469902.7| Zebrafish DNA sequence from clone CH211-277G23 in linkage group 9,
             complete sequence
          Length = 179135

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   caccccaaaataataattca 173
             ||||||||||||||||||||
Sbjct: 16903 caccccaaaataataattca 16922



to top

>gb|AC097525.3| Homo sapiens BAC clone RP11-627E8 from 2, complete sequence
          Length = 55514

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 16    catgggtgatattacaagta 35
             ||||||||||||||||||||
Sbjct: 11077 catgggtgatattacaagta 11096



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 220     ccggagatggtctggatgatggtg 243
               ||||||||||||||||||| ||||
Sbjct: 5018847 ccggagatggtctggatgagggtg 5018824



to top

>gb|AY109341.1| Zea mays CL4601_3 mRNA sequence
          Length = 1460

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 228 ggtctggatgatggtgttgt 247
           ||||||||||||||||||||
Sbjct: 280 ggtctggatgatggtgttgt 299


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,540,611
Number of Sequences: 3902068
Number of extensions: 2540611
Number of successful extensions: 40823
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 40774
Number of HSP's gapped (non-prelim): 46
length of query: 248
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 226
effective length of database: 17,147,199,772
effective search space: 3875267148472
effective search space used: 3875267148472
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top