>gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome 5, complete sequence
          Length = 224181

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 437    aacattttatgagatggttctct 459
              |||||||||||||||||||||||
Sbjct: 104826 aacattttatgagatggttctct 104804

>gb|AC116567.5| Mus musculus BAC clone RP23-1M9 from 5, complete sequence
          Length = 206570

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 437   aacattttatgagatggttctct 459
             |||||||||||||||||||||||
Sbjct: 57079 aacattttatgagatggttctct 57101

>emb|CR352237.9| Zebrafish DNA sequence from clone CH211-13I11 in linkage group 11,
            complete sequence
          Length = 193648

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 427  cacaaaaaacaacattttatgagatg 452
            |||||||||||||| |||||||||||
Sbjct: 7979 cacaaaaaacaacactttatgagatg 8004

>emb|BX936343.9| Zebrafish DNA sequence from clone CH211-51C14 in linkage group 3,
              complete sequence
          Length = 160177

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 425    accacaaaaaacaacatttta 445
              |||||||||||||||||||||
Sbjct: 104752 accacaaaaaacaacatttta 104772

>gb|AC016727.10| Homo sapiens BAC clone RP11-355B11 from 2, complete sequence
          Length = 159692

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 576   ttttggtgcaggtggcggcgg 596
             |||||||||||||||||||||
Sbjct: 88925 ttttggtgcaggtggcggcgg 88905

>gb|AC150421.2| Branchiostoma floridae clone CH302-78B15, complete sequence
          Length = 159541

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   agaaattctgctgccaggaa 145
             ||||||||||||||||||||
Sbjct: 84840 agaaattctgctgccaggaa 84821

>gb|AC006626.1| Caenorhabditis elegans cosmid CC8, complete sequence
          Length = 14400

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 429  caaaaaacaacattttatga 448
            ||||||||||||||||||||
Sbjct: 2199 caaaaaacaacattttatga 2218

>gb|AC147387.2| Pan troglodytes BAC clone RP43-143N10 from 7, complete sequence
          Length = 173662

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 479    aaagaagatacattctgaaa 498
              ||||||||||||||||||||
Sbjct: 114395 aaagaagatacattctgaaa 114376

>gb|AC094950.6| Rattus norvegicus 14 BAC CH230-6H12 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 237532

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 212  tggctggcagctctctccca 231
            ||||||||||||||||||||
Sbjct: 6419 tggctggcagctctctccca 6400

>emb|CT010524.6| Mouse DNA sequence from clone RP23-341L7 on chromosome 16, complete
              sequence
          Length = 233599

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 199    tggtgacatccaatggctgg 218
              ||||||||||||||||||||
Sbjct: 223354 tggtgacatccaatggctgg 223335

>ref|XM_808020.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053506155.40) partial mRNA
          Length = 1797

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 573 agcttttggtgcaggtggcggcgg 596
           ||||||||| ||||||||||||||
Sbjct: 914 agcttttggagcaggtggcggcgg 937

>gb|AF451953.1| Pantoea agglomerans D-alanylgriseoluteic acid synthesis gene cluster,
            complete sequence
          Length = 14924

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 359  cataaattctcgattacgaa 378
            ||||||||||||||||||||
Sbjct: 1213 cataaattctcgattacgaa 1194

>gb|AC115283.3| Homo sapiens chromosome 3 clone RP11-632K8, complete sequence
          Length = 193486

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 123    actagaaattctgctgccag 142
              ||||||||||||||||||||
Sbjct: 118093 actagaaattctgctgccag 118112

>emb|AL158064.16| Human DNA sequence from clone RP11-470M1 on chromosome 13, complete
             sequence
          Length = 160587

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 491   ttctgaaagacatgtatgtg 510
             ||||||||||||||||||||
Sbjct: 43844 ttctgaaagacatgtatgtg 43825

>emb|BX284645.3| Mouse DNA sequence from clone RP24-320J23 on chromosome 11 Contains
            the 3' end of a variant of the Cdkl3 gene for
            cyclin-dependent kinase-like 3, complete sequence
          Length = 3994

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 212  tggctggcagctctctccca 231
            ||||||||||||||||||||
Sbjct: 1892 tggctggcagctctctccca 1873

>emb|AL929351.1|PFA929351 Plasmodium falciparum strain 3D7, chromosome 5, segment 1/4
          Length = 347050

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 490    attctgaaagacatgtatgt 509
              ||||||||||||||||||||
Sbjct: 333942 attctgaaagacatgtatgt 333923

>gb|AC148407.2| Xenopus tropicalisBAC clone ISB1-124I14 containing the sox11 gene,
             complete cds, complete sequence
          Length = 85265

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 501   catgtatgtgtttgcctctg 520
             ||||||||||||||||||||
Sbjct: 45536 catgtatgtgtttgcctctg 45555

>gb|AC114759.3| Homo sapiens BAC clone RP11-347K3 from 4, complete sequence
          Length = 80436

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 439   cattttatgagatggttctc 458
             ||||||||||||||||||||
Sbjct: 10259 cattttatgagatggttctc 10278

>emb|BX537276.5| Zebrafish DNA sequence from clone DKEYP-57A10 in linkage group 3,
             complete sequence
          Length = 165427

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 65    aatagtccacattaacagca 84
             ||||||||||||||||||||
Sbjct: 12523 aatagtccacattaacagca 12542

>gb|AC012499.8| Homo sapiens BAC clone RP11-428I14 from 2, complete sequence
          Length = 183436

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 312   tatacctatgaattttactg 331
             ||||||||||||||||||||
Sbjct: 90820 tatacctatgaattttactg 90801

>gb|AF463770.1| Mus musculus strain C57BL/6J cytokine gene cluster, partial sequence
          Length = 56726

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   tggctggcagctctctccca 231
             ||||||||||||||||||||
Sbjct: 46806 tggctggcagctctctccca 46787

>gb|AC008038.1|AC008038 Homo sapiens clone RP11-371A22 from 7q31, complete sequence
          Length = 202945

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 479   aaagaagatacattctgaaa 498
             ||||||||||||||||||||
Sbjct: 74239 aaagaagatacattctgaaa 74220

>gb|AF111170.3|AF111170 Homo sapiens 14q32 Jagged2 gene, complete cds; and unknown gene
          Length = 148083

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 256   aatgccaccacggcctccac 275
             ||||||||||||||||||||
Sbjct: 91716 aatgccaccacggcctccac 91697

>emb|AL512355.6|CNS07EF4 Human chromosome 14 DNA sequence BAC R-1087P8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 198273

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 256   aatgccaccacggcctccac 275
             ||||||||||||||||||||
Sbjct: 41480 aatgccaccacggcctccac 41499

>gb|AC154609.2| Mus musculus BAC clone RP23-334N13 from 16, complete sequence
          Length = 202556

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 199   tggtgacatccaatggctgg 218
             ||||||||||||||||||||
Sbjct: 17194 tggtgacatccaatggctgg 17175

>emb|AL669920.15| Mouse DNA sequence from clone RP23-263C23 on chromosome 11, complete
              sequence
          Length = 216776

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    tggctggcagctctctccca 231
              ||||||||||||||||||||
Sbjct: 216668 tggctggcagctctctccca 216649

>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome
          Length = 2256640

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 200     ggtgacatccaatggctggc 219
               ||||||||||||||||||||
Sbjct: 1071527 ggtgacatccaatggctggc 1071508

>emb|AL928737.8| Mouse DNA sequence from clone RP23-382O14 on chromosome 2, complete
              sequence
          Length = 237175

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 410    ctgagcatggcaagcaccac 429
              ||||||||||||||||||||
Sbjct: 187190 ctgagcatggcaagcaccac 187209


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,786,074
Number of Sequences: 3902068
Number of extensions: 5786074
Number of successful extensions: 109169
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 109099
Number of HSP's gapped (non-prelim): 70
length of query: 606
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 583
effective length of database: 17,143,297,704
effective search space: 9994542561432
effective search space used: 9994542561432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)