>emb|AL136371.8| Human DNA sequence from clone RP11-110P20 on chromosome 1q31.1 Contains
             STSs, GSSs and a CpG island, complete sequence
          Length = 147784

 Score = 42.1 bits (21), Expect = 0.57
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 38    agtaaagttctattcatgtatcttt 62
             |||||||||||||| ||||||||||
Sbjct: 62027 agtaaagttctatttatgtatcttt 62051

>emb|AL133395.21| Human DNA sequence from clone RP11-446H13 on chromosome 10 Contains the
             3' end of the gene for  VPS10 domain receptor protein
             SORCS 1 and an RPL23A (60S ribosmal protein 23A)
             pseudogene, complete sequence
          Length = 217929

 Score = 42.1 bits (21), Expect = 0.57
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 50    ttcatgtatctttgtcttttc 70
             |||||||||||||||||||||
Sbjct: 54064 ttcatgtatctttgtcttttc 54044

>ref|NM_052918.3| Homo sapiens sortilin-related VPS10 domain containing receptor 1
            (SORCS1), transcript variant 1, mRNA
          Length = 7272

 Score = 42.1 bits (21), Expect = 0.57
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 50   ttcatgtatctttgtcttttc 70
            |||||||||||||||||||||
Sbjct: 4759 ttcatgtatctttgtcttttc 4779

>ref|NM_001013031.1| Homo sapiens sortilin-related VPS10 domain containing receptor 1
            (SORCS1), transcript variant 2, mRNA
          Length = 7163

 Score = 42.1 bits (21), Expect = 0.57
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 50   ttcatgtatctttgtcttttc 70
            |||||||||||||||||||||
Sbjct: 4650 ttcatgtatctttgtcttttc 4670

>gb|AC113382.2| Homo sapiens chromosome 5 clone RP11-325L7, complete sequence
          Length = 166870

 Score = 42.1 bits (21), Expect = 0.57
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 50    ttcatgtatctttgtcttttc 70
             |||||||||||||||||||||
Sbjct: 97567 ttcatgtatctttgtcttttc 97587

>gb|AC008780.7| Homo sapiens chromosome 5 clone CTD-2023N9, complete sequence
          Length = 178203

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     catgtatctttgtcttttca 71
              ||||||||||||||||||||
Sbjct: 172439 catgtatctttgtcttttca 172458

>gb|AC135016.3| Mus musculus BAC clone RP24-244B4 from chromosome 18, complete sequence
          Length = 177193

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 50     ttcatgtatctttgtcttt 68
              |||||||||||||||||||
Sbjct: 150467 ttcatgtatctttgtcttt 150485

>ref|XM_500654.1| Yarrowia lipolytica CLIB122, YALI0B08778g predicted mRNA
          Length = 3024

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 132 cgagttggatggaacggcc 150
           |||||||||||||||||||
Sbjct: 372 cgagttggatggaacggcc 354

>gb|AC010064.7| Drosophila melanogaster 3L BAC RP98-22I16 (Roswell Park Cancer Institute
              Drosophila BAC library) complete sequence
          Length = 199396

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 33     tataaagtaaagttctatt 51
              |||||||||||||||||||
Sbjct: 123465 tataaagtaaagttctatt 123483

>emb|AL049561.17|HSDA109P7 Human DNA sequence from clone RP6-109P7 on chromosome Xq25-26.3,
             complete sequence
          Length = 103989

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    ttctattcatgtatctttg 63
             |||||||||||||||||||
Sbjct: 23734 ttctattcatgtatctttg 23752

>emb|AL008726.3|HS337O18 Human DNA sequence from clone RP3-337O18 on chromosome 20q12-13.1
             Contains the PLPT gene for phospholipid transfer protein,
             the PPGB gene for protective protein for
             beta-galactosidase (galactosialidosis), the PTE1 gene for
             peroxisomal acyl-CoA thioesterase, the C20orf161 gene, the
             C20orf162 gene, the C20orf163, the C20orf164 gene, the
             C20orf165 gene, the 5' end of an variant of the TNNC2 gene
             for fast troponin C2 and three CpG islands, complete
             sequence
          Length = 86080

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 50    ttcatgtatctttgtcttt 68
             |||||||||||||||||||
Sbjct: 32038 ttcatgtatctttgtcttt 32020

>gb|AC122698.2| Homo sapiens chromosome 5 clone CTD-2313P7, complete sequence
          Length = 107685

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    ttctattcatgtatctttg 63
             |||||||||||||||||||
Sbjct: 93538 ttctattcatgtatctttg 93556

>gb|AC025028.21| Homo sapiens 3 BAC RP11-238M12 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 145969

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 2     tggaagtctgaaatgcagt 20
             |||||||||||||||||||
Sbjct: 80156 tggaagtctgaaatgcagt 80138

>gb|AC068880.6| Homo sapiens chromosome 8, clone RP11-618M23, complete sequence
          Length = 189810

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     tgtatctttgtcttttcaa 72
              |||||||||||||||||||
Sbjct: 165178 tgtatctttgtcttttcaa 165196

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 38       agtaaagttctattcatgt 56
                |||||||||||||||||||
Sbjct: 27967293 agtaaagttctattcatgt 27967311

>gb|AC022079.16|AC022079 Homo sapiens 12 BAC RP11-425D17 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 181193

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 53    atgtatctttgtcttttca 71
             |||||||||||||||||||
Sbjct: 65386 atgtatctttgtcttttca 65368

>dbj|AP003335.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1144G04
          Length = 194459

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     agtaaagttctattcatgt 56
              |||||||||||||||||||
Sbjct: 153974 agtaaagttctattcatgt 153992

>emb|AJ324111.1|HSA324111 Homo sapiens genomic sequence surrounding NotI site, clone
           NL1-VP18R
          Length = 769

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 51  tcatgtatctttgtctttt 69
           |||||||||||||||||||
Sbjct: 590 tcatgtatctttgtctttt 572

>gb|AE003592.3| Drosophila melanogaster chromosome 3L, section 73 of 83 of the complete
              sequence
          Length = 323816

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 33     tataaagtaaagttctatt 51
              |||||||||||||||||||
Sbjct: 263773 tataaagtaaagttctatt 263791

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 132     cgagttggatggaacggcc 150
               |||||||||||||||||||
Sbjct: 1207606 cgagttggatggaacggcc 1207624

>emb|Z73418.1|HSU55E4 Human DNA sequence from clone LL0XNC01-55E4 on chromosome X, complete
             sequence
          Length = 46930

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    ttctattcatgtatctttg 63
             |||||||||||||||||||
Sbjct: 23737 ttctattcatgtatctttg 23755


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,174,276
Number of Sequences: 3902068
Number of extensions: 1174276
Number of successful extensions: 82803
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82736
Number of HSP's gapped (non-prelim): 67
length of query: 181
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 159
effective length of database: 17,147,199,772
effective search space: 2726404763748
effective search space used: 2726404763748
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)