| Clone Name | rbaal11g14 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_184017.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 957 Score = 307 bits (155), Expect = 3e-80 Identities = 283/328 (86%) Strand = Plus / Minus Query: 343 cctgtttcatttggcttcaagatttgaaatgagcacattagattttcatctatgctcaac 402 ||||| ||||||||||||||||||||||| || ||||||| | ||||||||||||||||| Sbjct: 899 cctgtatcatttggcttcaagatttgaaaagaacacattaaactttcatctatgctcaac 840 Query: 403 aaagcacctacattatcaaattccccacaataatttggagctgagaagattgtgactaat 462 | |||||| |||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 839 agagcacccgcattatcaaattccccacaatagtttggagctgaaaagattgtcactaat 780 Query: 463 ctccgctgtgcgaagaactcgtaaccatcttctaccacctgatgggctcggcagataaga 522 |||| || || ||||||||||| ||||| || || |||||||| || ||||| |||||| Sbjct: 779 ctcctttgcgcaaagaactcgtagccatcctcaacaacctgatgagcgcggcatataaga 720 Query: 523 tcaagatcannnnnnnccaaaaactctataagcttatctgcaccaaacgtacatgaaaca 582 ||||||||| ||||||| |||| |||||||||||||||||| || || |||||| Sbjct: 719 tcaagatcattcttctccaaaaattctacaagcttatctgcaccaaaagtgcaggaaaca 660 Query: 583 cctctgtcactctccccccacccttctccttccgggctaggatcagaccaaagcaaatca 642 |||||||||||||| |||||||||||| || || |||||||||||||||| |||||| Sbjct: 659 cctctgtcactctctccccacccttctgagtcaggactaggatcagaccaaactaaatca 600 Query: 643 cacaggagaccataatcaggaatctcag 670 |||| |||||||| ||||||||||||| Sbjct: 599 cacaaaagaccatagtcaggaatctcag 572
>dbj|AK122182.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033149M05, full insert sequence Length = 1531 Score = 307 bits (155), Expect = 3e-80 Identities = 283/328 (86%) Strand = Plus / Minus Query: 343 cctgtttcatttggcttcaagatttgaaatgagcacattagattttcatctatgctcaac 402 ||||| ||||||||||||||||||||||| || ||||||| | ||||||||||||||||| Sbjct: 1045 cctgtatcatttggcttcaagatttgaaaagaacacattaaactttcatctatgctcaac 986 Query: 403 aaagcacctacattatcaaattccccacaataatttggagctgagaagattgtgactaat 462 | |||||| |||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 985 agagcacccgcattatcaaattccccacaatagtttggagctgaaaagattgtcactaat 926 Query: 463 ctccgctgtgcgaagaactcgtaaccatcttctaccacctgatgggctcggcagataaga 522 |||| || || ||||||||||| ||||| || || |||||||| || ||||| |||||| Sbjct: 925 ctcctttgcgcaaagaactcgtagccatcctcaacaacctgatgagcgcggcatataaga 866 Query: 523 tcaagatcannnnnnnccaaaaactctataagcttatctgcaccaaacgtacatgaaaca 582 ||||||||| ||||||| |||| |||||||||||||||||| || || |||||| Sbjct: 865 tcaagatcattcttctccaaaaattctacaagcttatctgcaccaaaagtgcaggaaaca 806 Query: 583 cctctgtcactctccccccacccttctccttccgggctaggatcagaccaaagcaaatca 642 |||||||||||||| |||||||||||| || || |||||||||||||||| |||||| Sbjct: 805 cctctgtcactctctccccacccttctgagtcaggactaggatcagaccaaactaaatca 746 Query: 643 cacaggagaccataatcaggaatctcag 670 |||| |||||||| ||||||||||||| Sbjct: 745 cacaaaagaccatagtcaggaatctcag 718 Score = 44.1 bits (22), Expect = 0.59 Identities = 46/54 (85%) Strand = Plus / Minus Query: 196 tgccatgccctggtggatccaaacaatagatcagatcacccccttcgagctgac 249 |||||||||||||||||||| | ||| | ||||||||||||||| |||||| Sbjct: 1191 tgccatgccctggtggatccgagacataaaagagatcacccccttcgggctgac 1138
>dbj|AK105047.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E11, full insert sequence Length = 1489 Score = 307 bits (155), Expect = 3e-80 Identities = 283/328 (86%) Strand = Plus / Minus Query: 343 cctgtttcatttggcttcaagatttgaaatgagcacattagattttcatctatgctcaac 402 ||||| ||||||||||||||||||||||| || ||||||| | ||||||||||||||||| Sbjct: 1029 cctgtatcatttggcttcaagatttgaaaagaacacattaaactttcatctatgctcaac 970 Query: 403 aaagcacctacattatcaaattccccacaataatttggagctgagaagattgtgactaat 462 | |||||| |||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 969 agagcacccgcattatcaaattccccacaatagtttggagctgaaaagattgtcactaat 910 Query: 463 ctccgctgtgcgaagaactcgtaaccatcttctaccacctgatgggctcggcagataaga 522 |||| || || ||||||||||| ||||| || || |||||||| || ||||| |||||| Sbjct: 909 ctcctttgcgcaaagaactcgtagccatcctcaacaacctgatgagcgcggcatataaga 850 Query: 523 tcaagatcannnnnnnccaaaaactctataagcttatctgcaccaaacgtacatgaaaca 582 ||||||||| ||||||| |||| |||||||||||||||||| || || |||||| Sbjct: 849 tcaagatcattcttctccaaaaattctacaagcttatctgcaccaaaagtgcaggaaaca 790 Query: 583 cctctgtcactctccccccacccttctccttccgggctaggatcagaccaaagcaaatca 642 |||||||||||||| |||||||||||| || || |||||||||||||||| |||||| Sbjct: 789 cctctgtcactctctccccacccttctgagtcaggactaggatcagaccaaactaaatca 730 Query: 643 cacaggagaccataatcaggaatctcag 670 |||| |||||||| ||||||||||||| Sbjct: 729 cacaaaagaccatagtcaggaatctcag 702 Score = 44.1 bits (22), Expect = 0.59 Identities = 46/54 (85%) Strand = Plus / Minus Query: 196 tgccatgccctggtggatccaaacaatagatcagatcacccccttcgagctgac 249 |||||||||||||||||||| | ||| | ||||||||||||||| |||||| Sbjct: 1175 tgccatgccctggtggatccgagacataaaagagatcacccccttcgggctgac 1122
>dbj|AK100195.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023037D01, full insert sequence Length = 1514 Score = 307 bits (155), Expect = 3e-80 Identities = 283/328 (86%) Strand = Plus / Minus Query: 343 cctgtttcatttggcttcaagatttgaaatgagcacattagattttcatctatgctcaac 402 ||||| ||||||||||||||||||||||| || ||||||| | ||||||||||||||||| Sbjct: 1045 cctgtatcatttggcttcaagatttgaaaagaacacattaaactttcatctatgctcaac 986 Query: 403 aaagcacctacattatcaaattccccacaataatttggagctgagaagattgtgactaat 462 | |||||| |||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 985 agagcacccgcattatcaaattccccacaatagtttggagctgaaaagattgtcactaat 926 Query: 463 ctccgctgtgcgaagaactcgtaaccatcttctaccacctgatgggctcggcagataaga 522 |||| || || ||||||||||| ||||| || || |||||||| || ||||| |||||| Sbjct: 925 ctcctttgcgcaaagaactcgtagccatcctcaacaacctgatgagcgcggcatataaga 866 Query: 523 tcaagatcannnnnnnccaaaaactctataagcttatctgcaccaaacgtacatgaaaca 582 ||||||||| ||||||| |||| |||||||||||||||||| || || |||||| Sbjct: 865 tcaagatcattcttctccaaaaattctacaagcttatctgcaccaaaagtgcaggaaaca 806 Query: 583 cctctgtcactctccccccacccttctccttccgggctaggatcagaccaaagcaaatca 642 |||||||||||||| |||||||||||| || || |||||||||||||||| |||||| Sbjct: 805 cctctgtcactctctccccacccttctgagtcaggactaggatcagaccaaactaaatca 746 Query: 643 cacaggagaccataatcaggaatctcag 670 |||| |||||||| ||||||||||||| Sbjct: 745 cacaaaagaccatagtcaggaatctcag 718 Score = 44.1 bits (22), Expect = 0.59 Identities = 46/54 (85%) Strand = Plus / Minus Query: 196 tgccatgccctggtggatccaaacaatagatcagatcacccccttcgagctgac 249 |||||||||||||||||||| | ||| | ||||||||||||||| |||||| Sbjct: 1191 tgccatgccctggtggatccgagacataaaagagatcacccccttcgggctgac 1138
>dbj|AK064941.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000P08, full insert sequence Length = 1514 Score = 307 bits (155), Expect = 3e-80 Identities = 283/328 (86%) Strand = Plus / Minus Query: 343 cctgtttcatttggcttcaagatttgaaatgagcacattagattttcatctatgctcaac 402 ||||| ||||||||||||||||||||||| || ||||||| | ||||||||||||||||| Sbjct: 1045 cctgtatcatttggcttcaagatttgaaaagaacacattaaactttcatctatgctcaac 986 Query: 403 aaagcacctacattatcaaattccccacaataatttggagctgagaagattgtgactaat 462 | |||||| |||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 985 agagcacccgcattatcaaattccccacaatagtttggagctgaaaagattgtcactaat 926 Query: 463 ctccgctgtgcgaagaactcgtaaccatcttctaccacctgatgggctcggcagataaga 522 |||| || || ||||||||||| ||||| || || |||||||| || ||||| |||||| Sbjct: 925 ctcctttgcgcaaagaactcgtagccatcctcaacaacctgatgagcgcggcatataaga 866 Query: 523 tcaagatcannnnnnnccaaaaactctataagcttatctgcaccaaacgtacatgaaaca 582 ||||||||| ||||||| |||| |||||||||||||||||| || || |||||| Sbjct: 865 tcaagatcattcttctccaaaaattctacaagcttatctgcaccaaaagtgcaggaaaca 806 Query: 583 cctctgtcactctccccccacccttctccttccgggctaggatcagaccaaagcaaatca 642 |||||||||||||| |||||||||||| || || |||||||||||||||| |||||| Sbjct: 805 cctctgtcactctctccccacccttctgagtcaggactaggatcagaccaaactaaatca 746 Query: 643 cacaggagaccataatcaggaatctcag 670 |||| |||||||| ||||||||||||| Sbjct: 745 cacaaaagaccatagtcaggaatctcag 718 Score = 44.1 bits (22), Expect = 0.59 Identities = 46/54 (85%) Strand = Plus / Minus Query: 196 tgccatgccctggtggatccaaacaatagatcagatcacccccttcgagctgac 249 |||||||||||||||||||| | ||| | ||||||||||||||| |||||| Sbjct: 1191 tgccatgccctggtggatccgagacataaaagagatcacccccttcgggctgac 1138
>gb|AY110065.1| Zea mays CL384_1 mRNA sequence Length = 1522 Score = 178 bits (90), Expect = 2e-41 Identities = 231/282 (81%) Strand = Plus / Minus Query: 306 tggcttatttggaatttgtctttttacacgtggtgtgcctgtttcatttggcttcaagat 365 ||||||||||||||||||| || || || | |||| || | ||| ||||||||| ||| Sbjct: 1003 tggcttatttggaatttgttttcttgcatgcggtggacccatatcagttggcttcaggat 944 Query: 366 ttgaaatgagcacattagattttcatctatgctcaacaaagcacctacattatcaaattc 425 |||||||| |||||||| | ||||||||||| || | ||| || ||||||||||| || Sbjct: 943 ctgaaatgaacacattaggctctcatctatgcttaaaagagcgccaacattatcaaactc 884 Query: 426 cccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaagaactcgta 485 |||||||||||||||||||| |||||||| |||||||| || ||||| |||||||| || Sbjct: 883 tccacaataatttggagctgaaaagattgtcactaatcttcgttgtgcaaagaactcata 824 Query: 486 accatcttctaccacctgatgggctcggcagataagatcaagatcannnnnnnccaaaaa 545 |||||||| ||||||||||| |||||||| |||||||| |||||| || Sbjct: 823 gccatcttcaaccacctgatgagctcggcatataagatcgagatcattcttctccnnnnn 764 Query: 546 ctctataagcttatctgcaccaaacgtacatgaaacacctct 587 ||||| ||| |||||||||||||||||||| || |||||||| Sbjct: 763 ctctacaagtttatctgcaccaaacgtacacgagacacctct 722 Score = 97.6 bits (49), Expect = 5e-17 Identities = 52/53 (98%) Strand = Plus / Minus Query: 619 ctaggatcagaccaaagcaaatcacacaggagaccataatcaggaatctcagc 671 ||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 690 ctaggatcagaccaaagcagatcacacaggagaccataatcaggaatctcagc 638
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 168 bits (85), Expect = 1e-38 Identities = 133/149 (89%) Strand = Plus / Plus Query: 343 cctgtttcatttggcttcaagatttgaaatgagcacattagattttcatctatgctcaac 402 ||||| ||||||||||||||||||||||| || ||||||| | ||||||||||||||||| Sbjct: 13906728 cctgtatcatttggcttcaagatttgaaaagaacacattaaactttcatctatgctcaac 13906787 Query: 403 aaagcacctacattatcaaattccccacaataatttggagctgagaagattgtgactaat 462 | |||||| |||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 13906788 agagcacccgcattatcaaattccccacaatagtttggagctgaaaagattgtcactaat 13906847 Query: 463 ctccgctgtgcgaagaactcgtaaccatc 491 |||| || || ||||||||||| ||||| Sbjct: 13906848 ctcctttgcgcaaagaactcgtagccatc 13906876 Score = 149 bits (75), Expect = 1e-32 Identities = 146/172 (84%) Strand = Plus / Plus Query: 499 acctgatgggctcggcagataagatcaagatcannnnnnnccaaaaactctataagctta 558 |||||||| || ||||| ||||||||||||||| ||||||| |||| ||||||| Sbjct: 13906958 acctgatgagcgcggcatataagatcaagatcattcttctccaaaaattctacaagctta 13907017 Query: 559 tctgcaccaaacgtacatgaaacacctctgtcactctccccccacccttctccttccggg 618 ||||||||||| || || |||||||||||||||||||| |||||||||||| || || Sbjct: 13907018 tctgcaccaaaagtgcaggaaacacctctgtcactctctccccacccttctgagtcagga 13907077 Query: 619 ctaggatcagaccaaagcaaatcacacaggagaccataatcaggaatctcag 670 |||||||||||||||| |||||||||| |||||||| ||||||||||||| Sbjct: 13907078 ctaggatcagaccaaactaaatcacacaaaagaccatagtcaggaatctcag 13907129 Score = 44.1 bits (22), Expect = 0.59 Identities = 46/54 (85%) Strand = Plus / Plus Query: 196 tgccatgccctggtggatccaaacaatagatcagatcacccccttcgagctgac 249 |||||||||||||||||||| | ||| | ||||||||||||||| |||||| Sbjct: 13905720 tgccatgccctggtggatccgagacataaaagagatcacccccttcgggctgac 13905773
>dbj|AP003764.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1051E10 Length = 207782 Score = 168 bits (85), Expect = 1e-38 Identities = 133/149 (89%) Strand = Plus / Plus Query: 343 cctgtttcatttggcttcaagatttgaaatgagcacattagattttcatctatgctcaac 402 ||||| ||||||||||||||||||||||| || ||||||| | ||||||||||||||||| Sbjct: 67030 cctgtatcatttggcttcaagatttgaaaagaacacattaaactttcatctatgctcaac 67089 Query: 403 aaagcacctacattatcaaattccccacaataatttggagctgagaagattgtgactaat 462 | |||||| |||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 67090 agagcacccgcattatcaaattccccacaatagtttggagctgaaaagattgtcactaat 67149 Query: 463 ctccgctgtgcgaagaactcgtaaccatc 491 |||| || || ||||||||||| ||||| Sbjct: 67150 ctcctttgcgcaaagaactcgtagccatc 67178 Score = 149 bits (75), Expect = 1e-32 Identities = 146/172 (84%) Strand = Plus / Plus Query: 499 acctgatgggctcggcagataagatcaagatcannnnnnnccaaaaactctataagctta 558 |||||||| || ||||| ||||||||||||||| ||||||| |||| ||||||| Sbjct: 67260 acctgatgagcgcggcatataagatcaagatcattcttctccaaaaattctacaagctta 67319 Query: 559 tctgcaccaaacgtacatgaaacacctctgtcactctccccccacccttctccttccggg 618 ||||||||||| || || |||||||||||||||||||| |||||||||||| || || Sbjct: 67320 tctgcaccaaaagtgcaggaaacacctctgtcactctctccccacccttctgagtcagga 67379 Query: 619 ctaggatcagaccaaagcaaatcacacaggagaccataatcaggaatctcag 670 |||||||||||||||| |||||||||| |||||||| ||||||||||||| Sbjct: 67380 ctaggatcagaccaaactaaatcacacaaaagaccatagtcaggaatctcag 67431 Score = 44.1 bits (22), Expect = 0.59 Identities = 46/54 (85%) Strand = Plus / Plus Query: 196 tgccatgccctggtggatccaaacaatagatcagatcacccccttcgagctgac 249 |||||||||||||||||||| | ||| | ||||||||||||||| |||||| Sbjct: 66022 tgccatgccctggtggatccgagacataaaagagatcacccccttcgggctgac 66075
>dbj|AP003852.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0440D10 Length = 144340 Score = 168 bits (85), Expect = 1e-38 Identities = 133/149 (89%) Strand = Plus / Plus Query: 343 cctgtttcatttggcttcaagatttgaaatgagcacattagattttcatctatgctcaac 402 ||||| ||||||||||||||||||||||| || ||||||| | ||||||||||||||||| Sbjct: 144131 cctgtatcatttggcttcaagatttgaaaagaacacattaaactttcatctatgctcaac 144190 Query: 403 aaagcacctacattatcaaattccccacaataatttggagctgagaagattgtgactaat 462 | |||||| |||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 144191 agagcacccgcattatcaaattccccacaatagtttggagctgaaaagattgtcactaat 144250 Query: 463 ctccgctgtgcgaagaactcgtaaccatc 491 |||| || || ||||||||||| ||||| Sbjct: 144251 ctcctttgcgcaaagaactcgtagccatc 144279 Score = 44.1 bits (22), Expect = 0.59 Identities = 46/54 (85%) Strand = Plus / Plus Query: 196 tgccatgccctggtggatccaaacaatagatcagatcacccccttcgagctgac 249 |||||||||||||||||||| | ||| | ||||||||||||||| |||||| Sbjct: 143123 tgccatgccctggtggatccgagacataaaagagatcacccccttcgggctgac 143176
>gb|AY112052.1| Zea mays CL384_2 mRNA sequence Length = 664 Score = 131 bits (66), Expect = 3e-27 Identities = 174/212 (82%) Strand = Plus / Minus Query: 302 ttgctggcttatttggaatttgtctttttacacgtggtgtgcctgtttcatttggcttca 361 ||||||||||||||||||||||| || || || |||||| || | ||| ||||||||| Sbjct: 220 ttgctggcttatttggaatttgttttcttgcatgtggtggacccatatcagttggcttca 161 Query: 362 agatttgaaatgagcacattagattttcatctatgctcaacaaagcacctacattatcaa 421 | || |||||||| |||||||| | |||||||||||||||| |||||| | ||||| | Sbjct: 160 aaatctgaaatgaacacattaggctctcatctatgctcaacagagcaccggcgttatcga 101 Query: 422 attccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaagaact 481 | || ||||| |||||||||||||| |||||||| |||||||| || ||||| || Sbjct: 100 actctccacagtaatttggagctgaaaagattgtcactaatcttcgttgtgcnnnnnnct 41 Query: 482 cgtaaccatcttctaccacctgatgggctcgg 513 | ||||||||||| || |||||||| |||||| Sbjct: 40 cataaccatcttcaactacctgatgagctcgg 9
>ref|NM_122666.3| Arabidopsis thaliana TOPP8; protein phosphatase type 1 AT5G27840 (TOPP8) transcript variant AT5G27840.2 mRNA, complete cds Length = 1639 Score = 99.6 bits (50), Expect = 1e-17 Identities = 98/114 (85%) Strand = Plus / Minus Query: 418 tcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaag 477 ||||| ||||||| ||| |||||||||||||| || |||||||||||||| | |||||| Sbjct: 1037 tcaaactccccaccatagtttggagctgagaatatcgtgactaatctccgttttgcgaaa 978 Query: 478 aactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatca 531 ||||| || || |||||||| ||||||||| ||||||| || || ||||||||| Sbjct: 977 aactcatacccgtcttctactacctgatggcctcggcaaatgaggtcaagatca 924
>ref|NM_180754.2| Arabidopsis thaliana TOPP8; protein phosphatase type 1 AT5G27840 (TOPP8) transcript variant AT5G27840.1 mRNA, complete cds Length = 1549 Score = 99.6 bits (50), Expect = 1e-17 Identities = 98/114 (85%) Strand = Plus / Minus Query: 418 tcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaag 477 ||||| ||||||| ||| |||||||||||||| || |||||||||||||| | |||||| Sbjct: 1041 tcaaactccccaccatagtttggagctgagaatatcgtgactaatctccgttttgcgaaa 982 Query: 478 aactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatca 531 ||||| || || |||||||| ||||||||| ||||||| || || ||||||||| Sbjct: 981 aactcatacccgtcttctactacctgatggcctcggcaaatgaggtcaagatca 928
>gb|AY081492.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 1066 Score = 99.6 bits (50), Expect = 1e-17 Identities = 98/114 (85%) Strand = Plus / Minus Query: 418 tcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaag 477 ||||| ||||||| ||| |||||||||||||| || |||||||||||||| | |||||| Sbjct: 836 tcaaactccccaccatagtttggagctgagaatatcgtgactaatctccgttttgcgaaa 777 Query: 478 aactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatca 531 ||||| || || |||||||| ||||||||| ||||||| || || ||||||||| Sbjct: 776 aactcatacccgtcttctactacctgatggcctcggcaaatgaggtcaagatca 723
>gb|AY042854.1| Arabidopsis thaliana serine/threonine protein phosphatase (MOJ9.27) mRNA, complete cds Length = 1546 Score = 99.6 bits (50), Expect = 1e-17 Identities = 98/114 (85%) Strand = Plus / Minus Query: 418 tcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaag 477 ||||| ||||||| ||| |||||||||||||| || |||||||||||||| | |||||| Sbjct: 1039 tcaaactccccaccatagtttggagctgagaatatcgtgactaatctccgttttgcgaaa 980 Query: 478 aactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatca 531 ||||| || || |||||||| ||||||||| ||||||| || || ||||||||| Sbjct: 979 aactcatacccgtcttctactacctgatggcctcggcaaatgaggtcaagatca 926
>emb|BX829841.1|CNS0A1AR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB40ZC02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1464 Score = 99.6 bits (50), Expect = 1e-17 Identities = 98/114 (85%) Strand = Plus / Minus Query: 418 tcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaag 477 ||||| ||||||| ||| |||||||||||||| || |||||||||||||| | |||||| Sbjct: 1024 tcaaactccccaccatagtttggagctgagaatatcgtgactaatctccgttttgcgaaa 965 Query: 478 aactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatca 531 ||||| || || |||||||| ||||||||| ||||||| || || ||||||||| Sbjct: 964 aactcatacccgtcttctactacctgatggcctcggcaaatgaggtcaagatca 911
>emb|BX832480.1|CNS0A10M Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH75ZH07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1460 Score = 99.6 bits (50), Expect = 1e-17 Identities = 98/114 (85%) Strand = Plus / Minus Query: 418 tcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaag 477 ||||| ||||||| ||| |||||||||||||| || |||||||||||||| | |||||| Sbjct: 973 tcaaactccccaccatagtttggagctgagaatatcgtgactaatctccgttttgcgaaa 914 Query: 478 aactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatca 531 ||||| || || |||||||| ||||||||| ||||||| || || ||||||||| Sbjct: 913 aactcatacccgtcttctactacctgatggcctcggcaaatgaggtcaagatca 860
>gb|AY087823.1| Arabidopsis thaliana clone 38656 mRNA, complete sequence Length = 1526 Score = 99.6 bits (50), Expect = 1e-17 Identities = 98/114 (85%) Strand = Plus / Minus Query: 418 tcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaag 477 ||||| ||||||| ||| |||||||||||||| || |||||||||||||| | |||||| Sbjct: 1037 tcaaactccccaccatagtttggagctgagaatatcgtgactaatctccgttttgcgaaa 978 Query: 478 aactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatca 531 ||||| || || |||||||| ||||||||| ||||||| || || ||||||||| Sbjct: 977 aactcatacccgtcttctactacctgatggcctcggcaaatgaggtcaagatca 924
>gb|U80922.2|ATU80922 Arabidopsis thaliana serine/threonine protein phosphatase type one (TOPP8) gene, complete cds Length = 1502 Score = 91.7 bits (46), Expect = 3e-15 Identities = 97/114 (85%) Strand = Plus / Minus Query: 418 tcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaag 477 ||||| ||||||| ||| |||||||||||||| || |||||||||||||| | |||||| Sbjct: 978 tcaaactccccaccatagtttggagctgagaatatcgtgactaatctccgttttgcgaaa 919 Query: 478 aactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatca 531 ||||| || | |||||||| ||||||||| ||||||| || || ||||||||| Sbjct: 918 aactcatactcgtcttctactacctgatggcctcggcaaatgaggtcaagatca 865
>emb|BX831124.1|CNS0A0TO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZD02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1516 Score = 91.7 bits (46), Expect = 3e-15 Identities = 97/114 (85%) Strand = Plus / Minus Query: 418 tcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaag 477 ||||| ||||||| ||| |||||||||||||| || |||||||||||||| | |||||| Sbjct: 1041 tcaaactccccaccatagtttggagctgagaatatcgtgactaatctccgttttgcgaaa 982 Query: 478 aactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatca 531 |||| || || |||||||| ||||||||| ||||||| || || ||||||||| Sbjct: 981 gactcatacccgtcttctactacctgatggcctcggcaaatgaggtcaagatca 928
>emb|X57438.1|BNPP1 B.napus mRNA for phosphatase 1 Length = 1344 Score = 89.7 bits (45), Expect = 1e-14 Identities = 99/117 (84%) Strand = Plus / Minus Query: 415 ttatcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcg 474 |||||||| ||||||| ||| || ||||||||||| || || |||||||||| | |||| Sbjct: 895 ttatcaaactccccaccatagttcggagctgagaatatcgtcactaatctcctttttgcg 836 Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatca 531 |||||||||||||||||||| || || |||||| | ||||| || || ||||||||| Sbjct: 835 aagaactcgtaaccatcttccactacttgatggccacggcaaatgaggtcaagatca 779 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcacacaggagacca 654 |||||||||||||||||||||||| || |||||| Sbjct: 689 aggatcagaccaaagcaaatcacaaagaagacca 656
>ref|XM_722866.1| Plasmodium yoelii yoelii str. 17XNL serine/threonine protein phosphatase alpha-3 isoform (PY07156) partial mRNA Length = 915 Score = 81.8 bits (41), Expect = 3e-12 Identities = 80/93 (86%) Strand = Plus / Minus Query: 354 tggcttcaagatttgaaatgagcacattagattttcatctatgctcaacaaagcacctac 413 |||||| || ||||||||||||||||| ||| | ||||| | |||| || ||| ||| | Sbjct: 888 tggctttaaaatttgaaatgagcacatgagagtctcatcaacactcatcatagctcctgc 829 Query: 414 attatcaaattccccacaataatttggagctga 446 |||||||||||| |||||||||||||||||||| Sbjct: 828 attatcaaattctccacaataatttggagctga 796 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 564 accaaacgtacatgaaacacctctgtca 591 |||||| ||| ||||||||||||||||| Sbjct: 678 accaaatgtaaatgaaacacctctgtca 651
>ref|NM_111431.2| Arabidopsis thaliana protein phosphatase type 1/ protein serine/threonine phosphatase AT3G05580 mRNA, complete cds Length = 1465 Score = 79.8 bits (40), Expect = 1e-11 Identities = 82/96 (85%) Strand = Plus / Minus Query: 436 tttggagctgagaagattgtgactaatctccgctgtgcgaagaactcgtaaccatcttct 495 |||||||||||||| ||||||||||| ||||| | |||||| ||||| || |||||||| Sbjct: 957 tttggagctgagaatattgtgactaacctccgttttgcgaaaaactcatacccatcttcc 898 Query: 496 accacctgatgggctcggcagataagatcaagatca 531 || ||||||||| ||| ||| || ||||| |||||| Sbjct: 897 actacctgatggcctctgcaaatgagatcgagatca 862 Score = 48.1 bits (24), Expect = 0.038 Identities = 42/48 (87%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcacacaggagaccataatcaggaatctc 668 ||||||||||||||| |||||||| || ||||||| || |||||||| Sbjct: 772 aggatcagaccaaagtaaatcacaaagaagaccattgtctggaatctc 725
>gb|BT010532.1| Arabidopsis thaliana At3g05580 gene, complete cds Length = 957 Score = 79.8 bits (40), Expect = 1e-11 Identities = 82/96 (85%) Strand = Plus / Minus Query: 436 tttggagctgagaagattgtgactaatctccgctgtgcgaagaactcgtaaccatcttct 495 |||||||||||||| ||||||||||| ||||| | |||||| ||||| || |||||||| Sbjct: 818 tttggagctgagaatattgtgactaacctccgttttgcgaaaaactcatacccatcttcc 759 Query: 496 accacctgatgggctcggcagataagatcaagatca 531 || ||||||||| ||| ||| || ||||| |||||| Sbjct: 758 actacctgatggcctctgcaaatgagatcgagatca 723 Score = 48.1 bits (24), Expect = 0.038 Identities = 42/48 (87%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcacacaggagaccataatcaggaatctc 668 ||||||||||||||| |||||||| || ||||||| || |||||||| Sbjct: 633 aggatcagaccaaagtaaatcacaaagaagaccattgtctggaatctc 586
>dbj|AK175443.1| Arabidopsis thaliana mRNA for putative serine/threonine protein phosphatase type one, complete cds, clone: RAFL21-87-E07 Length = 1568 Score = 79.8 bits (40), Expect = 1e-11 Identities = 82/96 (85%) Strand = Plus / Minus Query: 436 tttggagctgagaagattgtgactaatctccgctgtgcgaagaactcgtaaccatcttct 495 |||||||||||||| ||||||||||| ||||| | |||||| ||||| || |||||||| Sbjct: 1088 tttggagctgagaatattgtgactaacctccgttttgcgaaaaactcatacccatcttcc 1029 Query: 496 accacctgatgggctcggcagataagatcaagatca 531 || ||||||||| ||| ||| || ||||| |||||| Sbjct: 1028 actacctgatggcctctgcaaatgagatcgagatca 993 Score = 48.1 bits (24), Expect = 0.038 Identities = 42/48 (87%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcacacaggagaccataatcaggaatctc 668 ||||||||||||||| |||||||| || ||||||| || |||||||| Sbjct: 903 aggatcagaccaaagtaaatcacaaagaagaccattgtctggaatctc 856
>gb|AC069556.4|AC069556 Genomic Sequence For Arabidopsis thaliana Clone T1G16 From Chromosome V, complete sequence Length = 93672 Score = 75.8 bits (38), Expect = 2e-10 Identities = 74/86 (86%) Strand = Plus / Plus Query: 418 tcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcgaag 477 ||||| ||||||| ||| |||||||||||||| || |||||||||||||| | |||||| Sbjct: 83958 tcaaactccccaccatagtttggagctgagaatatcgtgactaatctccgttttgcgaaa 84017 Query: 478 aactcgtaaccatcttctaccacctg 503 ||||| || || |||||||| ||||| Sbjct: 84018 aactcatacccgtcttctactacctg 84043
>ref|NM_117195.3| Arabidopsis thaliana TOPP7; protein phosphatase type 1 AT4G11240 (TOPP7) mRNA, complete cds Length = 1392 Score = 73.8 bits (37), Expect = 7e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaag 527 ||||||||||| ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 978 aagaactcgtatccatcttctacaacctgatgagctcggcatataagatcaag 926 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 580 acacctctgtcactctccccccaccctt 607 |||||||||||| |||||||||| |||| Sbjct: 873 acacctctgtcattctccccccagcctt 846
>gb|AY122904.1| Arabidopsis thaliana AT4g11240/F8L21_30 mRNA, complete cds Length = 969 Score = 73.8 bits (37), Expect = 7e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaag 527 ||||||||||| ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 764 aagaactcgtatccatcttctacaacctgatgagctcggcatataagatcaag 712 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 580 acacctctgtcactctccccccaccctt 607 |||||||||||| |||||||||| |||| Sbjct: 659 acacctctgtcattctccccccagcctt 632
>gb|AY090365.1| Arabidopsis thaliana AT4g11240/F8L21_30 mRNA, complete cds Length = 1309 Score = 73.8 bits (37), Expect = 7e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaag 527 ||||||||||| ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 932 aagaactcgtatccatcttctacaacctgatgagctcggcatataagatcaag 880 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 580 acacctctgtcactctccccccaccctt 607 |||||||||||| |||||||||| |||| Sbjct: 827 acacctctgtcattctccccccagcctt 800
>emb|BX827517.1|CNS0A3D0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS69ZA11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1267 Score = 73.8 bits (37), Expect = 7e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaag 527 ||||||||||| ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 905 aagaactcgtatccatcttctacaacctgatgagctcggcatataagatcaag 853 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 580 acacctctgtcactctccccccaccctt 607 |||||||||||| |||||||||| |||| Sbjct: 800 acacctctgtcattctccccccagcctt 773
>emb|BX827508.1|CNS0A2U4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS66ZF05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 802 Score = 73.8 bits (37), Expect = 7e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaag 527 ||||||||||| ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 452 aagaactcgtatccatcttctacaacctgatgagctcggcatataagatcaag 400 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 580 acacctctgtcactctccccccaccctt 607 |||||||||||| |||||||||| |||| Sbjct: 347 acacctctgtcattctccccccagcctt 320
>emb|BX826313.1|CNS0A35Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB14ZG09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1317 Score = 73.8 bits (37), Expect = 7e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaag 527 ||||||||||| ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 964 aagaactcgtatccatcttctacaacctgatgagctcggcatataagatcaag 912 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 580 acacctctgtcactctccccccaccctt 607 |||||||||||| |||||||||| |||| Sbjct: 859 acacctctgtcattctccccccagcctt 832
>emb|BX827636.1|CNS0A2SB Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS88ZC08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1269 Score = 73.8 bits (37), Expect = 7e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaag 527 ||||||||||| ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 909 aagaactcgtatccatcttctacaacctgatgagctcggcatataagatcaag 857 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 580 acacctctgtcactctccccccaccctt 607 |||||||||||| |||||||||| |||| Sbjct: 804 acacctctgtcattctccccccagcctt 777
>gb|AY086060.1| Arabidopsis thaliana clone 20905 mRNA, complete sequence Length = 1282 Score = 73.8 bits (37), Expect = 7e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaag 527 ||||||||||| ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 888 aagaactcgtatccatcttctacaacctgatgagctcggcatataagatcaag 836 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 580 acacctctgtcactctccccccaccctt 607 |||||||||||| |||||||||| |||| Sbjct: 783 acacctctgtcattctccccccagcctt 756
>ref|XM_754134.1| Ustilago maydis 521 serine/threonine protein phosphatase (UM03080.1) partial mRNA Length = 996 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Minus Query: 406 gcacctacattatcaaattccccacaataatttggagctgagaagattgtgactaatctc 465 |||||| |||| ||||| || ||||||||||| || || ||||| | ||||| ||| | Sbjct: 848 gcacctgcattgtcaaactctccacaataattgggcgcggagaacagcgtgaccaattgc 789 Query: 466 cgctgtgcgaagaactcgtaaccatcttctaccacctgatgggctcggcagataagatc 524 |||| |||||| || |||||||| ||||| || |||||||| ||||||||||| ||||| Sbjct: 788 cgctttgcgaaaaattcgtaaccgtcttcgacaacctgatgcgctcggcagatgagatc 730
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 406 gcacctacattatcaaattccccacaataatttggagctgagaagattgtgac 458 |||||| ||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 8859940 gcacctgcattatcaaattcaccacaatagtttggagctgagaatatggtgac 8859888
>gb|AC139168.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1364E02, complete sequence Length = 126027 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 406 gcacctacattatcaaattccccacaataatttggagctgagaagattgtgac 458 |||||| ||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 50828 gcacctgcattatcaaattcaccacaatagtttggagctgagaatatggtgac 50776
>gb|AC135208.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1364E02, complete sequence Length = 112265 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 406 gcacctacattatcaaattccccacaataatttggagctgagaagattgtgac 458 |||||| ||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 103093 gcacctgcattatcaaattcaccacaatagtttggagctgagaatatggtgac 103041
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 406 gcacctacattatcaaattccccacaataatttggagctgagaagattgtgac 458 |||||| ||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 8857775 gcacctgcattatcaaattcaccacaatagtttggagctgagaatatggtgac 8857723
>dbj|AK073140.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033022I01, full insert sequence Length = 1621 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 406 gcacctacattatcaaattccccacaataatttggagctgagaagattgtgac 458 |||||| ||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 1003 gcacctgcattatcaaattcaccacaatagtttggagctgagaatatggtgac 951
>dbj|AK063856.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-D05, full insert sequence Length = 1022 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 406 gcacctacattatcaaattccccacaataatttggagctgagaagattgtgac 458 |||||| ||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 295 gcacctgcattatcaaattcaccacaatagtttggagctgagaatatggtgac 243
>gb|U31773.1|OSU31773 Oryza sativa protein phosphatase 1 mRNA, complete cds Length = 954 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 406 gcacctacattatcaaattccccacaataatttggagctgagaagattgtgac 458 |||||| ||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 860 gcacctgcattatcaaattcaccacaatagtttggagctgagaatatggtgac 808
>gb|AC011620.8|ATAC011620 Arabidopsis thaliana chromosome III BAC F18C1 genomic sequence, complete sequence Length = 100887 Score = 63.9 bits (32), Expect = 6e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 436 tttggagctgagaagattgtgactaatctccgctgtgcgaagaactcgtaaccatcttct 495 |||||||||||||| ||||||||||| ||||| | |||||| ||||| || |||||||| Sbjct: 88577 tttggagctgagaatattgtgactaacctccgttttgcgaaaaactcatacccatcttcc 88518 Query: 496 accacctg 503 || ||||| Sbjct: 88517 actacctg 88510 Score = 48.1 bits (24), Expect = 0.038 Identities = 42/48 (87%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcacacaggagaccataatcaggaatctc 668 ||||||||||||||| |||||||| || ||||||| || |||||||| Sbjct: 88238 aggatcagaccaaagtaaatcacaaagaagaccattgtctggaatctc 88191
>gb|AC009606.4|ATAC009606 Arabidopsis thaliana chromosome III BAC F22F7 genomic sequence, complete sequence Length = 91924 Score = 63.9 bits (32), Expect = 6e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 436 tttggagctgagaagattgtgactaatctccgctgtgcgaagaactcgtaaccatcttct 495 |||||||||||||| ||||||||||| ||||| | |||||| ||||| || |||||||| Sbjct: 2287 tttggagctgagaatattgtgactaacctccgttttgcgaaaaactcatacccatcttcc 2228 Query: 496 accacctg 503 || ||||| Sbjct: 2227 actacctg 2220 Score = 48.1 bits (24), Expect = 0.038 Identities = 42/48 (87%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcacacaggagaccataatcaggaatctc 668 ||||||||||||||| |||||||| || ||||||| || |||||||| Sbjct: 1948 aggatcagaccaaagtaaatcacaaagaagaccattgtctggaatctc 1901
>ref|NM_187476.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1122 Score = 61.9 bits (31), Expect = 3e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 408 acctacattatcaaattccccacaataatttggagctgagaagattgtgac 458 |||| ||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 1107 acctgcattatcaaattcaccacaatagtttggagctgagaatatggtgac 1057
>gb|BC041730.1| Xenopus laevis Protein phosphatase type 1 alpha, catalytic subunit, mRNA (cDNA clone MGC:52704 IMAGE:4682749), complete cds Length = 1908 Score = 61.9 bits (31), Expect = 3e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||| ||||| ||||| |||||||||||||| |||||||||||||| Sbjct: 823 gcgaaaaactcataaccgtcttctaccacctggtgggctcggcagat 777
>gb|BC072730.1| Xenopus laevis MGC79074 protein, mRNA (cDNA clone MGC:79074 IMAGE:4963300), complete cds Length = 1171 Score = 60.0 bits (30), Expect = 1e-05 Identities = 96/118 (81%) Strand = Plus / Minus Query: 413 cattatcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtg 472 |||||||||| || ||||| ||||||||||| ||||||| ||||| | |||| | Sbjct: 849 cattatcaaactcgccacagtaatttggagcagagaagagggtgaccagctgacgcttgg 790 Query: 473 cgaagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatc 530 | ||||| || || ||||||||||||||||||||||| || ||||| ||||| ||||| Sbjct: 789 caaagaattcatacccatcttctaccacctgatgggcccgacagatcagatctagatc 732
>gb|DQ380140.1| Sus scrofa protein phosphatase 1 catalytic subunit alpha isoform mRNA, complete cds Length = 1215 Score = 60.0 bits (30), Expect = 1e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatc 524 ||||||||||| ||||||||||||||||| || || |||||||| ||||| Sbjct: 820 aagaactcgtagccatcttctaccacctggtgtgcccggcagatgagatc 771
>gb|BT024175.1| Zea mays clone EL01N0421F03 mRNA sequence Length = 1673 Score = 60.0 bits (30), Expect = 1e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagataag 521 ||||| |||||||| |||||||| || |||||||| |||||||||||||| Sbjct: 1183 gcgaaaaactcgtatccatcttcgacaacctgatgtgctcggcagataag 1134
>gb|M60215.1|MZEZMPP1 Z.mays protein phosphatase-1 (ZmPP1) mRNA, complete cds Length = 1644 Score = 60.0 bits (30), Expect = 1e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagataag 521 ||||| |||||||| |||||||| || |||||||| |||||||||||||| Sbjct: 1165 gcgaaaaactcgtatccatcttcgacaacctgatgtgctcggcagataag 1116
>gb|BC054188.1| Xenopus laevis protein phosphatase 1, catalytic subunit, gamma isoform, mRNA (cDNA clone MGC:64327 IMAGE:6876315), complete cds Length = 1926 Score = 58.0 bits (29), Expect = 4e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 413 cattatcaaattccccacaataatttggagctgagaa 449 |||||||||||||||||||||| ||||| |||||||| Sbjct: 962 cattatcaaattccccacaatagtttggggctgagaa 926 Score = 50.1 bits (25), Expect = 0.010 Identities = 40/45 (88%) Strand = Plus / Minus Query: 487 ccatcttctaccacctgatgggctcggcagataagatcaagatca 531 |||||||| ||||||||||| |||||||| || ||||| |||||| Sbjct: 888 ccatcttcaaccacctgatgagctcggcaaatgagatccagatca 844
>emb|Z73535.1|SCYPL179W S.cerevisiae chromosome XVI reading frame ORF YPL179w Length = 4510 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 414 attatcaaattccccacaataatttggagctgagaagattgtgac 458 ||||| |||||| |||||||||||||| ||||| ||||||||||| Sbjct: 2054 attatgaaattctccacaataatttggtgctgaaaagattgtgac 2010
>emb|Z46253.1|ATPP1BG A.thaliana PP1bg gene encoding protein phosphatase 1 Length = 1430 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaag 527 ||||||||||| |||||||| | |||||||| |||||||| ||||||||||| Sbjct: 1015 aagaactcgtatccatcttcatcaacctgatgagctcggcatataagatcaag 963 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 580 acacctctgtcactctccccccaccctt 607 |||||||||||| |||||||||| |||| Sbjct: 910 acacctctgtcattctccccccagcctt 883
>emb|X75485.1|SCDNAPPQ1 S.cerevisiae PPQ1 gene Length = 2482 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 414 attatcaaattccccacaataatttggagctgagaagattgtgac 458 ||||| |||||| |||||||||||||| ||||| ||||||||||| Sbjct: 1898 attatgaaattctccacaataatttggtgctgaaaagattgtgac 1854
>gb|BC090213.1| Xenopus laevis protein phosphatase 1-gamma 1, mRNA (cDNA clone MGC:85040 IMAGE:6326645), complete cds Length = 2065 Score = 58.0 bits (29), Expect = 4e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 413 cattatcaaattccccacaataatttggagctgagaa 449 |||||||||||||||||||||| ||||| |||||||| Sbjct: 1050 cattatcaaattccccacaatagtttggggctgagaa 1014 Score = 50.1 bits (25), Expect = 0.010 Identities = 40/45 (88%) Strand = Plus / Minus Query: 487 ccatcttctaccacctgatgggctcggcagataagatcaagatca 531 |||||||| ||||||||||| |||| |||||| ||||| |||||| Sbjct: 976 ccatcttcaaccacctgatgagctctgcagatgagatccagatca 932 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcacacaggagacc 653 ||||||||||||||| || |||||||| ||||| Sbjct: 842 aggatcagaccaaagtaagtcacacagaagacc 810
>gb|U00795.1|SCU00795 Saccharomyces cerevisiae translational allosuppressor serine-threonine protein phosphatase (SAL6) gene, complete cds, and tRNA-Glu, complete sequence Length = 3868 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 414 attatcaaattccccacaataatttggagctgagaagattgtgac 458 ||||| |||||| |||||||||||||| ||||| ||||||||||| Sbjct: 2148 attatgaaattctccacaataatttggtgctgaaaagattgtgac 2104
>gb|U80921.1|ATU80921 Arabidopsis thaliana serine/threonine protein phosphatase type one (TOPP7) gene, complete cds Length = 1149 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaag 527 ||||||||||| |||||||| | |||||||| |||||||| ||||||||||| Sbjct: 887 aagaactcgtatccatcttcatcaacctgatgagctcggcatataagatcaag 835 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 580 acacctctgtcactctccccccaccctt 607 |||||||||||| |||||||||| |||| Sbjct: 782 acacctctgtcattctccccccagcctt 755
>gb|L17039.1|XELPP1G1CC Xenopus laevis protein phosphatase 1-gamma 1 mRNA, complete cds Length = 1105 Score = 58.0 bits (29), Expect = 4e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 413 cattatcaaattccccacaataatttggagctgagaa 449 |||||||||||||||||||||| ||||| |||||||| Sbjct: 901 cattatcaaattccccacaatagtttggggctgagaa 865 Score = 50.1 bits (25), Expect = 0.010 Identities = 40/45 (88%) Strand = Plus / Minus Query: 487 ccatcttctaccacctgatgggctcggcagataagatcaagatca 531 |||||||| ||||||||||| |||| |||||| ||||| |||||| Sbjct: 827 ccatcttcaaccacctgatgagctctgcagatgagatccagatca 783 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcacacaggagacc 653 ||||||||||||||| || |||||||| ||||| Sbjct: 693 aggatcagaccaaagtaagtcacacagaagacc 661
>ref|XM_468432.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1525 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| |||||||| || |||||||||||||| ||||| Sbjct: 1017 aagaactcgtacccatcttcgacaacctgatgggctcgacagat 974
>ref|NM_001008709.1| Homo sapiens protein phosphatase 1, catalytic subunit, alpha isoform (PPP1CA), transcript variant 3, mRNA Length = 1521 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 929 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 886
>ref|NM_206873.1| Homo sapiens protein phosphatase 1, catalytic subunit, alpha isoform (PPP1CA), transcript variant 2, mRNA Length = 1356 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 764 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 721
>ref|NM_002708.3| Homo sapiens protein phosphatase 1, catalytic subunit, alpha isoform (PPP1CA), transcript variant 1, mRNA Length = 1488 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 896 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 853
>gb|BC001888.1| Homo sapiens protein phosphatase 1, catalytic subunit, alpha isoform, transcript variant 1, mRNA (cDNA clone MGC:1674 IMAGE:3546588), complete cds Length = 1429 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 817 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 774
>gb|BC008010.1| Homo sapiens protein phosphatase 1, catalytic subunit, alpha isoform, transcript variant 1, mRNA (cDNA clone MGC:15877 IMAGE:3528742), complete cds Length = 1453 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 837 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 794
>gb|BC004482.2| Homo sapiens protein phosphatase 1, catalytic subunit, alpha isoform, transcript variant 1, mRNA (cDNA clone MGC:10585 IMAGE:3689198), complete cds Length = 1429 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 837 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 794
>ref|XM_729901.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000001.01.0) partial mRNA Length = 117 Score = 56.0 bits (28), Expect = 2e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 354 tggcttcaagatttgaaatgagcacattagattttcatctatgctcaacaaagcacctac 413 |||||| || |||||||| ||||||||||| |||| || | |||| || ||| ||| | Sbjct: 90 tggctttaaaatttgaaacgagcacattagtgtttcgtcaacactcatcatagcccctgc 31 Query: 414 attatcaaattccccacaataatt 437 |||||||||||| ||||||||||| Sbjct: 30 attatcaaattcgccacaataatt 7
>ref|NM_001011467.1| Xenopus tropicalis hypothetical LOC496958 (LOC496958), mRNA Length = 1183 Score = 56.0 bits (28), Expect = 2e-04 Identities = 94/116 (81%) Strand = Plus / Minus Query: 415 ttatcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcg 474 |||||||| || ||||||||||| ||||| ||||||| ||||| | |||| || Sbjct: 836 ttatcaaactctccacaataattgggagcagagaagagcgtgaccagctggcgcttggca 777 Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatc 530 ||||| || || |||||||| ||||||||||||||||| ||||| ||||| ||||| Sbjct: 776 aagaattcatacccatcttcaaccacctgatgggctcgacagatcagatctagatc 721
>gb|BT009603.1| Triticum aestivum clone wre1n.pk0081.a4:fis, full insert mRNA sequence Length = 1322 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| ||||| || || |||||||||||||||||||| Sbjct: 699 aagaactcgtagccatcctcaacaacctgatgggctcggcagat 656
>emb|X70848.1|HSPH1CAT H.sapiens mRNA for phosphatase 1 catalytic subunit Length = 1374 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 800 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 757
>gb|BT006629.1| Homo sapiens protein phosphatase 1, catalytic subunit, alpha isoform mRNA, complete cds Length = 993 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 773 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 730
>ref|NM_205122.1| Gallus gallus protein phosphatase 1, catalytic subunit, beta isoform (PPP1CB), mRNA Length = 1338 Score = 56.0 bits (28), Expect = 2e-04 Identities = 91/112 (81%) Strand = Plus / Minus Query: 407 cacctacattatcaaattccccacaataatttggagctgagaagattgtgactaatctcc 466 ||||| |||| ||||| || ||||||||||||||||||||||| | ||||| || || Sbjct: 1019 cacctgcattgtcaaactctccacaataatttggagctgagaatagggtgaccaactgcc 960 Query: 467 gctgtgcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 | | || ||||| ||||| |||||||| |||||||| || ||||| ||||| Sbjct: 959 gtttagcaaagaattcgtatccatcttcaaccacctggtgagctcgacagat 908
>emb|CR626815.1| full-length cDNA clone CS0DG007YO08 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1287 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 750 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 707
>emb|CR624648.1| full-length cDNA clone CS0DI029YN16 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1623 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 1086 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 1043
>dbj|AK127616.1| Homo sapiens cDNA FLJ45714 fis, clone FEKID2002637, highly similar to Serine/threonine protein phosphatase PP1-alpha 1 catalytic subunit (EC 3.1.3.16) Length = 1685 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 1113 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 1070
>emb|CR623343.1| full-length cDNA clone CS0DE005YB19 of Placenta of Homo sapiens (human) Length = 1425 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 857 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 814
>emb|CR621844.1| full-length cDNA clone CS0DM009YH11 of Fetal liver of Homo sapiens (human) Length = 1340 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 824 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 781
>emb|CR622044.1| full-length cDNA clone CS0DG002YP09 of B cells (Ramos cell line) of Homo sapiens (human) Length = 926 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 354 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 311
>emb|CR620164.1| full-length cDNA clone CS0DB009YD24 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 708 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 136 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 93
>dbj|AK098311.1| Homo sapiens cDNA FLJ40992 fis, clone UTERU2015202, highly similar to Human protein phosphatase I alpha subunit (PPPIA) mRNA Length = 2279 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 1705 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 1662
>emb|CR618840.1| full-length cDNA clone CS0DJ001YA13 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1412 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 844 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 801
>emb|CR618441.1| full-length cDNA clone CS0DI030YI19 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1359 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 815 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 772
>emb|CR618358.1| full-length cDNA clone CS0DB009YG01 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1401 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 847 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 804
>emb|CR616429.1| full-length cDNA clone CS0DC023YC16 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1629 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 1085 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 1042
>emb|CR614126.1| full-length cDNA clone CS0DL006YL21 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 1061 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 492 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 449
>emb|CR609547.1| full-length cDNA clone CS0DI028YB11 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1360 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 831 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 788
>emb|CR613010.1| full-length cDNA clone CS0DC016YF02 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1397 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 834 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 791
>emb|CR612914.1| full-length cDNA clone CS0DC028YO19 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1346 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 807 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 764
>emb|CR609689.1| full-length cDNA clone CS0DB004YB07 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1677 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 1123 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 1080
>emb|CR607767.1| full-length cDNA clone CS0DI077YG01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1437 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 866 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 823
>emb|CR607708.1| full-length cDNA clone CS0DI087YA09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1269 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 761 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 718
>emb|CR607154.1| full-length cDNA clone CS0DJ012YN16 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1366 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 810 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 767
>emb|CR606688.1| full-length cDNA clone CS0DB008YF03 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 817 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 245 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 202
>emb|CR600679.1| full-length cDNA clone CS0DI021YC04 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1369 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 808 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 765
>emb|CR598698.1| full-length cDNA clone CS0DJ006YM07 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1377 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 804 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 761
>emb|CR596128.1| full-length cDNA clone CS0DI001YF04 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1465 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 911 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 868
>emb|CR595463.1| full-length cDNA clone CS0DI064YC07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1375 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 844 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 801
>emb|CR595203.1| full-length cDNA clone CS0DI053YM03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 941 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 391 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 348
>emb|CR594609.1| full-length cDNA clone CS0DC009YH21 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 980 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 409 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 366
>emb|CR594209.1| full-length cDNA clone CS0DH004YD17 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1476 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 922 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 879
>emb|CR593308.1| full-length cDNA clone CS0DE010YI13 of Placenta of Homo sapiens (human) Length = 1303 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 820 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 777
>gb|AF383877.1|AF383877 Oryza sativa protein phosphatase mRNA, complete cds Length = 1428 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| |||||||| || |||||||||||||| ||||| Sbjct: 1045 aagaactcgtacccatcttcgacaacctgatgggctcgacagat 1002
>gb|AY889979.1| Synthetic construct Homo sapiens clone FLH026428.01X protein phosphatase 1 catalytic subunit alpha isoform (PPP1CA) mRNA, complete cds Length = 993 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 773 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 730
>dbj|AK120439.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H20, full insert sequence Length = 1525 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| |||||||| || |||||||||||||| ||||| Sbjct: 1017 aagaactcgtacccatcttcgacaacctgatgggctcgacagat 974
>emb|CR760533.2| Xenopus tropicalis finished cDNA, clone TEgg049h05 Length = 1261 Score = 56.0 bits (28), Expect = 2e-04 Identities = 94/116 (81%) Strand = Plus / Minus Query: 415 ttatcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcg 474 |||||||| || ||||||||||| ||||| ||||||| ||||| | |||| || Sbjct: 930 ttatcaaactctccacaataattgggagcagagaagagcgtgaccagctggcgcttggca 871 Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatc 530 ||||| || || |||||||| ||||||||||||||||| ||||| ||||| ||||| Sbjct: 870 aagaattcatacccatcttcaaccacctgatgggctcgacagatcagatctagatc 815
>gb|BC088594.1| Xenopus tropicalis hypothetical LOC496958, mRNA (cDNA clone MGC:97826 IMAGE:6992035), complete cds Length = 1183 Score = 56.0 bits (28), Expect = 2e-04 Identities = 94/116 (81%) Strand = Plus / Minus Query: 415 ttatcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcg 474 |||||||| || ||||||||||| ||||| ||||||| ||||| | |||| || Sbjct: 836 ttatcaaactctccacaataattgggagcagagaagagcgtgaccagctggcgcttggca 777 Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatc 530 ||||| || || |||||||| ||||||||||||||||| ||||| ||||| ||||| Sbjct: 776 aagaattcatacccatcttcaaccacctgatgggctcgacagatcagatctagatc 721
>gb|J04759.1|HUMPPPIA Human protein phosphatase I alpha subunit (PPPIA) mRNA, 3' end Length = 1080 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||| || |||||||||||||| || ||||||||||| Sbjct: 707 aagaactcgtagccgtcttctaccacctggtgtgctcggcagat 664
>dbj|D37987.1|CHK130KDC Chicken mRNA for catalytic subunit of chicken gizzard type-1 delta protein phosphatase, complete cds Length = 1338 Score = 56.0 bits (28), Expect = 2e-04 Identities = 91/112 (81%) Strand = Plus / Minus Query: 407 cacctacattatcaaattccccacaataatttggagctgagaagattgtgactaatctcc 466 ||||| |||| ||||| || ||||||||||||||||||||||| | ||||| || || Sbjct: 1019 cacctgcattgtcaaactctccacaataatttggagctgagaatagggtgaccaactgcc 960 Query: 467 gctgtgcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 | | || ||||| ||||| |||||||| |||||||| || ||||| ||||| Sbjct: 959 gtttagcaaagaattcgtatccatcttcaaccacctggtgagctcgacagat 908
>gb|BT014500.1| Lycopersicon esculentum clone 133871R, mRNA sequence Length = 1419 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 413 cattatcaaattccccacaataatttggagctgagaagattgt 455 ||||||||||||| ||||||||||| |||||||| || ||||| Sbjct: 918 cattatcaaattcgccacaataattaggagctgaaaaaattgt 876 Score = 50.1 bits (25), Expect = 0.010 Identities = 46/53 (86%) Strand = Plus / Minus Query: 478 aactcgtaaccatcttctaccacctgatgggctcggcagataagatcaagatc 530 |||||||| |||||||| || ||||| ||||| || || |||||||||||||| Sbjct: 853 aactcgtatccatcttccacaacctggtgggcacgacaaataagatcaagatc 801
>emb|CR660502.2|CNS0F8M4 Tetraodon nigroviridis full-length cDNA Length = 925 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 712 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 666
>emb|CR733855.2|CNS0GT0U Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR730990.2|CNS0GQZ7 Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR729803.2|CNS0GQ29 Tetraodon nigroviridis full-length cDNA Length = 891 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR727530.2|CNS0GOB4 Tetraodon nigroviridis full-length cDNA Length = 918 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 705 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 659
>emb|CR727041.2|CNS0GNXJ Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR726479.2|CNS0GNHX Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR721766.2|CNS0GJV0 Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR721613.2|CNS0GJQR Tetraodon nigroviridis full-length cDNA Length = 879 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 666 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 620
>emb|CR701963.3|CNS0G4L3 Tetraodon nigroviridis full-length cDNA Length = 639 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 531 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 485
>emb|CR701829.2|CNS0G4HD Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR691392.2|CNS0FWFG Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR699356.2|CNS0G2KO Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR697549.2|CNS0G16H Tetraodon nigroviridis full-length cDNA Length = 936 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR693974.2|CNS0FYF6 Tetraodon nigroviridis full-length cDNA Length = 917 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 704 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 658
>emb|CR693028.2|CNS0FXOW Tetraodon nigroviridis full-length cDNA Length = 917 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 705 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 659
>emb|CR692390.2|CNS0FX76 Tetraodon nigroviridis full-length cDNA Length = 860 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 648 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 602
>emb|CR692245.2|CNS0FX35 Tetraodon nigroviridis full-length cDNA Length = 883 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 671 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 625
>emb|CR691671.2|CNS0FWN7 Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR688331.2|CNS0FU2F Tetraodon nigroviridis full-length cDNA Length = 858 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 646 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 600
>emb|CR689849.2|CNS0FV8L Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR689586.2|CNS0FV1A Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR689091.2|CNS0FUNJ Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR685049.3|CNS0FRJ9 Tetraodon nigroviridis full-length cDNA Length = 913 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 707 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 661
>emb|CR681056.2|CNS0FOGC Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 711 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 665
>emb|CR681365.2|CNS0FOOX Tetraodon nigroviridis full-length cDNA Length = 591 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 485 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 439
>emb|CR680660.2|CNS0FO5C Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR680623.2|CNS0FO4B Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR680390.2|CNS0FNXU Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR680305.2|CNS0FNVH Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 711 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 665
>emb|CR680175.2|CNS0FNRV Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 712 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 666
>emb|CR680167.2|CNS0FNRN Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR679872.2|CNS0FNJG Tetraodon nigroviridis full-length cDNA Length = 921 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR679801.2|CNS0FNHH Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 721 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 675
>emb|CR679379.2|CNS0FN5R Tetraodon nigroviridis full-length cDNA Length = 920 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 705 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 659
>emb|CR679370.2|CNS0FN5I Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 711 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 665
>emb|CR678870.2|CNS0FMRM Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR678865.2|CNS0FMRH Tetraodon nigroviridis full-length cDNA Length = 514 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 184 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 138
>emb|CR678952.2|CNS0FMTW Tetraodon nigroviridis full-length cDNA Length = 919 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 706 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 660
>emb|CR678280.2|CNS0FMBF Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR678543.3|CNS0FMIJ Tetraodon nigroviridis full-length cDNA Length = 920 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 708 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 662
>emb|CR678298.3|CNS0FMBX Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR677946.2|CNS0FM2A Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 711 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 665
>emb|CR676685.3|CNS0FL3D Tetraodon nigroviridis full-length cDNA Length = 491 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 185 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 139
>emb|CR676453.2|CNS0FKWX Tetraodon nigroviridis full-length cDNA Length = 894 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR676714.2|CNS0FL46 Tetraodon nigroviridis full-length cDNA Length = 925 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR675899.2|CNS0FKHT Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 711 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 665
>emb|CR675236.2|CNS0FJZE Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR675005.2|CNS0FJSZ Tetraodon nigroviridis full-length cDNA Length = 933 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR674451.2|CNS0FJDL Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR674342.2|CNS0FJAK Tetraodon nigroviridis full-length cDNA Length = 941 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 729 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 683
>emb|CR674214.2|CNS0FJ70 Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 721 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 675
>emb|CR674103.2|CNS0FJ3X Tetraodon nigroviridis full-length cDNA Length = 921 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR674025.2|CNS0FJ1R Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR674008.2|CNS0FJ1A Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR673790.2|CNS0FIV8 Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR673374.2|CNS0FIJO Tetraodon nigroviridis full-length cDNA Length = 921 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR673352.2|CNS0FIJ2 Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 712 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 666
>emb|CR673326.2|CNS0FIIC Tetraodon nigroviridis full-length cDNA Length = 917 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 705 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 659
>emb|CR673215.2|CNS0FIF9 Tetraodon nigroviridis full-length cDNA Length = 925 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 712 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 666
>emb|CR672823.2|CNS0FI4D Tetraodon nigroviridis full-length cDNA Length = 921 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR672682.2|CNS0FI0G Tetraodon nigroviridis full-length cDNA Length = 881 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR672865.2|CNS0FI5J Tetraodon nigroviridis full-length cDNA Length = 784 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 572 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 526
>emb|CR672619.2|CNS0FHYP Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR672553.2|CNS0FHWV Tetraodon nigroviridis full-length cDNA Length = 928 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 716 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 670
>emb|CR672484.2|CNS0FHUY Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 723 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 677
>emb|CR672353.2|CNS0FHRB Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR671756.2|CNS0FHAQ Tetraodon nigroviridis full-length cDNA Length = 938 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR671874.3|CNS0FHE0 Tetraodon nigroviridis full-length cDNA Length = 518 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 183 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 137
>emb|CR671101.2|CNS0FGSJ Tetraodon nigroviridis full-length cDNA Length = 925 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 711 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 665
>emb|CR671494.2|CNS0FH3G Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR671233.2|CNS0FGW7 Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR671197.2|CNS0FGV7 Tetraodon nigroviridis full-length cDNA Length = 916 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR670468.2|CNS0FGAY Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR670329.2|CNS0FG73 Tetraodon nigroviridis full-length cDNA Length = 936 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR670218.2|CNS0FG40 Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR670188.2|CNS0FG36 Tetraodon nigroviridis full-length cDNA Length = 917 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 704 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 658
>emb|CR669836.2|CNS0FFTE Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR669690.2|CNS0FFPC Tetraodon nigroviridis full-length cDNA Length = 936 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR669672.2|CNS0FFOU Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR669215.2|CNS0FFC5 Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR668755.2|CNS0FEZD Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR667838.3|CNS0FE9W Tetraodon nigroviridis full-length cDNA Length = 533 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 187 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 141
>emb|CR668083.2|CNS0FEGP Tetraodon nigroviridis full-length cDNA Length = 921 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR667954.2|CNS0FED4 Tetraodon nigroviridis full-length cDNA Length = 794 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 692 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 646
>emb|CR666776.3|CNS0FDGE Tetraodon nigroviridis full-length cDNA Length = 524 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 184 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 138
>emb|CR666947.2|CNS0FDL5 Tetraodon nigroviridis full-length cDNA Length = 775 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 563 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 517
>emb|CR666719.2|CNS0FDET Tetraodon nigroviridis full-length cDNA Length = 916 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 702 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 656
>emb|CR666616.2|CNS0FDBY Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR666500.2|CNS0FD8Q Tetraodon nigroviridis full-length cDNA Length = 925 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 711 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 665
>emb|CR666389.2|CNS0FD5N Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR665997.2|CNS0FCUR Tetraodon nigroviridis full-length cDNA Length = 698 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 485 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 439
>emb|CR665888.2|CNS0FCRQ Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 723 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 677
>emb|CR665400.3|CNS0FCE6 Tetraodon nigroviridis full-length cDNA Length = 553 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 184 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 138
>emb|CR665637.2|CNS0FCKR Tetraodon nigroviridis full-length cDNA Length = 920 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 706 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 660
>emb|CR665603.2|CNS0FCJT Tetraodon nigroviridis full-length cDNA Length = 939 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 723 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 677
>emb|CR665049.2|CNS0FC4F Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR664945.2|CNS0FC1J Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR664912.2|CNS0FC0M Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR664161.2|CNS0FBFR Tetraodon nigroviridis full-length cDNA Length = 936 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR663346.3|CNS0FAT4 Tetraodon nigroviridis full-length cDNA Length = 553 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 184 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 138
>emb|CR663270.2|CNS0FAR0 Tetraodon nigroviridis full-length cDNA Length = 917 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 704 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 658
>emb|CR662817.3|CNS0FAEF Tetraodon nigroviridis full-length cDNA Length = 478 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 182 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 136
>emb|CR662896.2|CNS0FAGM Tetraodon nigroviridis full-length cDNA Length = 921 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR662796.2|CNS0FADU Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR662386.2|CNS0FA2G Tetraodon nigroviridis full-length cDNA Length = 936 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 723 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 677
>emb|CR662139.2|CNS0F9VL Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR661692.2|CNS0F9J6 Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR661571.2|CNS0F9FT Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR661302.3|CNS0F98C Tetraodon nigroviridis full-length cDNA Length = 522 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 186 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 140
>emb|CR661280.2|CNS0F97Q Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR661275.2|CNS0F97L Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR660829.2|CNS0F8V7 Tetraodon nigroviridis full-length cDNA Length = 934 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR658075.2|CNS0F6QP Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR660516.2|CNS0F8MI Tetraodon nigroviridis full-length cDNA Length = 935 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 722 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 676
>emb|CR660474.2|CNS0F8LC Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR660345.2|CNS0F8HR Tetraodon nigroviridis full-length cDNA Length = 925 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 712 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 666
>emb|CR659326.2|CNS0F7PG Tetraodon nigroviridis full-length cDNA Length = 925 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 721 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 675
>emb|CR659270.2|CNS0F7NW Tetraodon nigroviridis full-length cDNA Length = 521 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 149 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 103
>emb|CR659506.2|CNS0F7UG Tetraodon nigroviridis full-length cDNA Length = 918 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 705 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 659
>emb|CR659414.3|CNS0F7RW Tetraodon nigroviridis full-length cDNA Length = 917 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 704 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 658
>emb|CR659373.2|CNS0F7QR Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR658715.2|CNS0F78H Tetraodon nigroviridis full-length cDNA Length = 937 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 725 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 679
>emb|CR658638.2|CNS0F76C Tetraodon nigroviridis full-length cDNA Length = 920 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 708 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 662
>emb|CR658123.2|CNS0F6S1 Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR657857.2|CNS0F6KN Tetraodon nigroviridis full-length cDNA Length = 923 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR657060.2|CNS0F5YI Tetraodon nigroviridis full-length cDNA Length = 829 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 720 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 674
>emb|CR657052.3|CNS0F5YA Tetraodon nigroviridis full-length cDNA Length = 920 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 708 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 662
>emb|CR656950.2|CNS0F5VG Tetraodon nigroviridis full-length cDNA Length = 925 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 710 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664
>emb|CR656807.2|CNS0F5RH Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 663
>emb|CR653153.2|CNS0F2XZ Tetraodon nigroviridis full-length cDNA Length = 924 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 711 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 665
>emb|CR638860.2|CNS0ERWY Tetraodon nigroviridis full-length cDNA Length = 922 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 |||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 708 gcgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 662
>emb|AL035263.1|SPBC776 S.pombe chromosome II cosmid c776 Length = 42391 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 474 gaagaactcgtaaccatcttctaccacctgatgggctcggcagataagatc 524 ||||||||| ||||| ||||| || ||||||||||||||||| | |||||| Sbjct: 1916 gaagaactcataaccgtcttccacaacctgatgggctcggcaaacaagatc 1966 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 621 aggatcagaccaaagcaaatcaca 644 ||||||||||||||| |||||||| Sbjct: 2063 aggatcagaccaaagtaaatcaca 2086
>ref|NM_001022239.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC776.02c), partial mRNA Length = 984 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 474 gaagaactcgtaaccatcttctaccacctgatgggctcggcagataagatc 524 ||||||||| ||||| ||||| || ||||||||||||||||| | |||||| Sbjct: 771 gaagaactcataaccgtcttccacaacctgatgggctcggcaaacaagatc 721 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcaca 644 ||||||||||||||| |||||||| Sbjct: 624 aggatcagaccaaagtaaatcaca 601
>gb|AY107057.1| Zea mays PCO094064 mRNA sequence Length = 847 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 472 gcgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||| ||||| || |||||||| || |||||||||||||||||||| Sbjct: 235 gcgaaaaactcatatccatcttcgacaacctgatgggctcggcagat 189
>gb|M27068.1|YSPDIS2A Schizosaccharomyces pombe putative protein phosphatase type 1 (dis2+) gene, complete cds Length = 2417 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 474 gaagaactcgtaaccatcttctaccacctgatgggctcggcagataagatc 524 ||||||||| ||||| ||||| || ||||||||||||||||| | |||||| Sbjct: 1804 gaagaactcataaccgtcttccacaacctgatgggctcggcaaacaagatc 1754 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcaca 644 ||||||||||||||| |||||||| Sbjct: 1657 aggatcagaccaaagtaaatcaca 1634
>gb|M27075.1|YSPBSW1A Schizosaccharomyces pombe protein phosphatase type 1 (bws1+) gene, complete cds Length = 2467 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 474 gaagaactcgtaaccatcttctaccacctgatgggctcggcagataagatc 524 ||||||||| ||||| ||||| || ||||||||||||||||| | |||||| Sbjct: 1548 gaagaactcataaccgtcttccacaacctgatgggctcggcaaacaagatc 1498 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 621 aggatcagaccaaagcaaatcaca 644 ||||||||||||||| |||||||| Sbjct: 1401 aggatcagaccaaagtaaatcaca 1378
>gb|L26482.1|PARPP1B Paramecium tetraurelia macronuclear phosphoprotein phosphatase 1 isozyme omega-2 gene, complete cds Length = 1673 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 408 acctacattatcaaattccccacaataatttggagctgagaagattgtgactaat 462 |||| |||| |||||||| ||||||||||| |||||||| || | |||||||||| Sbjct: 1237 acctgcattgtcaaattcaccacaataattgggagctgaaaatagtgtgactaat 1183
>ref|NM_013065.2| Rattus norvegicus protein phosphatase 1, catalytic subunit, beta isoform (Ppp1cb), mRNA Length = 2942 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 487 ccatcttctaccacctgatgggctcg 512 |||||||||||||||||||||||||| Sbjct: 1022 ccatcttctaccacctgatgggctcg 997
>gb|BC062033.1| Rattus norvegicus protein phosphatase 1, catalytic subunit, beta isoform, mRNA (cDNA clone MGC:72523 IMAGE:5623630), complete cds Length = 2942 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 487 ccatcttctaccacctgatgggctcg 512 |||||||||||||||||||||||||| Sbjct: 1022 ccatcttctaccacctgatgggctcg 997
>ref|NM_212710.1| Danio rerio zgc:76940 (zgc:76940), mRNA Length = 2263 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatc 524 ||||||||||| ||||| || |||||||||||||||| ||| || ||||| Sbjct: 1014 aagaactcgtagccatcctccaccacctgatgggctctgcatatgagatc 965
>emb|Z73974.1|CEF29F11 Caenorhabditis elegans Cosmid F29F11, complete sequence Length = 36258 Score = 52.0 bits (26), Expect = 0.002 Identities = 89/110 (80%) Strand = Plus / Minus Query: 415 ttatcaaattccccacaataatttggagctgagaagattgtgactaatctccgctgtgcg 474 ||||| ||||| ||||||||||||||||| ||||| | |||||| | | |||| || Sbjct: 29511 ttatcgaattctccacaataatttggagcagagaatagtgtgacaagttgtcgcttagca 29452 Query: 475 aagaactcgtaaccatcttctaccacctgatgggctcggcagataagatc 524 |||||||| || |||||||| || |||||||| |||| ||| || ||||| Sbjct: 29451 aagaactcatatccatcttcgacgacctgatgagctctgcatatcagatc 29402
>emb|CR689832.2|CNS0FV84 Tetraodon nigroviridis full-length cDNA Length = 916 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 473 cgaagaactcgtaaccatcttctaccacctgatgggctcggcagat 518 ||||||||||||| || ||||| |||||||| ||||||| |||||| Sbjct: 709 cgaagaactcgtagccgtcttcaaccacctggtgggctctgcagat 664 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,597,566 Number of Sequences: 3902068 Number of extensions: 6597566 Number of successful extensions: 121010 Number of sequences better than 10.0: 494 Number of HSP's better than 10.0 without gapping: 489 Number of HSP's successfully gapped in prelim test: 5 Number of HSP's that attempted gapping in prelim test: 120074 Number of HSP's gapped (non-prelim): 933 length of query: 673 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 650 effective length of database: 17,143,297,704 effective search space: 11143143507600 effective search space used: 11143143507600 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)