>emb|AL136371.8| Human DNA sequence from clone RP11-110P20 on chromosome 1q31.1 Contains
             STSs, GSSs and a CpG island, complete sequence
          Length = 147784

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 114   agtaaagttctattcatgtatcttt 138
             |||||||||||||| ||||||||||
Sbjct: 62027 agtaaagttctatttatgtatcttt 62051

>emb|AL133395.21| Human DNA sequence from clone RP11-446H13 on chromosome 10 Contains the
             3' end of the gene for  VPS10 domain receptor protein
             SORCS 1 and an RPL23A (60S ribosmal protein 23A)
             pseudogene, complete sequence
          Length = 217929

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 126   ttcatgtatctttgtcttttc 146
             |||||||||||||||||||||
Sbjct: 54064 ttcatgtatctttgtcttttc 54044

>ref|NM_052918.3| Homo sapiens sortilin-related VPS10 domain containing receptor 1
            (SORCS1), transcript variant 1, mRNA
          Length = 7272

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 126  ttcatgtatctttgtcttttc 146
            |||||||||||||||||||||
Sbjct: 4759 ttcatgtatctttgtcttttc 4779

>ref|NM_001013031.1| Homo sapiens sortilin-related VPS10 domain containing receptor 1
            (SORCS1), transcript variant 2, mRNA
          Length = 7163

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 126  ttcatgtatctttgtcttttc 146
            |||||||||||||||||||||
Sbjct: 4650 ttcatgtatctttgtcttttc 4670

>gb|AC113382.2| Homo sapiens chromosome 5 clone RP11-325L7, complete sequence
          Length = 166870

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 126   ttcatgtatctttgtcttttc 146
             |||||||||||||||||||||
Sbjct: 97567 ttcatgtatctttgtcttttc 97587

>emb|BX908762.11| Zebrafish DNA sequence from clone CH211-222N22 in linkage group 3,
             complete sequence
          Length = 113490

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    aacaacaggtcactggaagt 84
             ||||||||||||||||||||
Sbjct: 87538 aacaacaggtcactggaagt 87519

>gb|AC108217.3| Homo sapiens BAC clone RP11-681L8 from 4, complete sequence
          Length = 111201

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 61    tgcaaacaacaggtcactggaagtctgaaatg 92
             |||||| || ||||||||| ||||||||||||
Sbjct: 42521 tgcaaaaaataggtcactgaaagtctgaaatg 42552

>gb|AC008780.7| Homo sapiens chromosome 5 clone CTD-2023N9, complete sequence
          Length = 178203

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 128    catgtatctttgtcttttca 147
              ||||||||||||||||||||
Sbjct: 172439 catgtatctttgtcttttca 172458

>gb|AC161878.3| Mus musculus BAC clone RP23-303B4 from chromosome 1, complete sequence
          Length = 169556

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 50    gtaataaactgtgcaaacaa 69
             ||||||||||||||||||||
Sbjct: 17796 gtaataaactgtgcaaacaa 17777


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,758,900
Number of Sequences: 3902068
Number of extensions: 1758900
Number of successful extensions: 33999
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33988
Number of HSP's gapped (non-prelim): 11
length of query: 258
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 236
effective length of database: 17,147,199,772
effective search space: 4046739146192
effective search space used: 4046739146192
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)