>gb|BT009171.1| Triticum aestivum clone wl1n.pk0105.h9:fis, full insert mRNA sequence
          Length = 1468

 Score =  107 bits (54), Expect = 8e-21
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                        
Query: 1    gggcacgaagggcatcttggtgacgaccgcgtcgtactgcttgccgcggacgaccacctt 60
            ||||||||| |||||||||||||| || ||||||||   ||| ||||| |||||||||||
Sbjct: 1241 gggcacgaacggcatcttggtgaccacggcgtcgtaggacttcccgcgaacgaccacctt 1182

                                                                        
Query: 61   gaactccgtgccggccttgngcagncngttcttnacgtaccccatggcgatgttcttctt 120
             |||||||| || |||||| |||  |    ||| ||||| ||||| ||||||||||||||
Sbjct: 1181 caactccgtcccagccttgtgcattcccgacttcacgtagcccatagcgatgttcttctt 1122

                          
Query: 121  caggcacgggctga 134
            ||||||||||||||
Sbjct: 1121 caggcacgggctga 1108

>gb|AY110998.1| Zea mays CL371_1 mRNA sequence
          Length = 1475

 Score =  107 bits (54), Expect = 8e-21
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                        
Query: 1    gggcacgaagggcatcttggtgacgaccgcgtcgtactgcttgccgcggacgaccacctt 60
            ||||||||| |||||||||||||| || ||||||||   ||| ||||| |||||||||||
Sbjct: 1271 gggcacgaacggcatcttggtgaccacggcgtcgtaggacttcccgcgaacgaccacctt 1212

                                                                        
Query: 61   gaactccgtgccggccttgngcagncngttcttnacgtaccccatggcgatgttcttctt 120
             |||||||| || |||||| |||  |    ||| ||||| ||||| ||||||||||||||
Sbjct: 1211 caactccgtcccagccttgtgcattcccgacttcacgtagcccatagcgatgttcttctt 1152

                          
Query: 121  caggcacgggctga 134
            ||||||||||||||
Sbjct: 1151 caggcacgggctga 1138

>ref|XM_473945.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1227

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 110/133 (82%)
 Strand = Plus / Minus

                                                                        
Query: 2    ggcacgaagggcatcttggtgacgaccgcgtcgtactgcttgccgcggacgaccaccttg 61
            |||||||| ||||||||||||||||| || |||||   ||| || |||||||| ||||||
Sbjct: 1202 ggcacgaacggcatcttggtgacgacggcatcgtaggacttcccacggacgacaaccttg 1143

                                                                        
Query: 62   aactccgtgccggccttgngcagncngttcttnacgtaccccatggcgatgttcttcttc 121
            ||||| || || |||||| |||  | |   || ||||| |||||||||||||||||||||
Sbjct: 1142 aactctgtcccagccttgtgcaaaccggattttacgtagcccatggcgatgttcttcttc 1083

                         
Query: 122  aggcacgggctga 134
            | ||| |||||||
Sbjct: 1082 aagcaggggctga 1070

>emb|AL606645.2|OSJN00079 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0053K19,
             complete sequence
          Length = 187601

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 110/133 (82%)
 Strand = Plus / Minus

                                                                         
Query: 2     ggcacgaagggcatcttggtgacgaccgcgtcgtactgcttgccgcggacgaccaccttg 61
             |||||||| ||||||||||||||||| || |||||   ||| || |||||||| ||||||
Sbjct: 70582 ggcacgaacggcatcttggtgacgacggcatcgtaggacttcccacggacgacaaccttg 70523

                                                                         
Query: 62    aactccgtgccggccttgngcagncngttcttnacgtaccccatggcgatgttcttcttc 121
             ||||| || || |||||| |||  | |   || ||||| |||||||||||||||||||||
Sbjct: 70522 aactctgtcccagccttgtgcaaaccggattttacgtagcccatggcgatgttcttcttc 70463

                          
Query: 122   aggcacgggctga 134
             | ||| |||||||
Sbjct: 70462 aagcaggggctga 70450

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 110/133 (82%)
 Strand = Plus / Minus

                                                                            
Query: 2        ggcacgaagggcatcttggtgacgaccgcgtcgtactgcttgccgcggacgaccaccttg 61
                |||||||| ||||||||||||||||| || |||||   ||| || |||||||| ||||||
Sbjct: 31737312 ggcacgaacggcatcttggtgacgacggcatcgtaggacttcccacggacgacaaccttg 31737253

                                                                            
Query: 62       aactccgtgccggccttgngcagncngttcttnacgtaccccatggcgatgttcttcttc 121
                ||||| || || |||||| |||  | |   || ||||| |||||||||||||||||||||
Sbjct: 31737252 aactctgtcccagccttgtgcaaaccggattttacgtagcccatggcgatgttcttcttc 31737193

                             
Query: 122      aggcacgggctga 134
                | ||| |||||||
Sbjct: 31737192 aagcaggggctga 31737180

>dbj|AK099234.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106I02, full
            insert sequence
          Length = 1430

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 110/133 (82%)
 Strand = Plus / Minus

                                                                        
Query: 2    ggcacgaagggcatcttggtgacgaccgcgtcgtactgcttgccgcggacgaccaccttg 61
            |||||||| ||||||||||||||||| || |||||   ||| || |||||||| ||||||
Sbjct: 1247 ggcacgaacggcatcttggtgacgacggcatcgtaggacttcccacggacgacaaccttg 1188

                                                                        
Query: 62   aactccgtgccggccttgngcagncngttcttnacgtaccccatggcgatgttcttcttc 121
            ||||| || || |||||| |||  | |   || ||||| |||||||||||||||||||||
Sbjct: 1187 aactctgtcccagccttgtgcaaaccggattttacgtagcccatggcgatgttcttcttc 1128

                         
Query: 122  aggcacgggctga 134
            | ||| |||||||
Sbjct: 1127 aagcaggggctga 1115

>dbj|AK059270.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-B08, full
           insert sequence
          Length = 994

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 110/133 (82%)
 Strand = Plus / Minus

                                                                       
Query: 2   ggcacgaagggcatcttggtgacgaccgcgtcgtactgcttgccgcggacgaccaccttg 61
           |||||||| ||||||||||||||||| || |||||   ||| || |||||||| ||||||
Sbjct: 797 ggcacgaacggcatcttggtgacgacggcatcgtaggacttcccacggacgacaaccttg 738

                                                                       
Query: 62  aactccgtgccggccttgngcagncngttcttnacgtaccccatggcgatgttcttcttc 121
           ||||| || || |||||| |||  | |   || ||||| |||||||||||||||||||||
Sbjct: 737 aactctgtcccagccttgtgcaaaccggattttacgtagcccatggcgatgttcttcttc 678

                        
Query: 122 aggcacgggctga 134
           | ||| |||||||
Sbjct: 677 aagcaggggctga 665

>emb|Z99769.1|FTZ99769 Flaveria trinervia GDCST gene
          Length = 5817

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 91   cttnacgtaccccatggcgatgttcttcttcaggcacgggct 132
            ||| |||||||||||| | ||||||||||||| |||||||||
Sbjct: 4849 cttcacgtaccccatgcctatgttcttcttcaagcacgggct 4808

>emb|CR385258.1| Gallus gallus finished cDNA, clone ChEST548a3
          Length = 971

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 1   gggcacgaagggcatcttggtgac 24
           ||||||||||||||||||||||||
Sbjct: 916 gggcacgaagggcatcttggtgac 893



 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 95  acgtaccccatggcgatgttctt 117
           ||||| |||||||||||||||||
Sbjct: 822 acgtagcccatggcgatgttctt 800

>ref|NM_204788.1| Gallus gallus T-protein (LOC395566), mRNA
          Length = 1228

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 1    gggcacgaagggcatcttggtgac 24
            ||||||||||||||||||||||||
Sbjct: 1174 gggcacgaagggcatcttggtgac 1151



 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 95   acgtaccccatggcgatgttctt 117
            ||||| |||||||||||||||||
Sbjct: 1080 acgtagcccatggcgatgttctt 1058

>dbj|D11162.1|CHKTP Gallus gallus mRNA for T-protein, complete cds
          Length = 1228

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 1    gggcacgaagggcatcttggtgac 24
            ||||||||||||||||||||||||
Sbjct: 1174 gggcacgaagggcatcttggtgac 1151



 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 95   acgtaccccatggcgatgttctt 117
            ||||| |||||||||||||||||
Sbjct: 1080 acgtagcccatggcgatgttctt 1058

>emb|Z25858.1|FPTSGDC F.pringlei mRNA for T subunit of glycine decarboxylase multi-enzyme
            complex
          Length = 1382

 Score = 46.1 bits (23), Expect = 0.026
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 98   taccccatggcgatgttcttcttcaggcacgggct 132
            ||||||||| | ||||||||||||| |||||||||
Sbjct: 1132 taccccatgcctatgttcttcttcaagcacgggct 1098

>ref|NM_101057.3| Arabidopsis thaliana aminomethyltransferase AT1G11860 transcript
            variant AT1G11860.1 mRNA, complete cds
          Length = 1581

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 101  cccatggcgatgttcttcttcagg 124
            |||||||| |||||||||||||||
Sbjct: 1260 cccatggctatgttcttcttcagg 1237

>ref|NM_179315.1| Arabidopsis thaliana aminomethyltransferase AT1G11860 transcript
            variant AT1G11860.2 mRNA, complete cds
          Length = 1582

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 101  cccatggcgatgttcttcttcagg 124
            |||||||| |||||||||||||||
Sbjct: 1261 cccatggctatgttcttcttcagg 1238

>ref|XM_362380.1| Magnaporthe grisea 70-15 hypothetical protein (MG04826.4) partial cds
          Length = 1395

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 7    gaagggcatcttggtgacgaccgc 30
            ||||||||||||||| ||||||||
Sbjct: 1365 gaagggcatcttggtcacgaccgc 1342

>emb|BX572607.1| Rhodopseudomonas palustris CGA009 complete genome; segment 15/16
          Length = 345012

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 12     gcatcttggtgacgaccgcgtcgt 35
              |||||||||||||| |||||||||
Sbjct: 274197 gcatcttggtgacggccgcgtcgt 274174

>gb|AY125509.1| Arabidopsis thaliana At1g11860/F12F1_30 mRNA, complete cds
          Length = 1478

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 101  cccatggcgatgttcttcttcagg 124
            |||||||| |||||||||||||||
Sbjct: 1206 cccatggctatgttcttcttcagg 1183

>gb|BT006361.1| Arabidopsis thaliana At1g11860/F12F1_30 gene, complete cds
          Length = 1227

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 101  cccatggcgatgttcttcttcagg 124
            |||||||| |||||||||||||||
Sbjct: 1103 cccatggctatgttcttcttcagg 1080

>emb|BX815798.1|CNS0ABJN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS9ZD02 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1374

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 101  cccatggcgatgttcttcttcagg 124
            |||||||| |||||||||||||||
Sbjct: 1106 cccatggctatgttcttcttcagg 1083

>emb|BX815440.1|CNS0ABEC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS60ZB04 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1514

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 101  cccatggcgatgttcttcttcagg 124
            |||||||| |||||||||||||||
Sbjct: 1260 cccatggctatgttcttcttcagg 1237

>emb|BX815010.1|CNS0ABD4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS23ZG07 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1405

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 101  cccatggcgatgttcttcttcagg 124
            |||||||| |||||||||||||||
Sbjct: 1147 cccatggctatgttcttcttcagg 1124

>emb|BX815758.1|CNS0AAGH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS91ZA02 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1460

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 101  cccatggcgatgttcttcttcagg 124
            |||||||| |||||||||||||||
Sbjct: 1190 cccatggctatgttcttcttcagg 1167

>gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 sequence, complete sequence
          Length = 123386

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 101    cccatggcgatgttcttcttcagg 124
              |||||||| |||||||||||||||
Sbjct: 111503 cccatggctatgttcttcttcagg 111526

>gb|AY288068.2| Paracoccidioides brasiliensis malate dehydrogenase mRNA, complete
            cds; nuclear gene for mitochondrial product
          Length = 1735

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 105  tggcgatgttcttcttcag 123
            |||||||||||||||||||
Sbjct: 1273 tggcgatgttcttcttcag 1255

>ref|XM_799931.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053504167.7) partial mRNA
          Length = 594

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 107 gcgatgttcttcttcaggc 125
           |||||||||||||||||||
Sbjct: 179 gcgatgttcttcttcaggc 197

>ref|XM_801634.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053508233.19) partial mRNA
          Length = 594

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 107 gcgatgttcttcttcaggc 125
           |||||||||||||||||||
Sbjct: 179 gcgatgttcttcttcaggc 197

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 103     catggcgatgttcttcttcaggc 125
               ||||||||||||| |||||||||
Sbjct: 1445212 catggcgatgttcctcttcaggc 1445234

>emb|AL691476.12| Mouse DNA sequence from clone RP23-219D8 on chromosome 11 Contains a
             chaperonin subunit 3 (gamma) (Cct3) pseudogene and the 3'
             end of a novel gene, complete sequence
          Length = 177256

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 109   gatgttcttcttcaggcac 127
             |||||||||||||||||||
Sbjct: 34915 gatgttcttcttcaggcac 34933

>gb|AE012520.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 428
           of 460 of the complete genome
          Length = 11484

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  gcgtcgtactgcttgccgc 47
           |||||||||||||||||||
Sbjct: 715 gcgtcgtactgcttgccgc 697

>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome
          Length = 3179300

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 58      cttgaactccgtgccggcc 76
               |||||||||||||||||||
Sbjct: 1789237 cttgaactccgtgccggcc 1789219

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 37      ctgcttgccgcggacgacc 55
               |||||||||||||||||||
Sbjct: 4686277 ctgcttgccgcggacgacc 4686295

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 16      cttggtgacgaccgcgtcg 34
               |||||||||||||||||||
Sbjct: 8573901 cttggtgacgaccgcgtcg 8573919



 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 103     catggcgatgttcttcttc 121
               |||||||||||||||||||
Sbjct: 6282514 catggcgatgttcttcttc 6282532

>emb|Z71184.1|FAGDCST F.anomala gdcsT gene
          Length = 3353

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                               
Query: 98   taccccatggcgatgttcttcttcaggcacgggct 132
            ||||||||| | ||||||||||||| ||| |||||
Sbjct: 2166 taccccatgcctatgttcttcttcaagcatgggct 2132


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 702,500
Number of Sequences: 3902068
Number of extensions: 702500
Number of successful extensions: 38227
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38002
Number of HSP's gapped (non-prelim): 218
length of query: 134
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 113
effective length of database: 17,151,101,840
effective search space: 1938074507920
effective search space used: 1938074507920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)