Clone Information

BLAST Search Result

Clone Name	rbaal6g23
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	emb\|AL354981.41\| Human DNA sequence from clone RP11-696J10 on ch...	44	0.11
2	emb\|AL031622.1\|HS740A11 Human DNA sequence from clone RP4-740A11...	44	0.11
3	gb\|AC091606.8\| Mus Musculus Strain C57BL6/J chromosome X BAC, RP...	44	0.11
4	gb\|AC093899.3\| Homo sapiens BAC clone RP11-724O16 from 2, comple...	44	0.11
5	emb\|AL671706.8\| Mouse DNA sequence from clone RP23-330O24 on chr...	44	0.11
6	emb\|AL049291.1\|HSM800076 Homo sapiens mRNA; cDNA DKFZp564N093 (f...	44	0.11
7	emb\|BX927327.14\| Zebrafish DNA sequence from clone CH211-11C15 i...	42	0.43
8	gb\|AC144805.9\| Medicago truncatula clone mth2-72a11, complete se...	42	0.43
9	emb\|AL356108.12\| Human DNA sequence from clone RP11-149J18 on ch...	42	0.43
10	gb\|AC005770.3\| Arabidopsis thaliana chromosome 2 clone T7F6 map ...	42	0.43
11	gb\|AC067752.5\| Homo sapiens chromosome 10 clone RP11-335G23, com...	42	0.43
12	gb\|AC106748.3\| Homo sapiens chromosome 5 clone RP11-155G15, comp...	42	0.43
13	gb\|AC024598.7\| Homo sapiens chromosome 10 clone RP11-13A2, compl...	42	0.43
14	gb\|AC159114.7\| Mus musculus BAC RP23-370L19 (Roswell Park Cance...	42	0.43
15	gb\|AC153951.3\| Mus musculus 10 BAC RP24-480P16 (Roswell Park Can...	42	0.43
16	gb\|AC113100.12\| Mus musculus chromosome 1, clone RP23-317I17, co...	40	1.7
17	gb\|AC150879.3\| Bos taurus BAC CH240-491H11 (Children's Hospital...	40	1.7
18	gb\|AC117748.13\| Mus musculus chromosome 5, clone RP24-317A24, co...	40	1.7
19	gb\|AC147329.2\| Pan troglodytes BAC clone RP43-21F14 from 7, comp...	40	1.7
20	gb\|AC146437.3\| Pan troglodytes BAC clone RP43-15J3 from 7, compl...	40	1.7
21	gb\|AC004451.2\| Homo sapiens PAC clone RP4-789N1 from 7, complete...	40	1.7
22	gb\|AC009152.8\| Homo sapiens chromosome 16 clone RP11-567P19, com...	40	1.7
23	gb\|AC145901.2\| Pan troglodytes BAC clone RP43-9F20 from 7, compl...	40	1.7
24	emb\|CR956646.4\| Pig DNA sequence from clone CH242-247L10 on chro...	40	1.7
25	gb\|AC004773.1\| Homo sapiens PAC clone RP5-982I22 from 7, complet...	40	1.7
26	gb\|AC146721.7\| Medicago truncatula clone mth2-145n10, complete s...	40	1.7
27	emb\|AL365362.9\| Human DNA sequence from clone RP5-1017O19 on chr...	40	1.7
28	emb\|AL358392.19\| Human DNA sequence from clone RP11-138J20 on ch...	40	1.7
29	emb\|AL137078.20\| Human DNA sequence from clone RP1-66N13 on chro...	40	1.7
30	emb\|AL034554.8\|HS994L9 Human DNA sequence from clone RP5-994L9 o...	40	1.7
31	gb\|AC155291.3\| Mus musculus BAC clone RP24-439M20 from chromosom...	40	1.7
32	emb\|BX546480.9\| Zebrafish DNA sequence from clone DKEY-175C11, c...	40	1.7
33	gb\|AC018922.22\| Homo sapiens 12 BAC RP11-485C17 (Roswell Park Ca...	40	1.7
34	gb\|AC005700.3\| Arabidopsis thaliana chromosome 2 clone T32F6 map...	40	1.7
35	gb\|AC092185.3\| Homo sapiens 3q BAC RP11-148O7 (Roswell Park Canc...	40	1.7
36	gb\|AC007992.12\| Homo sapiens chromosome 8, clone RP11-44N17, com...	40	1.7
37	gb\|AC079617.5\| Homo sapiens BAC clone RP11-623K14 from 4, comple...	40	1.7
38	gb\|AC016932.17\| Homo sapiens 3 BAC RP11-166C10 (Roswell Park Can...	40	1.7
39	gb\|AC009772.14\| Homo sapiens 12 BAC RP11-372P9 (Roswell Park Can...	40	1.7
40	gb\|AC109117.5\| Rattus norvegicus BAC CH230-75J22 (Children's Ho...	40	1.7
41	gb\|AC015998.8\|AC015998 Homo sapiens, clone RP11-15J14, complete ...	40	1.7
42	gb\|AC154645.3\| Mus musculus BAC clone RP23-282G11 from chromosom...	40	1.7
43	emb\|BX649473.8\| Zebrafish DNA sequence from clone CH211-65G16 in...	40	1.7
44	emb\|BX005004.12\| Zebrafish DNA sequence from clone DKEY-11L18, c...	40	1.7
45	gb\|AC133283.13\| Mus musculus chromosome 15, clone RP24-435N1, co...	40	1.7
46	gb\|AC102364.5\| Mus musculus chromosome 9, clone RP23-106P6, comp...	40	1.7
47	gb\|AC125210.4\| Mus musculus BAC clone RP23-148P22 from 18, compl...	40	1.7
48	dbj\|AP006627.1\| Bacillus clausii KSM-K16 DNA, complete genome	40	1.7
49	emb\|AL591598.8\| Mouse DNA sequence from clone RP23-272C14 on chr...	40	1.7
50	emb\|AL603826.18\| Mouse DNA sequence from clone RP23-206P11 on ch...	40	1.7
51	gb\|AC102795.28\| Mus musculus chromosome 3, clone RP23-182B7, com...	38	6.7
52	gb\|AC166709.9\| Mus musculus chromosome 1, clone RP23-406B10, com...	38	6.7
53	gb\|AC150800.3\| Medicago truncatula chromosome 7 BAC clone mth2-7...	38	6.7
54	gb\|AC163274.5\| Mus musculus chromosome 1, clone RP23-202P19, com...	38	6.7
55	gb\|AE014832.1\| Plasmodium falciparum 3D7 chromosome 10 section 4...	38	6.7
56	gb\|AY617393.1\| Sterkiella histriomuscorum clone UGC1O0002_D15_R ...	38	6.7
57	gb\|AF506028.1\| Poncirus trifoliata citrus tristeza virus resista...	38	6.7
58	ref\|NM_177069.2\| Mus musculus RIKEN cDNA E330009P21 gene (E33000...	38	6.7
59	gb\|AC124115.10\| Mus musculus chromosome 10, clone RP24-377E13, c...	38	6.7
60	gb\|AC117826.10\| Mus musculus chromosome 1, clone RP24-81K19, com...	38	6.7
61	gb\|AC150204.30\| Medicago truncatula clone mth2-69i3, complete se...	38	6.7
62	gb\|AC093136.3\| Pan troglodytes clone RP43-116L11, complete sequence	38	6.7
63	gb\|AE006255.1\| Lactococcus lactis subsp. lactis IL1403 section 1...	38	6.7
64	gb\|AC124535.4\| Mus musculus BAC clone RP23-331C24 from chromosom...	38	6.7
65	gb\|AC122491.3\| Mus musculus BAC clone RP24-390D3 from chromosome...	38	6.7
66	gb\|AC182813.8\| Medicago truncatula clone mth2-69k1, complete seq...	38	6.7
67	gb\|AC120418.10\| Mus musculus chromosome 6, clone RP24-474I24, co...	38	6.7
68	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	38	6.7
69	gb\|AC165311.3\| Mus musculus chromosome 18, clone RP23-352F3, com...	38	6.7
70	gb\|AC006330.5\| Homo sapiens BAC clone RP11-229D13 from 7, comple...	38	6.7
71	gb\|AC115736.11\| Mus musculus chromosome 3, clone RP23-473D1, com...	38	6.7
72	emb\|CT009702.5\| Mouse DNA sequence from clone RP23-140A15 on chr...	38	6.7
73	gb\|AC100754.8\| Homo sapiens chromosome 15, clone RP11-262I11, co...	38	6.7
74	emb\|CR854931.8\| Zebrafish DNA sequence from clone DKEY-30P2 in l...	38	6.7
75	emb\|CT025837.1\| Medicago truncatula chromosome 5 clone mth2-28f1...	38	6.7
76	emb\|CR940306.3\| M.truncatula DNA sequence from clone MTH2-10B11 ...	38	6.7
77	emb\|CR940307.5\| M.truncatula DNA sequence from clone MTH2-21G21 ...	38	6.7
78	ref\|XM_537110.2\| PREDICTED: Canis familiaris hypothetical LOC479...	38	6.7
79	gb\|AC138642.10\| Mus musculus chromosome 3, clone RP23-21O7, comp...	38	6.7
80	gb\|AC003986.2\| Homo sapiens BAC clone CTA-370M10 from 7, complet...	38	6.7
81	gb\|AC113318.8\| Mus musculus chromosome 3, clone RP23-442I7, comp...	38	6.7
82	gb\|AC164169.8\| Mus musculus 6 BAC RP23-413M4 (Roswell Park Cance...	38	6.7
83	gb\|AC117680.7\| Mus musculus chromosome 1, clone RP23-435M2, comp...	38	6.7
84	gb\|AC009192.72\| Mus musculus strain 129/Sv clone ct7-555d9 map 6...	38	6.7
85	gb\|AC144477.16\| Medicago truncatula clone mth2-6k4, complete seq...	38	6.7
86	gb\|AC012397.33\| Mus musculus strain 129/Sv clone ct7-369p18 map ...	38	6.7
87	gb\|AC147472.17\| Medicago truncatula clone mth2-24n18, complete s...	38	6.7
88	gb\|AC146747.7\| Medicago truncatula clone mth2-14h5, complete seq...	38	6.7
89	gb\|AC131249.43\| Medicago truncatula clone mth2-8p18, complete se...	38	6.7
90	gb\|AC144563.15\| Medicago truncatula clone mth2-5c24, complete se...	38	6.7
91	gb\|AC161033.18\| Medicago truncatula clone mth2-57g13, complete s...	38	6.7
92	gb\|AC136955.20\| Medicago truncatula clone mth2-10p1, complete se...	38	6.7
93	gb\|AC148360.10\| Medicago truncatula clone mth2-27i5, complete se...	38	6.7
94	gb\|AC141108.3\| Medicago truncatula clone mth2-22g6, complete seq...	38	6.7
95	gb\|AC148239.7\| Medicago truncatula clone mth2-5d7, complete sequ...	38	6.7
96	gb\|AC155344.1\| Brassica rapa subsp. pekinensis clone KBrH080A08,...	38	6.7
97	emb\|CR753894.12\| Mouse DNA sequence from clone RP23-222I6 on chr...	38	6.7
98	emb\|AL671884.3\| Human DNA sequence from clone RP13-44L19 on chro...	38	6.7
99	emb\|AL603863.7\| Human DNA sequence from clone RP11-346A3 on chro...	38	6.7
100	emb\|AL590644.14\| Human DNA sequence from clone RP11-380J14 on ch...	38	6.7
101	emb\|AL356499.16\| Human DNA sequence from clone RP1-315J21 on chr...	38	6.7
102	emb\|AL355537.11\| Human DNA sequence from clone RP11-442O18 on ch...	38	6.7
103	emb\|AL355810.10\| Human DNA sequence from clone RP11-40E6 on chro...	38	6.7
104	gb\|AC099533.36\| Pan troglodytes clone rp43-41g5, complete sequence	38	6.7
105	gb\|AC126407.6\| Homo sapiens chromosome 15, clone RP11-73C9, comp...	38	6.7
106	emb\|AL136372.8\| Human DNA sequence from clone RP11-134C1 on chro...	38	6.7
107	emb\|AL133321.11\| Human DNA sequence from clone RP13-17E1 on chro...	38	6.7
108	emb\|AL031660.16\|HS387E22 Human DNA sequence from clone RP3-387E2...	38	6.7
109	emb\|AL022311.5\|HS1014D13 Human DNA sequence from clone RP5-1014D...	38	6.7
110	emb\|AL022165.1\|HS71L16 Human DNA sequence from clone RP1-71L16 o...	38	6.7
111	emb\|AL954384.11\| Zebrafish DNA sequence from clone CH211-146L13 ...	38	6.7
112	emb\|Y10871.1\|HSTWISTGE H.sapiens twist gene	38	6.7
113	gb\|BC099397.1\| Mus musculus RIKEN cDNA E330009P21 gene, mRNA (cD...	38	6.7
114	emb\|CR380952.1\| Candida glabrata strain CBS138 chromosome F comp...	38	6.7
115	emb\|CR925821.12\| Zebrafish DNA sequence from clone DKEY-27D1 in ...	38	6.7
116	emb\|AL929353.1\|PFA929353 Plasmodium falciparum strain 3D7, chrom...	38	6.7
117	emb\|AL807244.7\| Zebrafish DNA sequence from clone CH211-215I13 i...	38	6.7
118	emb\|AL731611.2\|OSJN00253 Oryza sativa genomic DNA, chromosome 4,...	38	6.7
119	emb\|BX890550.10\| Zebrafish DNA sequence from clone DKEYP-110B6 i...	38	6.7
120	emb\|BX927244.11\| Zebrafish DNA sequence from clone CH211-116O3 i...	38	6.7
121	gb\|AC153988.5\| Mus musculus 6 BAC RP24-553I1 (Roswell Park Cance...	38	6.7
122	emb\|BX247888.10\| Zebrafish DNA sequence from clone DKEY-10D15 in...	38	6.7
123	emb\|CR626905.5\| Zebrafish DNA sequence from clone DKEY-85H21 in ...	38	6.7
124	emb\|CR356236.12\| Zebrafish DNA sequence from clone CH211-251P4 i...	38	6.7
125	emb\|BX248241.20\| Zebrafish DNA sequence from clone DKEY-22K18 in...	38	6.7
126	gb\|AC159546.4\| Mus musculus 6 BAC RP23-450B23 (Roswell Park Canc...	38	6.7
127	gb\|AC158172.17\| Medicago truncatula clone mth2-143b6, complete s...	38	6.7
128	gb\|AC008249.14\| Homo sapiens 3 BAC RP11-211P13 (Roswell Park Can...	38	6.7
129	gb\|AC107965.4\| Homo sapiens chromosome 8, clone CTD-2332A4, comp...	38	6.7
130	gb\|AC150876.29\| Medicago truncatula clone mth2-28e19, complete s...	38	6.7
131	emb\|CR623750.1\| full-length cDNA clone CS0DA003YM21 of Neuroblas...	38	6.7
132	gb\|AC147775.5\| Medicago truncatula clone mth2-13d20, complete se...	38	6.7
133	gb\|AC125482.9\| Medicago truncatula clone mth2-15h11, complete se...	38	6.7
134	gb\|AC067718.20\| Homo sapiens 3 BAC RP11-198M8 (Roswell Park Canc...	38	6.7
135	gb\|AC022026.7\| Homo sapiens chromosome 10 clone RP11-506B4, comp...	38	6.7
136	gb\|AC104996.4\| Homo sapiens chromosome 17, clone RP11-1148O4, co...	38	6.7
137	dbj\|AK136136.1\| Mus musculus in vitro fertilized eggs cDNA, RIKE...	38	6.7
138	dbj\|AK135949.1\| Mus musculus in vitro fertilized eggs cDNA, RIKE...	38	6.7
139	gb\|AC092668.2\| Homo sapiens BAC clone RP11-553F8 from 4, complet...	38	6.7
140	gb\|AC079233.4\| Homo sapiens BAC clone RP11-372N22 from 4, comple...	38	6.7
141	gb\|AC093371.6\| Genomic sequence for Mus musculus, clone RP23-36P...	38	6.7
142	dbj\|AK158229.1\| Mus musculus adult inner ear cDNA, RIKEN full-le...	38	6.7
143	gb\|AC079062.5\| Homo sapiens chromosome 18, clone RP11-476I17, co...	38	6.7
144	gb\|AC084741.4\| Homo sapiens BAC clone RP11-537K6 from 4, complet...	38	6.7
145	gb\|AC009455.9\| Homo sapiens chromosome 18, clone RP11-169F17, co...	38	6.7
146	gb\|AC091225.2\| Drosophila melanogaster 3L BAC RP98-34B24 (Roswel...	38	6.7
147	emb\|BX322612.8\| Zebrafish DNA sequence from clone RP71-80O10 in ...	38	6.7
148	gb\|AC150891.3\| Medicago truncatula chromosome 2 BAC clone mth2-7...	38	6.7
149	gb\|AC009898.6\| Homo sapiens chromosome 8, clone RP11-138H14, com...	38	6.7
150	gb\|AC149135.2\| Medicago truncatula chromosome 2 BAC clone mth2-3...	38	6.7
151	gb\|AC148918.3\| Medicago truncatula chromosome 2 BAC clone mth2-4...	38	6.7
152	emb\|AJ549502.2\|HSA549502 Homo sapiens peptidylarginine deiminase...	38	6.7
153	gb\|AC093097.1\| Drosophila melanogaster, chromosome 2L, region 36...	38	6.7
154	gb\|AC156632.2\| Mus musculus BAC clone RP24-511E24 from chromosom...	38	6.7
155	dbj\|AK087710.1\| Mus musculus 2 days pregnant adult female ovary ...	38	6.7
156	gb\|AC091247.4\| Oryza sativa chromosome 3 BAC OJ1111_B11 genomic ...	38	6.7
157	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	38	6.7
158	ref\|XM_395660.2\| PREDICTED: Apis mellifera similar to ENSANGP000...	38	6.7
159	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	38	6.7
160	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	38	6.7
161	gb\|AC068294.26\|AC068294 Mus musculus 3 BAC RP23-418O21 (Roswell ...	38	6.7
162	gb\|AC007185.12\|AC007185 Drosophila melanogaster, chromosome 2L, ...	38	6.7
163	emb\|AL731618.3\|OSJN00269 Oryza sativa genomic DNA, chromosome 4,...	38	6.7
164	gb\|AC097474.3\| Homo sapiens BAC clone RP11-93I21 from 4, complet...	38	6.7
165	gb\|AC104407.3\| Homo sapiens BAC clone RP11-92A5 from 4, complete...	38	6.7
166	gb\|DP000024.1\| Eulemur macaco macaco target 1 genomic scaffold	38	6.7
167	gb\|AC157658.2\| Mus musculus BAC clone RP23-331E4 from chromosome...	38	6.7
168	gb\|AC154405.2\| Mus musculus BAC clone RP24-248O10 from chromosom...	38	6.7
169	gb\|AC158497.2\| Medicago truncatula chromosome 2 BAC clone mth2-4...	38	6.7
170	gb\|AC006214.1\|AC006214 Drosophila melanogaster, chromosome 2L, r...	38	6.7
171	gb\|AC067953.4\| Homo sapiens BAC clone RP11-253E24 from 2, comple...	38	6.7
172	gb\|AY190947.1\| Drosophila pseudoobscura clone DPSF01_40_G23 (D14...	38	6.7
173	gb\|AC084273.20\| Mus musculus strain C57BL/6J chromosome 6 clone ...	38	6.7
174	gb\|AC092573.2\| Homo sapiens BAC clone RP11-1O7 from 2, complete ...	38	6.7
175	emb\|BX470229.4\| Zebrafish DNA sequence from clone DKEY-193B15 in...	38	6.7
176	dbj\|AP003216.3\| Oryza sativa (japonica cultivar-group) genomic D...	38	6.7
177	emb\|BX088724.6\| Zebrafish DNA sequence from clone DKEY-15G22, co...	38	6.7
178	emb\|BX649445.5\| Zebrafish DNA sequence from clone DKEY-177H9 in ...	38	6.7
179	dbj\|BS000203.1\| Pan troglodytes chromosome 22 clone:PTB-155H17, ...	38	6.7
180	dbj\|BS000068.1\| Pan troglodytes chromosome 22 clone:RP43-046F21,...	38	6.7
181	emb\|AL591374.5\| Zebrafish DNA sequence from clone BUSM1-204B6 in...	38	6.7
182	emb\|CT963112.1\| Medicago truncatula chromosome 5 clone mth2-117d...	38	6.7
183	emb\|CR293523.11\| Zebrafish DNA sequence from clone DKEY-104J7 in...	38	6.7
184	emb\|BX255937.13\| Zebrafish DNA sequence from clone CH211-191D7 i...	38	6.7
185	emb\|BX510920.6\| Zebrafish DNA sequence from clone DKEY-30J22 in ...	38	6.7
186	emb\|AL591462.5\| Zebrafish DNA sequence from clone BUSM1-204D19 i...	38	6.7
187	gb\|AC157510.1\| Dasypus novemcinctus, clone Dasypus novemcinctus-...	38	6.7
188	gb\|AC131992.8\| Mus musculus chromosome 1, clone RP24-190B16, com...	38	6.7
189	gb\|AC157473.1\| Medicago truncatula chromosome 7 BAC clone mte1-1...	38	6.7
190	gb\|AE003652.2\| Drosophila melanogaster chromosome 2L, section 61...	38	6.7
191	gb\|AE003557.4\| Drosophila melanogaster chromosome 3L, section 28...	38	6.7
192	emb\|AL355834.4\|CNS05TCN Human chromosome 14 DNA sequence BAC R-9...	38	6.7
193	dbj\|AP001725.1\| Homo sapiens genomic DNA, chromosome 21q, sectio...	38	6.7
194	gb\|AE015927.1\| Clostridium tetani E88, complete genome	38	6.7
195	dbj\|AP003057.2\| Homo sapiens genomic DNA, chromosome 11q clone:R...	38	6.7
196	gb\|AE017332.1\| Mycoplasma hyopneumoniae 232, complete genome	38	6.7
197	emb\|CT010572.8\| M.truncatula DNA sequence from clone MTH2-161L21...	38	6.7
198	gb\|AE017143.1\| Haemophilus ducreyi strain 35000HP complete genome	38	6.7
199	gb\|AC153617.3\| Mus musculus 6 BAC RP23-177G20 (Roswell Park Canc...	38	6.7
200	emb\|AL844548.7\| Mouse DNA sequence from clone RP23-263D22 on chr...	38	6.7
201	gb\|AC005144.1\|AC005144 Homo sapiens chromosome 17, clone hRPK.46...	38	6.7
202	emb\|AL845264.18\| Mouse DNA sequence from clone RP23-116F18 on ch...	38	6.7
203	emb\|AL929548.8\| Zebrafish DNA sequence from clone CH211-159E17, ...	38	6.7
204	emb\|CT025696.10\| Mouse DNA sequence from clone RP24-344B20 on ch...	38	6.7
205	gb\|AC004072.1\|AC004072 Human Chromosome X clone bWXD342, complet...	38	6.7
206	emb\|AL929307.8\| Zebrafish DNA sequence from clone CH211-85A24 in...	38	6.7
207	dbj\|AP004965.1\| Lotus japonicus genomic DNA, chromosome 1, clone...	38	6.7
208	dbj\|AP004512.1\| Lotus japonicus genomic DNA, chromosome 4, clone...	38	6.7
209	emb\|AL833773.6\| Mouse DNA sequence from clone RP23-434A2 on chro...	38	6.7
210	emb\|AJ292269.1\|NSY292269 Nicotiana sylvestris DNA flanking T-DNA...	38	6.7
211	emb\|AL671185.8\| Mouse DNA sequence from clone RP23-192N1 on chro...	38	6.7
212	emb\|AL163171.4\|CNS01RIF Human chromosome 14 DNA sequence BAC R-4...	38	6.7
213	emb\|AL355095.4\|CNS05TCE Human chromosome 14 DNA sequence BAC R-1...	38	6.7
214	emb\|AL161804.4\|CNS01RHL Human chromosome 14 DNA sequence BAC R-4...	38	6.7
215	emb\|BX294368.7\| Zebrafish DNA sequence from clone CH211-244N12 i...	38	6.7
216	dbj\|AP000694.1\| Homo sapiens genomic DNA, chromosome 21q22.2, BA...	38	6.7

>emb|AL354981.41| Human DNA sequence from clone RP11-696J10 on chromosome 9 Contains part
             of the ASTN2 gene for astrotactin 2 (KIAA0634), complete
             sequence
          Length = 117488

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 89    gaatagaaggtagattgcaaaa 110
             ||||||||||||||||||||||
Sbjct: 61591 gaatagaaggtagattgcaaaa 61570

to top

>emb|AL031622.1|HS740A11 Human DNA sequence from clone RP4-740A11 on chromosome Xq22.2-23
             Contains part of the COL4A5 gene for type IV alpha 5
             collagen (Alport syndrome), complete sequence
          Length = 104674

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 106   caaaaataaaatgaaatataca 127
             ||||||||||||||||||||||
Sbjct: 14147 caaaaataaaatgaaatataca 14126

to top

>gb|AC091606.8| Mus Musculus Strain C57BL6/J chromosome X BAC, RP23-75P20, complete
              sequence
          Length = 234105

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 102    attgcaaaaataaaatgaaata 123
              ||||||||||||||||||||||
Sbjct: 118919 attgcaaaaataaaatgaaata 118940

to top

>gb|AC093899.3| Homo sapiens BAC clone RP11-724O16 from 2, complete sequence
          Length = 172816

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 99    tagattgcaaaaataaaatgaa 120
             ||||||||||||||||||||||
Sbjct: 71104 tagattgcaaaaataaaatgaa 71083

to top

>emb|AL671706.8| Mouse DNA sequence from clone RP23-330O24 on chromosome X, complete
             sequence
          Length = 192676

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 102   attgcaaaaataaaatgaaata 123
             ||||||||||||||||||||||
Sbjct: 13878 attgcaaaaataaaatgaaata 13899

to top

>emb|AL049291.1|HSM800076 Homo sapiens mRNA; cDNA DKFZp564N093 (from clone DKFZp564N093)
          Length = 4460

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 106 caaaaataaaatgaaatataca 127
           ||||||||||||||||||||||
Sbjct: 84  caaaaataaaatgaaatataca 63

to top

>emb|BX927327.14| Zebrafish DNA sequence from clone CH211-11C15 in linkage group 14,
              complete sequence
          Length = 182779

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 103    ttgcaaaaataaaatgaaatataca 127
              |||||||||||||||||||| ||||
Sbjct: 129096 ttgcaaaaataaaatgaaatctaca 129120

to top

>gb|AC144805.9| Medicago truncatula clone mth2-72a11, complete sequence
          Length = 78128

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aaaaataaaatgaaatataca 127
             |||||||||||||||||||||
Sbjct: 36562 aaaaataaaatgaaatataca 36582

to top

>emb|AL356108.12| Human DNA sequence from clone RP11-149J18 on chromosome 1 Contains part
             of a novel gene and a glutaminyl-tRNA synthase
             (glutamine-hydrolyzing)-like 1 (QRSL1) pseudogene,
             complete sequence
          Length = 162347

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 97    ggtagattgcaaaaataaaat 117
             |||||||||||||||||||||
Sbjct: 76359 ggtagattgcaaaaataaaat 76339

to top

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 68    ttaattgatacttactactag 88
             |||||||||||||||||||||
Sbjct: 23822 ttaattgatacttactactag 23842

to top

>gb|AC067752.5| Homo sapiens chromosome 10 clone RP11-335G23, complete sequence
          Length = 188453

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 104    tgcaaaaataaaatgaaatat 124
              |||||||||||||||||||||
Sbjct: 102745 tgcaaaaataaaatgaaatat 102725

to top

>gb|AC106748.3| Homo sapiens chromosome 5 clone RP11-155G15, complete sequence
          Length = 169734

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 62     taactgttaattgatacttactact 86
              ||||||||||||||||||| |||||
Sbjct: 112012 taactgttaattgatacttcctact 112036

to top

>gb|AC024598.7| Homo sapiens chromosome 10 clone RP11-13A2, complete sequence
          Length = 174734

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 104   tgcaaaaataaaatgaaatat 124
             |||||||||||||||||||||
Sbjct: 16691 tgcaaaaataaaatgaaatat 16671

to top

>gb|AC159114.7| Mus musculus  BAC RP23-370L19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 169393

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aaaaataaaatgaaatataca 127
             |||||||||||||||||||||
Sbjct: 12621 aaaaataaaatgaaatataca 12641

to top

>gb|AC153951.3| Mus musculus 10 BAC RP24-480P16 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 176067

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aaaaataaaatgaaatataca 127
              |||||||||||||||||||||
Sbjct: 107860 aaaaataaaatgaaatataca 107880

to top

>gb|AC113100.12| Mus musculus chromosome 1, clone RP23-317I17, complete sequence
          Length = 199991

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   tgcaaaaataaaatgaaata 123
             ||||||||||||||||||||
Sbjct: 45276 tgcaaaaataaaatgaaata 45257

to top

>gb|AC150879.3| Bos taurus  BAC CH240-491H11 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 175314

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 108    aaaataaaatgaaatatacagcca 131
              |||||||||||| |||||||||||
Sbjct: 103330 aaaataaaatgatatatacagcca 103307

to top

>gb|AC117748.13| Mus musculus chromosome 5, clone RP24-317A24, complete sequence
          Length = 180438

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     ttaattgatacttactacta 87
              ||||||||||||||||||||
Sbjct: 113306 ttaattgatacttactacta 113325

to top

>gb|AC147329.2| Pan troglodytes BAC clone RP43-21F14 from 7, complete sequence
          Length = 189770

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 50    actggaacaaaataactgttaatt 73
             ||||||| ||||||||||||||||
Sbjct: 25297 actggaagaaaataactgttaatt 25320

to top

>gb|AC146437.3| Pan troglodytes BAC clone RP43-15J3 from 7, complete sequence
          Length = 163637

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 106   caaaaataaaatgaaatata 125
             ||||||||||||||||||||
Sbjct: 49836 caaaaataaaatgaaatata 49855

to top

>gb|AC004451.2| Homo sapiens PAC clone RP4-789N1 from 7, complete sequence
          Length = 108642

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 106   caaaaataaaatgaaatata 125
             ||||||||||||||||||||
Sbjct: 55034 caaaaataaaatgaaatata 55053

to top

>gb|AC009152.8| Homo sapiens chromosome 16 clone RP11-567P19, complete sequence
          Length = 171127

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 107   aaaaataaaatgaaatatacagcc 130
             ||||||||| ||||||||||||||
Sbjct: 81908 aaaaataaagtgaaatatacagcc 81931

to top

>gb|AC145901.2| Pan troglodytes BAC clone RP43-9F20 from 7, complete sequence
          Length = 176187

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 50    actggaacaaaataactgttaatt 73
             ||||||| ||||||||||||||||
Sbjct: 89162 actggaagaaaataactgttaatt 89139

to top

>emb|CR956646.4| Pig DNA sequence from clone CH242-247L10 on chromosome 17, complete
             sequence
          Length = 171329

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   aaaataaaatgaaatataca 127
             ||||||||||||||||||||
Sbjct: 80080 aaaataaaatgaaatataca 80099

to top

>gb|AC004773.1| Homo sapiens PAC clone RP5-982I22 from 7, complete sequence
          Length = 126995

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   tgcaaaaataaaatgaaata 123
             ||||||||||||||||||||
Sbjct: 15968 tgcaaaaataaaatgaaata 15987

to top

>gb|AC146721.7| Medicago truncatula clone mth2-145n10, complete sequence
          Length = 133097

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   caaaaataaaatgaaatata 125
             ||||||||||||||||||||
Sbjct: 70782 caaaaataaaatgaaatata 70763

to top

>emb|AL365362.9| Human DNA sequence from clone RP5-1017O19 on chromosome 1 Contains a
             pseudogene similar to part of GDP dissociation inhibitor 2
             (GDI2), complete sequence
          Length = 92339

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 108   aaaataaaatgaaatataca 127
             ||||||||||||||||||||
Sbjct: 56006 aaaataaaatgaaatataca 55987

to top

>emb|AL358392.19| Human DNA sequence from clone RP11-138J20 on chromosome 1 Contains part
             of the EIF4G3 gene for  eukaryotic translation initiation
             factor 4 gamma, 3, complete sequence
          Length = 78241

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   tgcaaaaataaaatgaaata 123
             ||||||||||||||||||||
Sbjct: 65789 tgcaaaaataaaatgaaata 65808

to top

>emb|AL137078.20| Human DNA sequence from clone RP1-66N13 on chromosome 20 Contains a
             novel gene (LOC284749) and two novel genes, complete
             sequence
          Length = 80725

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 55    aacaaaataactgttaattg 74
             ||||||||||||||||||||
Sbjct: 17759 aacaaaataactgttaattg 17740

to top

>emb|AL034554.8|HS994L9 Human DNA sequence from clone RP5-994L9 on chromosome 20p12.3-13 Contains
              STS and GSSs, complete sequence
          Length = 137739

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     aaaataactgttaattgata 77
              ||||||||||||||||||||
Sbjct: 117696 aaaataactgttaattgata 117715

to top

>gb|AC155291.3| Mus musculus BAC clone RP24-439M20 from chromosome 12, complete
             sequence
          Length = 185156

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 99    tagattgcaaaaataaaatgaaat 122
             |||||||||| |||||||||||||
Sbjct: 37720 tagattgcaataataaaatgaaat 37697

to top

>emb|BX546480.9| Zebrafish DNA sequence from clone DKEY-175C11, complete sequence
          Length = 203056

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 104    tgcaaaaataaaatgaaata 123
              ||||||||||||||||||||
Sbjct: 191192 tgcaaaaataaaatgaaata 191173

to top

>gb|AC018922.22| Homo sapiens 12 BAC RP11-485C17 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 166256

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   ttgcaaaaataaaatgaaat 122
             ||||||||||||||||||||
Sbjct: 68866 ttgcaaaaataaaatgaaat 68885

to top

>gb|AC005700.3| Arabidopsis thaliana chromosome 2 clone T32F6 map TEn5, complete
             sequence
          Length = 100424

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   tgcaaaaataaaatgaaata 123
             ||||||||||||||||||||
Sbjct: 31116 tgcaaaaataaaatgaaata 31135

to top

>gb|AC092185.3| Homo sapiens 3q BAC RP11-148O7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 165962

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    tgcaaaaataaaatgaaata 123
              ||||||||||||||||||||
Sbjct: 164512 tgcaaaaataaaatgaaata 164531

to top

>gb|AC007992.12| Homo sapiens chromosome 8, clone RP11-44N17, complete sequence
          Length = 146921

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   caaaaataaaatgaaatata 125
             ||||||||||||||||||||
Sbjct: 30931 caaaaataaaatgaaatata 30912

to top

>gb|AC079617.5| Homo sapiens BAC clone RP11-623K14 from 4, complete sequence
          Length = 112615

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   caaaaataaaatgaaatata 125
             ||||||||||||||||||||
Sbjct: 62938 caaaaataaaatgaaatata 62919

to top

>gb|AC016932.17| Homo sapiens 3 BAC RP11-166C10 (Roswell Park Cancer Institute Human Bac
             Library) complete sequence
          Length = 89000

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   tgcaaaaataaaatgaaata 123
             ||||||||||||||||||||
Sbjct: 88376 tgcaaaaataaaatgaaata 88357

to top

>gb|AC009772.14| Homo sapiens 12 BAC RP11-372P9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 85000

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 106   caaaaataaaatgaaatata 125
             ||||||||||||||||||||
Sbjct: 50290 caaaaataaaatgaaatata 50309

to top

>gb|AC109117.5| Rattus norvegicus  BAC CH230-75J22 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 228314

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 106    caaaaataaaatgaaatata 125
              ||||||||||||||||||||
Sbjct: 165444 caaaaataaaatgaaatata 165425

to top

>gb|AC015998.8|AC015998 Homo sapiens, clone RP11-15J14, complete sequence
          Length = 156873

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 106   caaaaataaaatgaaatata 125
             ||||||||||||||||||||
Sbjct: 60238 caaaaataaaatgaaatata 60257

to top

>gb|AC154645.3| Mus musculus BAC clone RP23-282G11 from chromosome 9, complete sequence
          Length = 210202

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 106    caaaaataaaatgaaatata 125
              ||||||||||||||||||||
Sbjct: 104443 caaaaataaaatgaaatata 104462

to top

>emb|BX649473.8| Zebrafish DNA sequence from clone CH211-65G16 in linkage group 1,
              complete sequence
          Length = 167871

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    attgcaaaaataaaatgaaa 121
              ||||||||||||||||||||
Sbjct: 126912 attgcaaaaataaaatgaaa 126893

to top

>emb|BX005004.12| Zebrafish DNA sequence from clone DKEY-11L18, complete sequence
          Length = 216131

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 50    actggaacaaaataactgttaatt 73
             ||||||| ||||||||||||||||
Sbjct: 12222 actggaaaaaaataactgttaatt 12245

to top

>gb|AC133283.13| Mus musculus chromosome 15, clone RP24-435N1, complete sequence
          Length = 154352

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 41     agcatatttactggaacaaaataa 64
              |||| |||||||||||||||||||
Sbjct: 125096 agcaaatttactggaacaaaataa 125119

to top

>gb|AC102364.5| Mus musculus chromosome 9, clone RP23-106P6, complete sequence
          Length = 208404

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 106    caaaaataaaatgaaatata 125
              ||||||||||||||||||||
Sbjct: 113253 caaaaataaaatgaaatata 113272

to top

>gb|AC125210.4| Mus musculus BAC clone RP23-148P22 from 18, complete sequence
          Length = 210193

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   attgcaaaaataaaatgaaa 121
             ||||||||||||||||||||
Sbjct: 68795 attgcaaaaataaaatgaaa 68814

to top

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 65      ctgttaattgatacttacta 84
               ||||||||||||||||||||
Sbjct: 4266111 ctgttaattgatacttacta 4266130

to top

>emb|AL591598.8| Mouse DNA sequence from clone RP23-272C14 on chromosome 2, complete
              sequence
          Length = 191520

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 106    caaaaataaaatgaaatata 125
              ||||||||||||||||||||
Sbjct: 177023 caaaaataaaatgaaatata 177004

to top

>emb|AL603826.18| Mouse DNA sequence from clone RP23-206P11 on chromosome 11, complete
              sequence
          Length = 145299

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     aaaataactgttaattgata 77
              ||||||||||||||||||||
Sbjct: 105639 aaaataactgttaattgata 105658

to top

>gb|AC102795.28| Mus musculus chromosome 3, clone RP23-182B7, complete sequence
          Length = 226270

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 104    tgcaaaaataaaatgaaat 122
              |||||||||||||||||||
Sbjct: 160078 tgcaaaaataaaatgaaat 160060

to top

>gb|AC166709.9| Mus musculus chromosome 1, clone RP23-406B10, complete sequence
          Length = 175924

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 103   ttgcaaaaataaaatgaaa 121
             |||||||||||||||||||
Sbjct: 22912 ttgcaaaaataaaatgaaa 22930

to top

>gb|AC150800.3| Medicago truncatula chromosome 7 BAC clone mth2-77m9, complete sequence
          Length = 116865

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 80822 caaaaataaaatgaaatat 80840

to top

>gb|AC163274.5| Mus musculus chromosome 1, clone RP23-202P19, complete sequence
          Length = 208546

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 103    ttgcaaaaataaaatgaaa 121
              |||||||||||||||||||
Sbjct: 161009 ttgcaaaaataaaatgaaa 161027

to top

>gb|AE014832.1| Plasmodium falciparum 3D7 chromosome 10 section 4 of 7 of the complete
             sequence
          Length = 258658

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 15248 aaaaataaaatgaaatata 15230

to top

>gb|AY617393.1| Sterkiella histriomuscorum clone UGC1O0002_D15_R genomic sequence
          Length = 726

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 103 ttgcaaaaataaaatgaaa 121
           |||||||||||||||||||
Sbjct: 662 ttgcaaaaataaaatgaaa 680

to top

>gb|AF506028.1| Poncirus trifoliata citrus tristeza virus resistance gene locus,
             complete sequence
          Length = 282699

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 33666 aaaaataaaatgaaatata 33648

to top

>ref|NM_177069.2| Mus musculus RIKEN cDNA E330009P21 gene (E330009P21Rik), mRNA
          Length = 1487

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 53   ggaacaaaataactgttaa 71
            |||||||||||||||||||
Sbjct: 1005 ggaacaaaataactgttaa 1023

to top

>gb|AC124115.10| Mus musculus chromosome 10, clone RP24-377E13, complete sequence
          Length = 165796

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 48    ttactggaacaaaataactgtta 70
             ||||||||| |||||||||||||
Sbjct: 44293 ttactggaagaaaataactgtta 44315

to top

>gb|AC117826.10| Mus musculus chromosome 1, clone RP24-81K19, complete sequence
          Length = 227953

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 43     catatttactggaacaaaa 61
              |||||||||||||||||||
Sbjct: 215743 catatttactggaacaaaa 215725

to top

>gb|AC150204.30| Medicago truncatula clone mth2-69i3, complete sequence
          Length = 115027

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 50442 caaaaataaaatgaaatat 50460

to top

>gb|AC093136.3| Pan troglodytes clone RP43-116L11, complete sequence
          Length = 179629

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 53356 aaaaataaaatgaaatata 53374

to top

>gb|AE006255.1| Lactococcus lactis subsp. lactis IL1403 section 17 of 218 of the
           complete genome
          Length = 10098

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 103 ttgcaaaaataaaatgaaa 121
           |||||||||||||||||||
Sbjct: 105 ttgcaaaaataaaatgaaa 123

to top

>gb|AC124535.4| Mus musculus BAC clone RP23-331C24 from chromosome 18, complete
             sequence
          Length = 206191

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 99    tagattgcaaaaataaaatgaaa 121
             |||||||| ||||||||||||||
Sbjct: 57687 tagattgctaaaataaaatgaaa 57709

to top

>gb|AC122491.3| Mus musculus BAC clone RP24-390D3 from chromosome 3, complete sequence
          Length = 175092

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 152963 aaaaataaaatgaaatata 152945

to top

>gb|AC182813.8| Medicago truncatula clone mth2-69k1, complete sequence
          Length = 131049

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 102   attgcaaaaataaaatgaaatatacag 128
             |||||||||||||||| |||| |||||
Sbjct: 37222 attgcaaaaataaaataaaatttacag 37196

to top

>gb|AC120418.10| Mus musculus chromosome 6, clone RP24-474I24, complete sequence
          Length = 177307

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    tttactggaacaaaataac 65
             |||||||||||||||||||
Sbjct: 29146 tttactggaacaaaataac 29128

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 105      gcaaaaataaaatgaaata 123
                |||||||||||||||||||
Sbjct: 34342744 gcaaaaataaaatgaaata 34342762

to top

>gb|AC165311.3| Mus musculus chromosome 18, clone RP23-352F3, complete sequence
          Length = 174474

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 99    tagattgcaaaaataaaatgaaa 121
             |||||||| ||||||||||||||
Sbjct: 86164 tagattgctaaaataaaatgaaa 86186

to top

>gb|AC006330.5| Homo sapiens BAC clone RP11-229D13 from 7, complete sequence
          Length = 96299

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 47340 aaaaataaaatgaaatata 47322

to top

>gb|AC115736.11| Mus musculus chromosome 3, clone RP23-473D1, complete sequence
          Length = 180545

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 105   gcaaaaataaaatgaaata 123
             |||||||||||||||||||
Sbjct: 16402 gcaaaaataaaatgaaata 16420

to top

>emb|CT009702.5| Mouse DNA sequence from clone RP23-140A15 on chromosome 16, complete
              sequence
          Length = 230233

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 159546 aaaaataaaatgaaatata 159564

to top

>gb|AC100754.8| Homo sapiens chromosome 15, clone RP11-262I11, complete sequence
          Length = 118732

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 82    ctactaggaatagaaggta 100
             |||||||||||||||||||
Sbjct: 93711 ctactaggaatagaaggta 93693

to top

>emb|CR854931.8| Zebrafish DNA sequence from clone DKEY-30P2 in linkage group 14, complete
              sequence
          Length = 203332

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 109    aaataaaatgaaatataca 127
              |||||||||||||||||||
Sbjct: 121337 aaataaaatgaaatataca 121319

to top

>emb|CT025837.1| Medicago truncatula chromosome 5 clone mth2-28f11, COMPLETE SEQUENCE
          Length = 99258

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 51789 aaaaataaaatgaaatata 51807

to top

>emb|CR940306.3| M.truncatula DNA sequence from clone MTH2-10B11 on chromosome 3,
             complete sequence
          Length = 90977

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 77042 caaaaataaaatgaaatat 77060

to top

>emb|CR940307.5| M.truncatula DNA sequence from clone MTH2-21G21 on chromosome 3,
             complete sequence
          Length = 115223

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 91705 caaaaataaaatgaaatat 91687

to top

>ref|XM_537110.2| PREDICTED: Canis familiaris hypothetical LOC479986 (LOC479986),
           mRNA
          Length = 887

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 102 attgcaaaaataaaatgaa 120
           |||||||||||||||||||
Sbjct: 861 attgcaaaaataaaatgaa 879

to top

>gb|AC138642.10| Mus musculus chromosome 3, clone RP23-21O7, complete sequence
          Length = 252108

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 47660 aaaaataaaatgaaatata 47642

to top

>gb|AC003986.2| Homo sapiens BAC clone CTA-370M10 from 7, complete sequence
          Length = 188205

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 105    gcaaaaataaaatgaaata 123
              |||||||||||||||||||
Sbjct: 140340 gcaaaaataaaatgaaata 140322

to top

>gb|AC113318.8| Mus musculus chromosome 3, clone RP23-442I7, complete sequence
          Length = 213409

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 105    gcaaaaataaaatgaaata 123
              |||||||||||||||||||
Sbjct: 208084 gcaaaaataaaatgaaata 208102

to top

>gb|AC164169.8| Mus musculus 6 BAC RP23-413M4 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 209149

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 109  aaataaaatgaaatataca 127
            |||||||||||||||||||
Sbjct: 7642 aaataaaatgaaatataca 7660

to top

>gb|AC117680.7| Mus musculus chromosome 1, clone RP23-435M2, complete sequence
          Length = 202195

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 57153 aaaaataaaatgaaatata 57135

to top

>gb|AC009192.72| Mus musculus strain 129/Sv clone ct7-555d9 map 6, complete sequence
          Length = 120530

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 109   aaataaaatgaaatataca 127
             |||||||||||||||||||
Sbjct: 66598 aaataaaatgaaatataca 66616

to top

>gb|AC144477.16| Medicago truncatula clone mth2-6k4, complete sequence
          Length = 112241

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 106  caaaaataaaatgaaatat 124
            |||||||||||||||||||
Sbjct: 8942 caaaaataaaatgaaatat 8960

to top

>gb|AC012397.33| Mus musculus strain 129/Sv clone ct7-369p18 map 6, complete sequence
          Length = 140198

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 109    aaataaaatgaaatataca 127
              |||||||||||||||||||
Sbjct: 110456 aaataaaatgaaatataca 110474

to top

>gb|AC147472.17| Medicago truncatula clone mth2-24n18, complete sequence
          Length = 133272

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 110387 caaaaataaaatgaaatat 110369

to top

>gb|AC146747.7| Medicago truncatula clone mth2-14h5, complete sequence
          Length = 129204

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 20995 caaaaataaaatgaaatat 20977

to top

>gb|AC131249.43| Medicago truncatula clone mth2-8p18, complete sequence
          Length = 104866

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 73034 caaaaataaaatgaaatat 73052

to top

>gb|AC144563.15| Medicago truncatula clone mth2-5c24, complete sequence
          Length = 111376

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 41885 caaaaataaaatgaaatat 41903

to top

>gb|AC161033.18| Medicago truncatula clone mth2-57g13, complete sequence
          Length = 109039

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 73765 caaaaataaaatgaaatat 73747

to top

>gb|AC136955.20| Medicago truncatula clone mth2-10p1, complete sequence
          Length = 107635

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 103972 caaaaataaaatgaaatat 103954

to top

>gb|AC148360.10| Medicago truncatula clone mth2-27i5, complete sequence
          Length = 113746

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 109044 caaaaataaaatgaaatat 109062

to top

>gb|AC141108.3| Medicago truncatula clone mth2-22g6, complete sequence
          Length = 119745

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 106  caaaaataaaatgaaatat 124
            |||||||||||||||||||
Sbjct: 7105 caaaaataaaatgaaatat 7123

to top

>gb|AC148239.7| Medicago truncatula clone mth2-5d7, complete sequence
          Length = 103609

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 42358 caaaaataaaatgaaatat 42340

to top

>gb|AC155344.1| Brassica rapa subsp. pekinensis clone KBrH080A08, complete sequence
          Length = 110038

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 106  caaaaataaaatgaaatat 124
            |||||||||||||||||||
Sbjct: 9089 caaaaataaaatgaaatat 9107

to top

>emb|CR753894.12| Mouse DNA sequence from clone RP23-222I6 on chromosome 2, complete
             sequence
          Length = 110921

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 13409 aaaaataaaatgaaatata 13391

to top

>emb|AL671884.3| Human DNA sequence from clone RP13-44L19 on chromosome 6 Contains the
             gene for mandaselin (FLJ12838) and a CpG island, complete
             sequence
          Length = 105273

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 103   ttgcaaaaataaaatgaaa 121
             |||||||||||||||||||
Sbjct: 47210 ttgcaaaaataaaatgaaa 47228

to top

>emb|AL603863.7| Human DNA sequence from clone RP11-346A3 on chromosome 13 Contains the
             5' end of the PCDH9 gene for protocadherin 9, a laminin
             receptor 1 (67kDa ribosomal protein SA) (LAMR1) pseudogene
             and a CpG island, complete sequence
          Length = 71774

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 104   tgcaaaaataaaatgaaat 122
             |||||||||||||||||||
Sbjct: 57635 tgcaaaaataaaatgaaat 57653

to top

>emb|AL590644.14| Human DNA sequence from clone RP11-380J14 on chromosome 1 Contains a
              novel gene (FLJ45933), the PADI1 gene for type I peptidyl
              arginine deiminase, the PADI3 gene for type III peptidyl
              arginine deiminase, the 5' end of the PADI4 gene for type
              IV peptidyl arginine deiminase, complete sequence
          Length = 164862

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 109    aaataaaatgaaatataca 127
              |||||||||||||||||||
Sbjct: 120865 aaataaaatgaaatataca 120883

to top

>emb|AL356499.16| Human DNA sequence from clone RP1-315J21 on chromosome X Contains the
             3' end of a novel gene, complete sequence
          Length = 142557

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 96    aggtagattgcaaaaataaaatg 118
             |||||||||||| ||||||||||
Sbjct: 10732 aggtagattgcataaataaaatg 10710

to top

>emb|AL355537.11| Human DNA sequence from clone RP11-442O18 on chromosome 10 Contains three
              novel genes, complete sequence
          Length = 188728

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 106543 aaaaataaaatgaaatata 106525

to top

>emb|AL355810.10| Human DNA sequence from clone RP11-40E6 on chromosome 13, complete
             sequence
          Length = 103749

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 38431 aaaaataaaatgaaatata 38449

to top

>gb|AC099533.36| Pan troglodytes clone rp43-41g5, complete sequence
          Length = 226331

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 20471 aaaaataaaatgaaatata 20453

to top

>gb|AC126407.6| Homo sapiens chromosome 15, clone RP11-73C9, complete sequence
          Length = 105574

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 82    ctactaggaatagaaggta 100
             |||||||||||||||||||
Sbjct: 31359 ctactaggaatagaaggta 31341

to top

>emb|AL136372.8| Human DNA sequence from clone RP11-134C1 on chromosome 1q25.1-31.1
              Contains a zinc finger protein pseudogene, complete
              sequence
          Length = 165880

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 60     aataactgttaattgatac 78
              |||||||||||||||||||
Sbjct: 157009 aataactgttaattgatac 157027

to top

>emb|AL133321.11| Human DNA sequence from clone RP13-17E1 on chromosome X Contains part
             of the PCDH11X gene for protocadherin 11 X-linked,
             complete sequence
          Length = 170805

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   gcaaaaataaaatgaaata 123
             |||||||||||||||||||
Sbjct: 98178 gcaaaaataaaatgaaata 98160

to top

>emb|AL031660.16|HS387E22 Human DNA sequence from clone RP3-387E22 on chromosome 20q11.23-12
             Contains STSs and GSSs, complete sequence
          Length = 49838

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 43334 caaaaataaaatgaaatat 43316

to top

>emb|AL022311.5|HS1014D13 Human DNA sequence from clone RP5-1014D13 on chromosome 22q13.1-13.2,
             complete sequence
          Length = 71263

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 102   attgcaaaaataaaatgaaatat 124
             |||| ||||||||||||||||||
Sbjct: 48101 attgaaaaaataaaatgaaatat 48123

to top

>emb|AL022165.1|HS71L16 Human DNA sequence from clone RP1-71L16 on chromosome Xp11 Contains a
             pseudogene similar to part of novel gene (FLJ20344), a
             novel gene, the CHST7 gene for carbohydrate
             (N-acetylglucosamine 6-O) ulfotransferase 7 (C6ST-2), the
             3' end of the SLC9A7 gene for solute carrier family 9
             (sodium/hydrogen exchanger), isoform 7 (NHE7), a
             pseudogene similar to part of germ cell specific Y-box
             binding protein (YBX2) and two CpG islands, complete
             sequence
          Length = 176433

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 72728 aaaaataaaatgaaatata 72710

to top

>emb|AL954384.11| Zebrafish DNA sequence from clone CH211-146L13 in linkage group 6,
             complete sequence
          Length = 162560

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 33018 aaaaataaaatgaaatata 33000

to top

>emb|Y10871.1|HSTWISTGE H.sapiens twist gene
          Length = 16702

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 105  gcaaaaataaaatgaaata 123
            |||||||||||||||||||
Sbjct: 9451 gcaaaaataaaatgaaata 9469

to top

>gb|BC099397.1| Mus musculus RIKEN cDNA E330009P21 gene, mRNA (cDNA clone MGC:117557
            IMAGE:30936381), complete cds
          Length = 1497

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 53   ggaacaaaataactgttaa 71
            |||||||||||||||||||
Sbjct: 986  ggaacaaaataactgttaa 1004

to top

>emb|CR380952.1| Candida glabrata strain CBS138 chromosome F complete sequence
          Length = 927101

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 9      ttaattggtatttggtaga 27
              |||||||||||||||||||
Sbjct: 506536 ttaattggtatttggtaga 506518

to top

>emb|CR925821.12| Zebrafish DNA sequence from clone DKEY-27D1 in linkage group 14,
             complete sequence
          Length = 184616

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 109   aaataaaatgaaatataca 127
             |||||||||||||||||||
Sbjct: 29742 aaataaaatgaaatataca 29724

to top

>emb|AL929353.1|PFA929353 Plasmodium falciparum strain 3D7, chromosome 5, segment 3/4
          Length = 343050

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 44     atatttactggaacaaaat 62
              |||||||||||||||||||
Sbjct: 250592 atatttactggaacaaaat 250610

to top

>emb|AL807244.7| Zebrafish DNA sequence from clone CH211-215I13 in linkage group 19
             Contains a novel gene similar to Spir-2, the first exon of
             a novel gene simialr to BAALC (brain and acute leukemia,
             cytoplasmic), the atp6v1c1l gene for  ATPase, H+
             transporting, lysosomal, V1 subunit C, isoform 1 like
             protein,  the oazin gene for ornithine decarboxylase
             antizyme inhibitor, a novel gene similar to rrm2
             (ribonucleotide reductase protein r2 class I), a novel
             gene remotely similar to LYRIC, a novel gene similar to
             LAPTM4B (lysosomal associated protein transmembrane 4
             beta) and a CpG island, complete sequence
          Length = 201745

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 33272 aaaaataaaatgaaatata 33254

to top

>emb|AL731611.2|OSJN00253 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D08,
            complete sequence
          Length = 142814

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 106  caaaaataaaatgaaatat 124
            |||||||||||||||||||
Sbjct: 9045 caaaaataaaatgaaatat 9027

to top

>emb|BX890550.10| Zebrafish DNA sequence from clone DKEYP-110B6 in linkage group 13,
              complete sequence
          Length = 174313

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 105    gcaaaaataaaatgaaata 123
              |||||||||||||||||||
Sbjct: 138383 gcaaaaataaaatgaaata 138401

to top

>emb|BX927244.11| Zebrafish DNA sequence from clone CH211-116O3 in linkage group 15,
            complete sequence
          Length = 152919

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 107  aaaaataaaatgaaatata 125
            |||||||||||||||||||
Sbjct: 2535 aaaaataaaatgaaatata 2553

to top

>gb|AC153988.5| Mus musculus 6 BAC RP24-553I1 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 136725

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 109   aaataaaatgaaatataca 127
             |||||||||||||||||||
Sbjct: 94075 aaataaaatgaaatataca 94057

to top

>emb|BX247888.10| Zebrafish DNA sequence from clone DKEY-10D15 in linkage group 9,
            complete sequence
          Length = 223425

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 107  aaaaataaaatgaaatata 125
            |||||||||||||||||||
Sbjct: 2416 aaaaataaaatgaaatata 2398

to top

>emb|CR626905.5| Zebrafish DNA sequence from clone DKEY-85H21 in linkage group 15,
              complete sequence
          Length = 201465

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 105    gcaaaaataaaatgaaata 123
              |||||||||||||||||||
Sbjct: 105448 gcaaaaataaaatgaaata 105430

to top

>emb|CR356236.12| Zebrafish DNA sequence from clone CH211-251P4 in linkage group 13,
              complete sequence
          Length = 171465

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 99     tagattgcaaaaataaaat 117
              |||||||||||||||||||
Sbjct: 166852 tagattgcaaaaataaaat 166834

to top

>emb|BX248241.20| Zebrafish DNA sequence from clone DKEY-22K18 in linkage group 19,
             complete sequence
          Length = 101595

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 68471 aaaaataaaatgaaatata 68489

to top

>gb|AC159546.4| Mus musculus 6 BAC RP23-450B23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 192227

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 109    aaataaaatgaaatataca 127
              |||||||||||||||||||
Sbjct: 178204 aaataaaatgaaatataca 178222

to top

>gb|AC158172.17| Medicago truncatula clone mth2-143b6, complete sequence
          Length = 117641

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 103020 caaaaataaaatgaaatat 103038

to top

>gb|AC008249.14| Homo sapiens 3 BAC RP11-211P13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 184203

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 88854 aaaaataaaatgaaatata 88872

to top

>gb|AC107965.4| Homo sapiens chromosome 8, clone CTD-2332A4, complete sequence
          Length = 112032

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 98509 aaaaataaaatgaaatata 98491

to top

>gb|AC150876.29| Medicago truncatula clone mth2-28e19, complete sequence
          Length = 91361

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 46652 caaaaataaaatgaaatat 46670

to top

>emb|CR623750.1| full-length cDNA clone CS0DA003YM21 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1711

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 105 gcaaaaataaaatgaaata 123
           |||||||||||||||||||
Sbjct: 874 gcaaaaataaaatgaaata 892

to top

>gb|AC147775.5| Medicago truncatula clone mth2-13d20, complete sequence
          Length = 117523

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 101603 caaaaataaaatgaaatat 101585

to top

>gb|AC125482.9| Medicago truncatula clone mth2-15h11, complete sequence
          Length = 129658

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 119244 caaaaataaaatgaaatat 119262

to top

>gb|AC067718.20| Homo sapiens 3 BAC RP11-198M8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 97995

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 46545 aaaaataaaatgaaatata 46563

to top

>gb|AC022026.7| Homo sapiens chromosome 10 clone RP11-506B4, complete sequence
          Length = 170834

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 140123 caaaaataaaatgaaatat 140141

to top

>gb|AC104996.4| Homo sapiens chromosome 17, clone RP11-1148O4, complete sequence
          Length = 155848

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 102    attgcaaaaataaaatgaa 120
              |||||||||||||||||||
Sbjct: 120464 attgcaaaaataaaatgaa 120446

to top

>dbj|AK136136.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
            enriched library, clone:7420462A02 product:Similar to
            F-box protein FBX12 homolog [Mus musculus], full insert
            sequence
          Length = 1755

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 53   ggaacaaaataactgttaa 71
            |||||||||||||||||||
Sbjct: 1001 ggaacaaaataactgttaa 1019

to top

>dbj|AK135949.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
            enriched library, clone:7420440J21 product:Similar to
            F-box protein FBX12 homolog [Mus musculus], full insert
            sequence
          Length = 2244

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 53   ggaacaaaataactgttaa 71
            |||||||||||||||||||
Sbjct: 1005 ggaacaaaataactgttaa 1023

to top

>gb|AC092668.2| Homo sapiens BAC clone RP11-553F8 from 4, complete sequence
          Length = 167570

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 16152 aaaaataaaatgaaatata 16134

to top

>gb|AC079233.4| Homo sapiens BAC clone RP11-372N22 from 4, complete sequence
          Length = 164183

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 64245 caaaaataaaatgaaatat 64263

to top

>gb|AC093371.6| Genomic sequence for Mus musculus, clone RP23-36P10, complete sequence
          Length = 177872

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 108    aaaataaaatgaaatatac 126
              |||||||||||||||||||
Sbjct: 104238 aaaataaaatgaaatatac 104220

to top

>dbj|AK158229.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930043N18 product:hypothetical protein,
           full insert sequence
          Length = 1267

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 104 tgcaaaaataaaatgaaat 122
           |||||||||||||||||||
Sbjct: 419 tgcaaaaataaaatgaaat 437

to top

>gb|AC079062.5| Homo sapiens chromosome 18, clone RP11-476I17, complete sequence
          Length = 170048

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 11938 caaaaataaaatgaaatat 11920

to top

>gb|AC084741.4| Homo sapiens BAC clone RP11-537K6 from 4, complete sequence
          Length = 146143

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 57459 aaaaataaaatgaaatata 57477

to top

>gb|AC009455.9| Homo sapiens chromosome 18, clone RP11-169F17, complete sequence
          Length = 191356

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 161894 caaaaataaaatgaaatat 161876

to top

>gb|AC091225.2| Drosophila melanogaster 3L BAC RP98-34B24 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 174774

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 89725 caaaaataaaatgaaatat 89707

to top

>emb|BX322612.8| Zebrafish DNA sequence from clone RP71-80O10 in linkage group 23,
             complete sequence
          Length = 158403

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 43391 aaaaataaaatgaaatata 43409

to top

>gb|AC150891.3| Medicago truncatula chromosome 2 BAC clone mth2-76a9, complete sequence
          Length = 142579

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 10849 caaaaataaaatgaaatat 10831

to top

>gb|AC009898.6| Homo sapiens chromosome 8, clone RP11-138H14, complete sequence
          Length = 168539

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 117058 aaaaataaaatgaaatata 117076

to top

>gb|AC149135.2| Medicago truncatula chromosome 2 BAC clone mth2-31g23, complete
             sequence
          Length = 113812

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 72685 caaaaataaaatgaaatat 72703

to top

>gb|AC148918.3| Medicago truncatula chromosome 2 BAC clone mth2-44o11, complete sequence
          Length = 126437

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 125054 caaaaataaaatgaaatat 125072

to top

>emb|AJ549502.2|HSA549502 Homo sapiens peptidylarginine deiminase gene locus (PADI12346 genes)
          Length = 355060

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 109    aaataaaatgaaatataca 127
              |||||||||||||||||||
Sbjct: 222403 aaataaaatgaaatataca 222421

to top

>gb|AC093097.1| Drosophila melanogaster, chromosome 2L, region 36A-36B, BAC clone
             BACR26O03, complete sequence
          Length = 175413

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   gcaaaaataaaatgaaata 123
             |||||||||||||||||||
Sbjct: 19853 gcaaaaataaaatgaaata 19835

to top

>gb|AC156632.2| Mus musculus BAC clone RP24-511E24 from chromosome 12, complete
            sequence
          Length = 173515

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 101  gattgcaaaaataaaatgaaatataca 127
            |||| |||||||||||| |||||||||
Sbjct: 9034 gattacaaaaataaaataaaatataca 9008

to top

>dbj|AK087710.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
            full-length enriched library, clone:E330009P21
            product:similar to F-BOX PROTEIN FBX12 (FRAGMENT) [Mus
            musculus], full insert sequence
          Length = 1487

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 53   ggaacaaaataactgttaa 71
            |||||||||||||||||||
Sbjct: 1005 ggaacaaaataactgttaa 1023

to top

>gb|AC091247.4| Oryza sativa chromosome 3 BAC OJ1111_B11 genomic sequence, complete
              sequence
          Length = 115393

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 105    gcaaaaataaaatgaaata 123
              |||||||||||||||||||
Sbjct: 106950 gcaaaaataaaatgaaata 106932

to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 106      caaaaataaaatgaaatat 124
                |||||||||||||||||||
Sbjct: 11000390 caaaaataaaatgaaatat 11000372

to top

>ref|XM_395660.2| PREDICTED: Apis mellifera similar to ENSANGP00000010474 (LOC412198),
            mRNA
          Length = 4519

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 107  aaaaataaaatgaaatata 125
            |||||||||||||||||||
Sbjct: 4419 aaaaataaaatgaaatata 4437

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 105      gcaaaaataaaatgaaata 123
                |||||||||||||||||||
Sbjct: 34433216 gcaaaaataaaatgaaata 34433234

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 103      ttgcaaaaataaaatgaaa 121
                |||||||||||||||||||
Sbjct: 24006942 ttgcaaaaataaaatgaaa 24006960

to top

>gb|AC068294.26|AC068294 Mus musculus 3 BAC RP23-418O21 (Roswell Park Cancer Institute Mouse BAC
              Library) complete sequence
          Length = 201750

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 144914 caaaaataaaatgaaatat 144932

to top

>gb|AC007185.12|AC007185 Drosophila melanogaster, chromosome 2L, region 36A-, BAC clone BACR44N04,
              complete sequence
          Length = 190651

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 105    gcaaaaataaaatgaaata 123
              |||||||||||||||||||
Sbjct: 189096 gcaaaaataaaatgaaata 189078

to top

>emb|AL731618.3|OSJN00269 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0012A12,
              complete sequence
          Length = 122766

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 103455 caaaaataaaatgaaatat 103437

to top

>gb|AC097474.3| Homo sapiens BAC clone RP11-93I21 from 4, complete sequence
          Length = 156568

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    caaaaataaaatgaaatat 124
              |||||||||||||||||||
Sbjct: 104378 caaaaataaaatgaaatat 104360

to top

>gb|AC104407.3| Homo sapiens BAC clone RP11-92A5 from 4, complete sequence
          Length = 102822

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 52506 aaaaataaaatgaaatata 52488

to top

>gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold
          Length = 1570569

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 86     taggaatagaaggtagatt 104
              |||||||||||||||||||
Sbjct: 507217 taggaatagaaggtagatt 507235

to top

>gb|AC157658.2| Mus musculus BAC clone RP23-331E4 from chromosome 12, complete sequence
          Length = 203717

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 131504 aaaaataaaatgaaatata 131522

to top

>gb|AC154405.2| Mus musculus BAC clone RP24-248O10 from chromosome 12, complete
             sequence
          Length = 158411

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 101   gattgcaaaaataaaatgaaatataca 127
             |||| |||||||||||| |||||||||
Sbjct: 88388 gattacaaaaataaaataaaatataca 88414

to top

>gb|AC158497.2| Medicago truncatula chromosome 2 BAC clone mth2-48e18, complete
             sequence
          Length = 146321

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 51877 caaaaataaaatgaaatat 51859



 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 25322 caaaaataaaatgaaatat 25304

to top

>gb|AC006214.1|AC006214 Drosophila melanogaster, chromosome 2L, region 36A7-36A13, P1 clones
             DS04680 and DS00592, complete sequence
          Length = 129779

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   gcaaaaataaaatgaaata 123
             |||||||||||||||||||
Sbjct: 51762 gcaaaaataaaatgaaata 51744

to top

>gb|AC067953.4| Homo sapiens BAC clone RP11-253E24 from 2, complete sequence
          Length = 91209

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 113  aaaatgaaatatacagcca 131
            |||||||||||||||||||
Sbjct: 4782 aaaatgaaatatacagcca 4764

to top

>gb|AY190947.1| Drosophila pseudoobscura clone DPSF01_40_G23 (D1426) genomic sequence
          Length = 42336

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 108   aaaataaaatgaaatatac 126
             |||||||||||||||||||
Sbjct: 19395 aaaataaaatgaaatatac 19377

to top

>gb|AC084273.20| Mus musculus strain C57BL/6J chromosome 6 clone rp23-313e8, complete
             sequence
          Length = 182818

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 109   aaataaaatgaaatataca 127
             |||||||||||||||||||
Sbjct: 28413 aaataaaatgaaatataca 28431

to top

>gb|AC092573.2| Homo sapiens BAC clone RP11-1O7 from 2, complete sequence
          Length = 171265

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 45     tatttactggaacaaaata 63
              |||||||||||||||||||
Sbjct: 139827 tatttactggaacaaaata 139845

to top

>emb|BX470229.4| Zebrafish DNA sequence from clone DKEY-193B15 in linkage group 2,
              complete sequence
          Length = 241018

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 208191 aaaaataaaatgaaatata 208209

to top

>dbj|AP003216.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OSJNBa0090K04
          Length = 152556

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 103    ttgcaaaaataaaatgaaa 121
              |||||||||||||||||||
Sbjct: 121464 ttgcaaaaataaaatgaaa 121482

to top

>emb|BX088724.6| Zebrafish DNA sequence from clone DKEY-15G22, complete sequence
          Length = 198368

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 105   gcaaaaataaaatgaaata 123
             |||||||||||||||||||
Sbjct: 21955 gcaaaaataaaatgaaata 21973

to top

>emb|BX649445.5| Zebrafish DNA sequence from clone DKEY-177H9 in linkage group 7,
             complete sequence
          Length = 159167

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    aacaaaataactgttaatt 73
             |||||||||||||||||||
Sbjct: 85852 aacaaaataactgttaatt 85834

to top

>dbj|BS000203.1| Pan troglodytes chromosome 22 clone:PTB-155H17, map 22, complete
              sequences
          Length = 196470

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 101    gattgcaaaaataaaatgaaata 123
              |||| ||||||||||||||||||
Sbjct: 167379 gatttcaaaaataaaatgaaata 167401

to top

>dbj|BS000068.1| Pan troglodytes chromosome 22 clone:RP43-046F21, map 22, complete
             sequences
          Length = 163689

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 77811 aaaaataaaatgaaatata 77793

to top

>emb|AL591374.5| Zebrafish DNA sequence from clone BUSM1-204B6 in linkage group 6,
             complete sequence
          Length = 102137

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 48944 aaaaataaaatgaaatata 48926

to top

>emb|CT963112.1| Medicago truncatula chromosome 5 clone mth2-117d22, COMPLETE SEQUENCE
          Length = 118597

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 81201 caaaaataaaatgaaatat 81219

to top

>emb|CR293523.11| Zebrafish DNA sequence from clone DKEY-104J7 in linkage group 7, complete
              sequence
          Length = 214581

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 101    gattgcaaaaataaaatgaaata 123
              |||| ||||||||||||||||||
Sbjct: 128394 gattacaaaaataaaatgaaata 128372

to top

>emb|BX255937.13| Zebrafish DNA sequence from clone CH211-191D7 in linkage group 20,
             complete sequence
          Length = 165726

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   gcaaaaataaaatgaaata 123
             |||||||||||||||||||
Sbjct: 10947 gcaaaaataaaatgaaata 10929

to top

>emb|BX510920.6| Zebrafish DNA sequence from clone DKEY-30J22 in linkage group 20,
             complete sequence
          Length = 220240

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 109   aaataaaatgaaatataca 127
             |||||||||||||||||||
Sbjct: 97679 aaataaaatgaaatataca 97661

to top

>emb|AL591462.5| Zebrafish DNA sequence from clone BUSM1-204D19 in linkage group 6,
             complete sequence
          Length = 77242

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 107   aaaaataaaatgaaatata 125
             |||||||||||||||||||
Sbjct: 49644 aaaaataaaatgaaatata 49662

to top

>gb|AC157510.1| Dasypus novemcinctus, clone Dasypus novemcinctus-10241875J15, complete
             sequence
          Length = 41401

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 108   aaaataaaatgaaatatac 126
             |||||||||||||||||||
Sbjct: 25882 aaaataaaatgaaatatac 25864

to top

>gb|AC131992.8| Mus musculus chromosome 1, clone RP24-190B16, complete sequence
          Length = 163820

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 43     catatttactggaacaaaa 61
              |||||||||||||||||||
Sbjct: 131002 catatttactggaacaaaa 130984

to top

>gb|AC157473.1| Medicago truncatula chromosome 7 BAC clone mte1-11e4, complete sequence
          Length = 125310

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 63683 caaaaataaaatgaaatat 63665

to top

>gb|AE003652.2| Drosophila melanogaster chromosome 2L, section 61 of 83 of the complete
             sequence
          Length = 262525

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   gcaaaaataaaatgaaata 123
             |||||||||||||||||||
Sbjct: 30887 gcaaaaataaaatgaaata 30869

to top

>gb|AE003557.4| Drosophila melanogaster chromosome 3L, section 28 of 83 of the complete
             sequence
          Length = 287988

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 83877 caaaaataaaatgaaatat 83859

to top

>emb|AL355834.4|CNS05TCN Human chromosome 14 DNA sequence BAC R-932A10 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 222275

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 219307 aaaaataaaatgaaatata 219289

to top

>dbj|AP001725.1| Homo sapiens genomic DNA, chromosome 21q, section 69/105
          Length = 340000

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 101    gattgcaaaaataaaatgaaata 123
              |||| ||||||||||||||||||
Sbjct: 296924 gatttcaaaaataaaatgaaata 296946

to top

>gb|AE015927.1| Clostridium tetani E88, complete genome
          Length = 2799251

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 99     tagattgcaaaaataaaatgaaa 121
              ||||||| |||||||||||||||
Sbjct: 887290 tagattgtaaaaataaaatgaaa 887268

to top

>dbj|AP003057.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-382M14, complete
              sequences
          Length = 190462

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 105    gcaaaaataaaatgaaata 123
              |||||||||||||||||||
Sbjct: 135693 gcaaaaataaaatgaaata 135711

to top

>gb|AE017332.1| Mycoplasma hyopneumoniae 232, complete genome
          Length = 892758

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 354187 aaaaataaaatgaaatata 354205

to top

>emb|CT010572.8| M.truncatula DNA sequence from clone MTH2-161L21 on chromosome 3,
             complete sequence
          Length = 121331

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 106   caaaaataaaatgaaatat 124
             |||||||||||||||||||
Sbjct: 17442 caaaaataaaatgaaatat 17460

to top

>gb|AE017143.1| Haemophilus ducreyi strain 35000HP complete genome
          Length = 1698955

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 103    ttgcaaaaataaaatgaaa 121
              |||||||||||||||||||
Sbjct: 501223 ttgcaaaaataaaatgaaa 501241

to top

>gb|AC153617.3| Mus musculus 6 BAC RP23-177G20 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 199525

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    tttactggaacaaaataac 65
             |||||||||||||||||||
Sbjct: 45931 tttactggaacaaaataac 45949

to top

>emb|AL844548.7| Mouse DNA sequence from clone RP23-263D22 on chromosome 2, complete
             sequence
          Length = 198946

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   gcaaaaataaaatgaaata 123
             |||||||||||||||||||
Sbjct: 77159 gcaaaaataaaatgaaata 77141

to top

>gb|AC005144.1|AC005144 Homo sapiens chromosome 17, clone hRPK.465_C_12, complete sequence
          Length = 73362

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 101   gattgcaaaaataaaatgaaata 123
             ||||||||||||||||| |||||
Sbjct: 33942 gattgcaaaaataaaataaaata 33920

to top

>emb|AL845264.18| Mouse DNA sequence from clone RP23-116F18 on chromosome 2, complete
              sequence
          Length = 207724

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 193792 aaaaataaaatgaaatata 193810

to top

>emb|AL929548.8| Zebrafish DNA sequence from clone CH211-159E17, complete sequence
          Length = 168842

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 104    tgcaaaaataaaatgaaat 122
              |||||||||||||||||||
Sbjct: 103020 tgcaaaaataaaatgaaat 103002

to top

>emb|CT025696.10| Mouse DNA sequence from clone RP24-344B20 on chromosome 9, complete
              sequence
          Length = 163726

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 53     ggaacaaaataactgttaa 71
              |||||||||||||||||||
Sbjct: 136182 ggaacaaaataactgttaa 136200

to top

>gb|AC004072.1|AC004072 Human Chromosome X clone bWXD342, complete sequence
          Length = 170658

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 105    gcaaaaataaaatgaaata 123
              |||||||||||||||||||
Sbjct: 109813 gcaaaaataaaatgaaata 109831

to top

>emb|AL929307.8| Zebrafish DNA sequence from clone CH211-85A24 in linkage group 20,
              complete sequence
          Length = 176518

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 55     aacaaaataactgttaatt 73
              |||||||||||||||||||
Sbjct: 101727 aacaaaataactgttaatt 101709

to top

>dbj|AP004965.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT20J05, TM0143b,
             complete sequence
          Length = 83991

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 75    atacttactactaggaatagaag 97
             |||||| ||||||||||||||||
Sbjct: 54129 atacttgctactaggaatagaag 54107

to top

>dbj|AP004512.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10L16, TM0042,
             complete sequence
          Length = 85815

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 62    taactgttaattgatactt 80
             |||||||||||||||||||
Sbjct: 71991 taactgttaattgatactt 71973

to top

>emb|AL833773.6| Mouse DNA sequence from clone RP23-434A2 on chromosome 4, complete
              sequence
          Length = 157131

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 108    aaaataaaatgaaatatac 126
              |||||||||||||||||||
Sbjct: 101341 aaaataaaatgaaatatac 101359

to top

>emb|AJ292269.1|NSY292269 Nicotiana sylvestris DNA flanking T-DNA insert line S18K2L
          Length = 7228

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 105  gcaaaaataaaatgaaata 123
            |||||||||||||||||||
Sbjct: 6168 gcaaaaataaaatgaaata 6150

to top

>emb|AL671185.8| Mouse DNA sequence from clone RP23-192N1 on chromosome X, complete
            sequence
          Length = 229574

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 56   acaaaataactgttaattg 74
            |||||||||||||||||||
Sbjct: 3596 acaaaataactgttaattg 3578

to top

>emb|AL163171.4|CNS01RIF Human chromosome 14 DNA sequence BAC R-406A9 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 148578

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 102    attgcaaaaataaaatgaa 120
              |||||||||||||||||||
Sbjct: 129100 attgcaaaaataaaatgaa 129082

to top

>emb|AL355095.4|CNS05TCE Human chromosome 14 DNA sequence BAC R-11K13 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 153099

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 102   attgcaaaaataaaatgaa 120
             |||||||||||||||||||
Sbjct: 46638 attgcaaaaataaaatgaa 46620

to top

>emb|AL161804.4|CNS01RHL Human chromosome 14 DNA sequence BAC R-409I10 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 151853

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 101029 aaaaataaaatgaaatata 101047

to top

>emb|BX294368.7| Zebrafish DNA sequence from clone CH211-244N12 in linkage group 6,
              complete sequence
          Length = 147484

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 107    aaaaataaaatgaaatata 125
              |||||||||||||||||||
Sbjct: 130184 aaaaataaaatgaaatata 130202

to top

>dbj|AP000694.1| Homo sapiens genomic DNA, chromosome 21q22.2, BAC clone:KB5G11,
             CBR1-HLCS region
          Length = 101608

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 101   gattgcaaaaataaaatgaaata 123
             |||| ||||||||||||||||||
Sbjct: 17091 gatttcaaaaataaaatgaaata 17113


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,399,096
Number of Sequences: 3902068
Number of extensions: 2399096
Number of successful extensions: 265296
Number of sequences better than 10.0: 216
Number of HSP's better than 10.0 without gapping: 216
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 263915
Number of HSP's gapped (non-prelim): 1381
length of query: 141
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 120
effective length of database: 17,151,101,840
effective search space: 2058132220800
effective search space used: 2058132220800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result