| Clone Name | rbaal10g22 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_475153.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 618 Score = 89.7 bits (45), Expect = 9e-15 Identities = 125/151 (82%), Gaps = 3/151 (1%) Strand = Plus / Minus Query: 158 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 217 ||||||||||| ||||||||||||||| ||||||||||| | || ||| ||| |||| Sbjct: 605 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 546 Query: 218 ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 277 |||||||||| |||||| ||||||| ||||||| ||||||| || ||||||||||| Sbjct: 545 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 486 Query: 278 tcga---tctcctcatcgtcctgggctgctg 305 |||| ||| ||||| ||||||||||||| Sbjct: 485 tcgacggcctcatcatcttcctgggctgctg 455 Score = 60.0 bits (30), Expect = 8e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 |||||||||| |||| ||| |||||| |||||||||| || | ||||||||||||||| Sbjct: 280 tcttgctcttcttgacagtaacacggctcacaccagtgatagacttcatgccaagctt 223
>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0025P09, complete sequence Length = 167318 Score = 89.7 bits (45), Expect = 9e-15 Identities = 125/151 (82%), Gaps = 3/151 (1%) Strand = Plus / Minus Query: 158 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 217 ||||||||||| ||||||||||||||| ||||||||||| | || ||| ||| |||| Sbjct: 129674 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 129615 Query: 218 ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 277 |||||||||| |||||| ||||||| ||||||| ||||||| || ||||||||||| Sbjct: 129614 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 129555 Query: 278 tcga---tctcctcatcgtcctgggctgctg 305 |||| ||| ||||| ||||||||||||| Sbjct: 129554 tcgacggcctcatcatcttcctgggctgctg 129524 Score = 60.0 bits (30), Expect = 8e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 |||||||||| |||| ||| |||||| |||||||||| || | ||||||||||||||| Sbjct: 129257 tcttgctcttcttgacagtaacacggctcacaccagtgatagacttcatgccaagctt 129200
>gb|AC108874.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1005_E12, complete sequence Length = 121293 Score = 89.7 bits (45), Expect = 9e-15 Identities = 125/151 (82%), Gaps = 3/151 (1%) Strand = Plus / Minus Query: 158 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 217 ||||||||||| ||||||||||||||| ||||||||||| | || ||| ||| |||| Sbjct: 469 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 410 Query: 218 ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 277 |||||||||| |||||| ||||||| ||||||| ||||||| || ||||||||||| Sbjct: 409 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 350 Query: 278 tcga---tctcctcatcgtcctgggctgctg 305 |||| ||| ||||| ||||||||||||| Sbjct: 349 tcgacggcctcatcatcttcctgggctgctg 319
>dbj|AB110178.1| Oryza sativa (japonica cultivar-group) mRNA for nascent polypeptide associated complex alpha chain, complete cds, clone: 13YPG044 Length = 878 Score = 89.7 bits (45), Expect = 9e-15 Identities = 125/151 (82%), Gaps = 3/151 (1%) Strand = Plus / Minus Query: 158 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 217 ||||||||||| ||||||||||||||| ||||||||||| | || ||| ||| |||| Sbjct: 622 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 563 Query: 218 ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 277 |||||||||| |||||| ||||||| ||||||| ||||||| || ||||||||||| Sbjct: 562 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 503 Query: 278 tcga---tctcctcatcgtcctgggctgctg 305 |||| ||| ||||| ||||||||||||| Sbjct: 502 tcgacggcctcatcatcttcctgggctgctg 472 Score = 60.0 bits (30), Expect = 8e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 |||||||||| |||| ||| |||||| |||||||||| || | ||||||||||||||| Sbjct: 297 tcttgctcttcttgacagtaacacggctcacaccagtgatagacttcatgccaagctt 240
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 89.7 bits (45), Expect = 9e-15 Identities = 125/151 (82%), Gaps = 3/151 (1%) Strand = Plus / Minus Query: 158 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 217 ||||||||||| ||||||||||||||| ||||||||||| | || ||| ||| |||| Sbjct: 17869720 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 17869661 Query: 218 ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 277 |||||||||| |||||| ||||||| ||||||| ||||||| || ||||||||||| Sbjct: 17869660 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 17869601 Query: 278 tcga---tctcctcatcgtcctgggctgctg 305 |||| ||| ||||| ||||||||||||| Sbjct: 17869600 tcgacggcctcatcatcttcctgggctgctg 17869570 Score = 60.0 bits (30), Expect = 8e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 |||||||||| |||| ||| |||||| |||||||||| || | ||||||||||||||| Sbjct: 17869303 tcttgctcttcttgacagtaacacggctcacaccagtgatagacttcatgccaagctt 17869246
>dbj|AK058906.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-D09, full insert sequence Length = 930 Score = 89.7 bits (45), Expect = 9e-15 Identities = 125/151 (82%), Gaps = 3/151 (1%) Strand = Plus / Minus Query: 158 tccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagccctggat 217 ||||||||||| ||||||||||||||| ||||||||||| | || ||| ||| |||| Sbjct: 684 tccatgatggctgtgacgatgtcgccattggcagccttgagtgccttcaccgccttggac 625 Query: 218 ctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacaccagtctca 277 |||||||||| |||||| ||||||| ||||||| ||||||| || ||||||||||| Sbjct: 624 ctcgacacggtggcctgggtcatcaccagctcgatgtccttcggctcgacaccagtctcg 565 Query: 278 tcga---tctcctcatcgtcctgggctgctg 305 |||| ||| ||||| ||||||||||||| Sbjct: 564 tcgacggcctcatcatcttcctgggctgctg 534 Score = 60.0 bits (30), Expect = 8e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 |||||||||| |||| ||| |||||| |||||||||| || | ||||||||||||||| Sbjct: 359 tcttgctcttcttgacagtaacacggctcacaccagtgatagacttcatgccaagctt 302
>ref|NM_190087.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 609 Score = 77.8 bits (39), Expect = 3e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| ||||| ||||| |||||| | ||||||||||||| Sbjct: 362 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 303 Query: 458 tctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcaca 517 ||||| || |||| ||| || | ||||||||||||||||||| |||||| ||||| Sbjct: 302 tctggtttagagatgacgaacagaatgttcttgctctttttgatagtgacacggctcaca 243 Query: 518 ccagtaatggccttcatgccaag 540 ||||| |||| |||||||||||| Sbjct: 242 ccagtgatggtcttcatgccaag 220 Score = 75.8 bits (38), Expect = 1e-10 Identities = 131/162 (80%) Strand = Plus / Minus Query: 145 ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 204 |||||| |||| |||||||||||| |||| ||||| || | |||||||| |||| || Sbjct: 609 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 550 Query: 205 cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 264 ||| ||||| ||||||||||||| |||||| ||||||| || || | ||||||| || Sbjct: 549 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 490 Query: 265 aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 306 || |||| |||||||| |||||| || ||||| |||||||| Sbjct: 489 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 448
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaag 540 ||||||||||||||||||| |||||| |||||||||| |||| |||||||||||| Sbjct: 41208715 tcttgctctttttgatagtgacacggctcacaccagtgatggtcttcatgccaag 41208661 Score = 75.8 bits (38), Expect = 1e-10 Identities = 131/162 (80%) Strand = Plus / Minus Query: 145 ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 204 |||||| |||| |||||||||||| |||| ||||| || | |||||||| |||| || Sbjct: 41209147 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 41209088 Query: 205 cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 264 ||| ||||| ||||||||||||| |||||| ||||||| || || | ||||||| || Sbjct: 41209087 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 41209028 Query: 265 aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 306 || |||| |||||||| |||||| || ||||| |||||||| Sbjct: 41209027 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 41208986 Score = 42.1 bits (21), Expect = 1.9 Identities = 54/65 (83%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| ||||| ||||| |||||| | ||||||||||||| Sbjct: 41208900 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 41208841 Query: 458 tctgg 462 ||||| Sbjct: 41208840 tctgg 41208836
>dbj|AP003412.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1150F11 Length = 130355 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaag 540 ||||||||||||||||||| |||||| |||||||||| |||| |||||||||||| Sbjct: 25630 tcttgctctttttgatagtgacacggctcacaccagtgatggtcttcatgccaag 25576 Score = 75.8 bits (38), Expect = 1e-10 Identities = 131/162 (80%) Strand = Plus / Minus Query: 145 ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 204 |||||| |||| |||||||||||| |||| ||||| || | |||||||| |||| || Sbjct: 26062 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 26003 Query: 205 cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 264 ||| ||||| ||||||||||||| |||||| ||||||| || || | ||||||| || Sbjct: 26002 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 25943 Query: 265 aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 306 || |||| |||||||| |||||| || ||||| |||||||| Sbjct: 25942 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 25901 Score = 42.1 bits (21), Expect = 1.9 Identities = 54/65 (83%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| ||||| ||||| |||||| | ||||||||||||| Sbjct: 25815 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 25756 Query: 458 tctgg 462 ||||| Sbjct: 25755 tctgg 25751
>dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0504E02 Length = 137468 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaag 540 ||||||||||||||||||| |||||| |||||||||| |||| |||||||||||| Sbjct: 105770 tcttgctctttttgatagtgacacggctcacaccagtgatggtcttcatgccaag 105716 Score = 75.8 bits (38), Expect = 1e-10 Identities = 131/162 (80%) Strand = Plus / Minus Query: 145 ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 204 |||||| |||| |||||||||||| |||| ||||| || | |||||||| |||| || Sbjct: 106202 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 106143 Query: 205 cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 264 ||| ||||| ||||||||||||| |||||| ||||||| || || | ||||||| || Sbjct: 106142 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 106083 Query: 265 aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 306 || |||| |||||||| |||||| || ||||| |||||||| Sbjct: 106082 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 106041 Score = 42.1 bits (21), Expect = 1.9 Identities = 54/65 (83%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| ||||| ||||| |||||| | ||||||||||||| Sbjct: 105955 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 105896 Query: 458 tctgg 462 ||||| Sbjct: 105895 tctgg 105891
>dbj|AK109341.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-F04, full insert sequence Length = 909 Score = 77.8 bits (39), Expect = 3e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| ||||| ||||| |||||| | ||||||||||||| Sbjct: 474 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 415 Query: 458 tctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcaca 517 ||||| || |||| ||| || | ||||||||||||||||||| |||||| ||||| Sbjct: 414 tctggtttagagatgacgaacagaatgttcttgctctttttgatagtgacacggctcaca 355 Query: 518 ccagtaatggccttcatgccaag 540 ||||| |||| |||||||||||| Sbjct: 354 ccagtgatggtcttcatgccaag 332 Score = 75.8 bits (38), Expect = 1e-10 Identities = 131/162 (80%) Strand = Plus / Minus Query: 145 ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 204 |||||| |||| |||||||||||| |||| ||||| || | |||||||| |||| || Sbjct: 721 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 662 Query: 205 cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 264 ||| ||||| ||||||||||||| |||||| ||||||| || || | ||||||| || Sbjct: 661 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 602 Query: 265 aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 306 || |||| |||||||| |||||| || ||||| |||||||| Sbjct: 601 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 560
>dbj|AK101971.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076L24, full insert sequence Length = 976 Score = 77.8 bits (39), Expect = 3e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| ||||| ||||| |||||| | ||||||||||||| Sbjct: 453 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 394 Query: 458 tctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcaca 517 ||||| || |||| ||| || | ||||||||||||||||||| |||||| ||||| Sbjct: 393 tctggtttagagatgacgaacagaatgttcttgctctttttgatagtgacacggctcaca 334 Query: 518 ccagtaatggccttcatgccaag 540 ||||| |||| |||||||||||| Sbjct: 333 ccagtgatggtcttcatgccaag 311 Score = 67.9 bits (34), Expect = 3e-08 Identities = 130/162 (80%) Strand = Plus / Minus Query: 145 ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 204 |||||| |||| |||||||||||| |||| ||||| || | |||||||| |||| || Sbjct: 700 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 641 Query: 205 cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 264 ||| ||||| ||||||||||||| |||||| ||||||| || || | ||||||| || Sbjct: 640 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 581 Query: 265 aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 306 || |||| |||||||| | |||| || ||||| |||||||| Sbjct: 580 gacgccagactcatcgaccccctcgtcatcctgagctgctgc 539
>dbj|AK070627.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055N09, full insert sequence Length = 3171 Score = 77.8 bits (39), Expect = 3e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| ||||| ||||| |||||| | ||||||||||||| Sbjct: 2732 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 2673 Query: 458 tctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcaca 517 ||||| || |||| ||| || | ||||||||||||||||||| |||||| ||||| Sbjct: 2672 tctggtttagagatgacgaacagaatgttcttgctctttttgatagtgacacggctcaca 2613 Query: 518 ccagtaatggccttcatgccaag 540 ||||| |||| |||||||||||| Sbjct: 2612 ccagtgatggtcttcatgccaag 2590 Score = 75.8 bits (38), Expect = 1e-10 Identities = 131/162 (80%) Strand = Plus / Minus Query: 145 ctagttagtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactc 204 |||||| |||| |||||||||||| |||| ||||| || | |||||||| |||| || Sbjct: 2979 ctagttcgtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgcctt 2920 Query: 205 cacagccctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtc 264 ||| ||||| ||||||||||||| |||||| ||||||| || || | ||||||| || Sbjct: 2919 caccgccctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctc 2860 Query: 265 aacaccagtctcatcgatctcctcatcgtcctgggctgctgc 306 || |||| |||||||| |||||| || ||||| |||||||| Sbjct: 2859 gacgccagactcatcgacctcctcgtcatcctgagctgctgc 2818
>dbj|AK059437.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G10, full insert sequence Length = 873 Score = 77.8 bits (39), Expect = 3e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| ||||| ||||| |||||| | ||||||||||||| Sbjct: 452 tcctcgatcttcgcctcaccgaagatgacgtaggtgtctgagtttgggctcttgaagaca 393 Query: 458 tctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcaca 517 ||||| || |||| ||| || | ||||||||||||||||||| |||||| ||||| Sbjct: 392 tctggtttagagatgacgaacagaatgttcttgctctttttgatagtgacacggctcaca 333 Query: 518 ccagtaatggccttcatgccaag 540 ||||| |||| |||||||||||| Sbjct: 332 ccagtgatggtcttcatgccaag 310 Score = 69.9 bits (35), Expect = 8e-09 Identities = 125/155 (80%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcgccatccgcagccttgagcgactccacagcc 211 |||| |||||||||||| |||| ||||| || | |||||||| |||| || ||| ||| Sbjct: 692 gtcagctccatgatggcagtgacaatgtcaccgttagcagccttcagcgccttcaccgcc 633 Query: 212 ctggatctcgacacggaggcctgcatcatcacgagctcgacgtccttcttgtcaacacca 271 || ||||||||||||| |||||| ||||||| || || | ||||||| || || ||| Sbjct: 632 ctcgatctcgacacggtggcctgtgtcatcaccagttcaatgtccttcggctcgacgcca 573 Query: 272 gtctcatcgatctcctcatcgtcctgggctgctgc 306 | |||||||| |||||| || ||||| |||||||| Sbjct: 572 gactcatcgacctcctcgtcatcctgagctgctgc 538
>ref|NM_114807.2| Arabidopsis thaliana unknown protein AT3G49470 mRNA, complete cds Length = 938 Score = 50.1 bits (25), Expect = 0.008 Identities = 61/73 (83%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| || |||||||||||||| ||| |||||| |||||| Sbjct: 472 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 413 Query: 458 tctggcttggaga 470 || ||||| |||| Sbjct: 412 tcaggcttagaga 400
>emb|AL132964.2|ATT9C5 Arabidopsis thaliana DNA chromosome 3, BAC clone T9C5 Length = 104204 Score = 50.1 bits (25), Expect = 0.008 Identities = 61/73 (83%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| || |||||||||||||| ||| |||||| |||||| Sbjct: 17660 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 17601 Query: 458 tctggcttggaga 470 || ||||| |||| Sbjct: 17600 tcaggcttagaga 17588
>gb|AY072536.1| Arabidopsis thaliana alpha NAC-like protein (At3g49470; T9C5.70) mRNA, complete cds Length = 706 Score = 50.1 bits (25), Expect = 0.008 Identities = 61/73 (83%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| || |||||||||||||| ||| |||||| |||||| Sbjct: 389 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 330 Query: 458 tctggcttggaga 470 || ||||| |||| Sbjct: 329 tcaggcttagaga 317
>gb|AF370545.1|AF370545 Arabidopsis thaliana alpha NAC-like protein (T9C5.70) mRNA, complete cds Length = 966 Score = 50.1 bits (25), Expect = 0.008 Identities = 61/73 (83%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| || |||||||||||||| ||| |||||| |||||| Sbjct: 472 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 413 Query: 458 tctggcttggaga 470 || ||||| |||| Sbjct: 412 tcaggcttagaga 400
>emb|BX825921.1|CNS0A553 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL72ZG01 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 923 Score = 50.1 bits (25), Expect = 0.008 Identities = 61/73 (83%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| || |||||||||||||| ||| |||||| |||||| Sbjct: 450 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 391 Query: 458 tctggcttggaga 470 || ||||| |||| Sbjct: 390 tcaggcttagaga 378
>gb|AC012329.5|AC012329 Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence Length = 80367 Score = 50.1 bits (25), Expect = 0.008 Identities = 61/73 (83%) Strand = Plus / Minus Query: 398 tcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagaca 457 ||||||| ||| |||| ||||| || |||||||||||||| ||| |||||| |||||| Sbjct: 62800 tcctcgatcttggcctcaccgaatataacataggtttctgaatgcgggctcttaaagaca 62741 Query: 458 tctggcttggaga 470 || ||||| |||| Sbjct: 62740 tcaggcttagaga 62728
>gb|BT016475.1| Zea mays clone Contig308 mRNA sequence Length = 891 Score = 46.1 bits (23), Expect = 0.12 Identities = 116/147 (78%) Strand = Plus / Minus Query: 397 gtcctcgagcttaacctccccgaacatgacataggtttctgagcgcgagctcttgaagac 456 |||||||| ||| |||| ||||| ||||||||||| || ||| | ||||||||| || Sbjct: 441 gtcctcgatcttcgcctcgccgaatatgacataggtgtccgagtttgggctcttgaacac 382 Query: 457 atctggcttggagaggacatacgtcaccgtcttgctctttttgatagttacacggttcac 516 ||||||||| |||| |||| | || ||||||| || || | ||| || ||| | || Sbjct: 381 atctggcttcgagatgacaaaaagcatattcttgcttttcttcacagtgacccggctgac 322 Query: 517 accagtaatggccttcatgccaagctt 543 |||||| |||| ||||||||||||||| Sbjct: 321 accagtgatgggcttcatgccaagctt 295 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 352 cttgaactgctctgccgcttgtgtctgcag 381 ||||||||||||||| ||||| |||||||| Sbjct: 483 cttgaactgctctgcagcttgggtctgcag 454
>gb|AY231744.1| Drosophila yakuba clone yak-em_Nacalpha mRNA sequence Length = 198 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 150 tagtcaactccatgatggcgctgacgatgtc 180 |||||| ||||||||||||| |||||||||| Sbjct: 193 tagtcagctccatgatggcgttgacgatgtc 163
>gb|BC091311.1| Rattus norvegicus hypothetical protein LOC289786, mRNA (cDNA clone IMAGE:7311803), partial cds Length = 1864 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 445 gctcttgaagacatctggcttgg 467 ||||||||||||||||||||||| Sbjct: 1447 gctcttgaagacatctggcttgg 1425
>ref|XM_214092.3| PREDICTED: Rattus norvegicus similar to mKIAA0363 protein (LOC289786), mRNA Length = 4028 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 445 gctcttgaagacatctggcttgg 467 ||||||||||||||||||||||| Sbjct: 3633 gctcttgaagacatctggcttgg 3611
>gb|AF220200.1|AF220200 Pinus taeda nascent polypeptide associated complex alpha chain mRNA, complete cds Length = 1057 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 352 cttgaactgctctgccgcttgtgtctg 378 ||||||||||||||| ||||||||||| Sbjct: 489 cttgaactgctctgcagcttgtgtctg 463
>ref|NM_112074.2| Arabidopsis thaliana unknown protein AT3G12390 mRNA, complete cds Length = 884 Score = 44.1 bits (22), Expect = 0.47 Identities = 49/58 (84%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 ||||||||||||||| || || ||| | |||||||| |||| |||||||||||||| Sbjct: 356 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 299
>gb|AY522625.1| Oreochromis mossambicus nascent polypeptide-associated complex alpha polypeptide-like mRNA, partial sequence Length = 461 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||||||||||||||| ||||||||||| Sbjct: 348 gtcaactccatgatggcattgacgatgtcg 319
>emb|CR712159.2|CNS0GCGB Tetraodon nigroviridis full-length cDNA Length = 750 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR722249.2|CNS0GK8F Tetraodon nigroviridis full-length cDNA Length = 754 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 645 gtcaattccatgatggcgttgacgatgtcg 616
>emb|CR722169.2|CNS0GK67 Tetraodon nigroviridis full-length cDNA Length = 1366 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 1263 gtcaattccatgatggcgttgacgatgtcg 1234
>emb|CR717966.2|CNS0GGXG Tetraodon nigroviridis full-length cDNA Length = 755 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR717497.2|CNS0GGKF Tetraodon nigroviridis full-length cDNA Length = 456 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 347 gtcaattccatgatggcgttgacgatgtcg 318
>emb|CR716901.2|CNS0GG3Y Tetraodon nigroviridis full-length cDNA Length = 750 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR716022.2|CNS0GFFM Tetraodon nigroviridis full-length cDNA Length = 520 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 411 gtcaattccatgatggcgttgacgatgtcg 382
>emb|CR715618.2|CNS0GF4E Tetraodon nigroviridis full-length cDNA Length = 453 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 349 gtcaattccatgatggcgttgacgatgtcg 320
>emb|CR715460.2|CNS0GF00 Tetraodon nigroviridis full-length cDNA Length = 755 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR714862.2|CNS0GEJE Tetraodon nigroviridis full-length cDNA Length = 754 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617
>emb|CR714224.2|CNS0GE1O Tetraodon nigroviridis full-length cDNA Length = 757 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR712921.2|CNS0GD1H Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR712868.2|CNS0GD00 Tetraodon nigroviridis full-length cDNA Length = 751 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR710910.2|CNS0GBHM Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR710585.2|CNS0GB8L Tetraodon nigroviridis full-length cDNA Length = 754 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR709573.2|CNS0GAGH Tetraodon nigroviridis full-length cDNA Length = 515 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 411 gtcaattccatgatggcgttgacgatgtcg 382
>emb|CR706444.2|CNS0G81K Tetraodon nigroviridis full-length cDNA Length = 755 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR704473.2|CNS0G6IT Tetraodon nigroviridis full-length cDNA Length = 463 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 354 gtcaattccatgatggcgttgacgatgtcg 325
>emb|CR702894.2|CNS0G5AY Tetraodon nigroviridis full-length cDNA Length = 1294 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 1184 gtcaattccatgatggcgttgacgatgtcg 1155
>emb|CR702653.2|CNS0G549 Tetraodon nigroviridis full-length cDNA Length = 1355 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 1261 gtcaattccatgatggcgttgacgatgtcg 1232
>emb|CR702124.2|CNS0G4PK Tetraodon nigroviridis full-length cDNA Length = 463 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 354 gtcaattccatgatggcgttgacgatgtcg 325
>emb|CR701979.2|CNS0G4LJ Tetraodon nigroviridis full-length cDNA Length = 750 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR701629.2|CNS0G4BT Tetraodon nigroviridis full-length cDNA Length = 1355 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 1258 gtcaattccatgatggcgttgacgatgtcg 1229
>emb|CR699096.2|CNS0G2DG Tetraodon nigroviridis full-length cDNA Length = 1361 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 1264 gtcaattccatgatggcgttgacgatgtcg 1235
>emb|CR698619.2|CNS0G207 Tetraodon nigroviridis full-length cDNA Length = 655 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 551 gtcaattccatgatggcgttgacgatgtcg 522
>emb|CR698352.2|CNS0G1SS Tetraodon nigroviridis full-length cDNA Length = 1052 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617
>emb|CR697288.2|CNS0G0Z8 Tetraodon nigroviridis full-length cDNA Length = 1362 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 1260 gtcaattccatgatggcgttgacgatgtcg 1231
>emb|CR696825.2|CNS0G0MD Tetraodon nigroviridis full-length cDNA Length = 1370 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 1261 gtcaattccatgatggcgttgacgatgtcg 1232
>emb|CR696554.2|CNS0G0EU Tetraodon nigroviridis full-length cDNA Length = 545 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 436 gtcaattccatgatggcgttgacgatgtcg 407
>emb|CR696276.2|CNS0G074 Tetraodon nigroviridis full-length cDNA Length = 435 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 326 gtcaattccatgatggcgttgacgatgtcg 297
>emb|CR695626.2|CNS0FZP2 Tetraodon nigroviridis full-length cDNA Length = 1055 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 646 gtcaattccatgatggcgttgacgatgtcg 617
>emb|CR695732.2|CNS0FZS0 Tetraodon nigroviridis full-length cDNA Length = 750 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR694436.2|CNS0FYS0 Tetraodon nigroviridis full-length cDNA Length = 1018 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 644 gtcaattccatgatggcgttgacgatgtcg 615
>emb|CR688523.2|CNS0FU7R Tetraodon nigroviridis full-length cDNA Length = 420 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 311 gtcaattccatgatggcgttgacgatgtcg 282
>emb|CR688181.2|CNS0FTY9 Tetraodon nigroviridis full-length cDNA Length = 981 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 648 gtcaattccatgatggcgttgacgatgtcg 619
>emb|CR688138.2|CNS0FTX2 Tetraodon nigroviridis full-length cDNA Length = 750 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR687296.2|CNS0FT9O Tetraodon nigroviridis full-length cDNA Length = 1052 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR682385.2|CNS0FPH9 Tetraodon nigroviridis full-length cDNA Length = 1363 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 1260 gtcaattccatgatggcgttgacgatgtcg 1231
>emb|CR675609.2|CNS0FK9R Tetraodon nigroviridis full-length cDNA Length = 707 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 606 gtcaattccatgatggcgttgacgatgtcg 577
>emb|CR664046.2|CNS0FBCK Tetraodon nigroviridis full-length cDNA Length = 1047 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 938 gtcaattccatgatggcgttgacgatgtcg 909
>emb|CR663607.2|CNS0FB0D Tetraodon nigroviridis full-length cDNA Length = 1200 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 1089 gtcaattccatgatggcgttgacgatgtcg 1060
>emb|CR661227.2|CNS0F969 Tetraodon nigroviridis full-length cDNA Length = 1044 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 935 gtcaattccatgatggcgttgacgatgtcg 906
>emb|CR660613.2|CNS0F8P7 Tetraodon nigroviridis full-length cDNA Length = 1051 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 645 gtcaattccatgatggcgttgacgatgtcg 616
>emb|CR660539.2|CNS0F8N5 Tetraodon nigroviridis full-length cDNA Length = 948 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 839 gtcaattccatgatggcgttgacgatgtcg 810
>emb|CR655127.2|CNS0F4GT Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR653087.2|CNS0F2W5 Tetraodon nigroviridis full-length cDNA Length = 750 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR652468.2|CNS0F2EY Tetraodon nigroviridis full-length cDNA Length = 749 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR651752.2|CNS0F1V2 Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR651630.2|CNS0F1RO Tetraodon nigroviridis full-length cDNA Length = 1056 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 648 gtcaattccatgatggcgttgacgatgtcg 619
>emb|CR650255.2|CNS0F0PH Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR647893.2|CNS0EYVV Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR647713.2|CNS0EYQV Tetraodon nigroviridis full-length cDNA Length = 755 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR639196.2|CNS0ES6A Tetraodon nigroviridis full-length cDNA Length = 755 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR637873.2|CNS0ER5J Tetraodon nigroviridis full-length cDNA Length = 749 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR636835.2|CNS0EQCP Tetraodon nigroviridis full-length cDNA Length = 755 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR634963.2|CNS0EOWP Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR632932.2|CNS0ENCA Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR632678.2|CNS0EN58 Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR632573.2|CNS0EN2B Tetraodon nigroviridis full-length cDNA Length = 749 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR632323.2|CNS0EMVD Tetraodon nigroviridis full-length cDNA Length = 749 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR632317.2|CNS0EMV7 Tetraodon nigroviridis full-length cDNA Length = 755 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR631332.2|CNS0EM3T Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>emb|CR631747.2|CNS0EMFD Tetraodon nigroviridis full-length cDNA Length = 756 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||| |||||||||||| ||||||||||| Sbjct: 647 gtcaattccatgatggcgttgacgatgtcg 618
>gb|AY094022.1| Arabidopsis thaliana AT3g12390/T2E22_130 mRNA, complete cds Length = 612 Score = 44.1 bits (22), Expect = 0.47 Identities = 49/58 (84%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 ||||||||||||||| || || ||| | |||||||| |||| |||||||||||||| Sbjct: 271 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 214
>gb|AY048232.1| Arabidopsis thaliana AT3g12390/T2E22_130 mRNA, complete cds Length = 861 Score = 44.1 bits (22), Expect = 0.47 Identities = 49/58 (84%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 ||||||||||||||| || || ||| | |||||||| |||| |||||||||||||| Sbjct: 356 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 299
>emb|BX824815.1|CNS0A5HP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZH02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 635 Score = 44.1 bits (22), Expect = 0.47 Identities = 49/58 (84%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 ||||||||||||||| || || ||| | |||||||| |||| |||||||||||||| Sbjct: 121 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 64
>gb|AC069474.4|AC069474 Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence Length = 105768 Score = 44.1 bits (22), Expect = 0.47 Identities = 49/58 (84%) Strand = Plus / Plus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 ||||||||||||||| || || ||| | |||||||| |||| |||||||||||||| Sbjct: 84642 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 84699
>gb|AY168640.1| Oreochromis niloticus nascent polypeptide-associated complex alpha polypeptide (naca) mRNA, complete cds Length = 808 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcg 181 ||||||||||||||||| ||||||||||| Sbjct: 677 gtcaactccatgatggcattgacgatgtcg 648
>dbj|AP002047.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MQC3 Length = 86536 Score = 44.1 bits (22), Expect = 0.47 Identities = 49/58 (84%) Strand = Plus / Minus Query: 486 tcttgctctttttgatagttacacggttcacaccagtaatggccttcatgccaagctt 543 ||||||||||||||| || || ||| | |||||||| |||| |||||||||||||| Sbjct: 56823 tcttgctctttttgacggtgactcggctaacaccagtgatgggtttcatgccaagctt 56766
>emb|CT033503.1| Platynereis dumerilii EST IB0AAA19AH12EM1 Length = 813 Score = 44.1 bits (22), Expect = 0.47 Identities = 31/34 (91%) Strand = Plus / Minus Query: 263 tcaacaccagtctcatcgatctcctcatcgtcct 296 ||||| ||||| ||||||||||||||||| |||| Sbjct: 593 tcaactccagtgtcatcgatctcctcatcatcct 560
>emb|CT033502.1| Platynereis dumerilii EST IB0AAA19AH12FM1 Length = 655 Score = 44.1 bits (22), Expect = 0.47 Identities = 31/34 (91%) Strand = Plus / Plus Query: 263 tcaacaccagtctcatcgatctcctcatcgtcct 296 ||||| ||||| ||||||||||||||||| |||| Sbjct: 221 tcaactccagtgtcatcgatctcctcatcatcct 254
>emb|CT033318.1| Platynereis dumerilii EST IB0AAA22CF02EM1 Length = 798 Score = 44.1 bits (22), Expect = 0.47 Identities = 31/34 (91%) Strand = Plus / Minus Query: 263 tcaacaccagtctcatcgatctcctcatcgtcct 296 ||||| ||||| ||||||||||||||||| |||| Sbjct: 586 tcaactccagtgtcatcgatctcctcatcatcct 553
>emb|CT033317.1| Platynereis dumerilii EST IB0AAA22CF02FM1 Length = 782 Score = 44.1 bits (22), Expect = 0.47 Identities = 31/34 (91%) Strand = Plus / Plus Query: 263 tcaacaccagtctcatcgatctcctcatcgtcct 296 ||||| ||||| ||||||||||||||||| |||| Sbjct: 213 tcaactccagtgtcatcgatctcctcatcatcct 246
>emb|CT032495.1| Platynereis dumerilii EST IB0AAA37BF03EM1 Length = 814 Score = 44.1 bits (22), Expect = 0.47 Identities = 31/34 (91%) Strand = Plus / Minus Query: 263 tcaacaccagtctcatcgatctcctcatcgtcct 296 ||||| ||||| ||||||||||||||||| |||| Sbjct: 590 tcaactccagtgtcatcgatctcctcatcatcct 557
>emb|CT032494.1| Platynereis dumerilii EST IB0AAA37BF03FM1 Length = 804 Score = 44.1 bits (22), Expect = 0.47 Identities = 31/34 (91%) Strand = Plus / Plus Query: 263 tcaacaccagtctcatcgatctcctcatcgtcct 296 ||||| ||||| ||||||||||||||||| |||| Sbjct: 225 tcaactccagtgtcatcgatctcctcatcatcct 258
>gb|BT016765.1| Zea mays clone Contig598 mRNA sequence Length = 957 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 515 acaccagtaatggccttcatgccaagctt 543 |||||||| |||| ||||||||||||||| Sbjct: 340 acaccagtgatgggcttcatgccaagctt 312
>ref|XM_609695.2| PREDICTED: Bos taurus similar to Nascent polypeptide-associated complex alpha subunit, muscle-specific form (Alpha-NAC, muscle-specific form) (LOC531208), mRNA Length = 8513 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtc 180 |||| ||||||||||||| |||||||||| Sbjct: 8264 gtcagctccatgatggcgttgacgatgtc 8236
>gb|AC079440.38| Mus musculus strain 129/Sv clone ct7-340l7 map 2, complete sequence Length = 131387 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 523 aatggccttcatgccaagctt 543 ||||||||||||||||||||| Sbjct: 129024 aatggccttcatgccaagctt 129044
>gb|AC083797.16| Homo sapiens 3 BAC RP11-114A6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 157113 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 cacaactccaccttccagaac 144 ||||||||||||||||||||| Sbjct: 104829 cacaactccaccttccagaac 104849
>emb|AL954374.4| Mouse DNA sequence from clone RP23-445A5 on chromosome 2, complete sequence Length = 87941 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 523 aatggccttcatgccaagctt 543 ||||||||||||||||||||| Sbjct: 25818 aatggccttcatgccaagctt 25838
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome Length = 3052398 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 162 tgatggcgctgacgatgtcgccatc 186 ||||||||||| ||||||||||||| Sbjct: 675148 tgatggcgctggcgatgtcgccatc 675172
>gb|AY103873.1| Zea mays PCO094039 mRNA sequence Length = 984 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 515 acaccagtaatggccttcatgccaagctt 543 |||||||| |||| ||||||||||||||| Sbjct: 341 acaccagtgatgggcttcatgccaagctt 313
>emb|CT025599.16| Mouse DNA sequence from clone RP24-254G12 on chromosome 14, complete sequence Length = 170436 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 3 aaacaccttcaaaacctagtttcaa 27 |||||| |||||||||||||||||| Sbjct: 35425 aaacacattcaaaacctagtttcaa 35449
>gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete sequence Length = 182105 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 157 ctccatgatggcgctgacgatgtc 180 ||||||||||||| |||||||||| Sbjct: 23136 ctccatgatggcgttgacgatgtc 23159
>gb|BT012765.1| Lycopersicon esculentum clone 113714F, mRNA sequence Length = 820 Score = 40.1 bits (20), Expect = 7.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 266 acaccagtctcatcgatctcctcatcgtcctg 297 |||||||||||||| | |||||||||||||| Sbjct: 512 acaccagtctcatctacatcctcatcgtcctg 481
>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence Length = 234127 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 451 gaagacatctggcttggaga 470 |||||||||||||||||||| Sbjct: 220809 gaagacatctggcttggaga 220790
>ref|XM_883486.1| Leishmania major strain Friedlin nascent polypeptide associated complex subunit (L4830.08) partial mRNA Length = 735 Score = 40.1 bits (20), Expect = 7.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 152 gtcaactccatgatggcgctgacgatgtcgcc 183 |||| ||||||||||| | ||||||||||||| Sbjct: 728 gtcagctccatgatggtgttgacgatgtcgcc 697
>emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end Length = 247462 Score = 40.1 bits (20), Expect = 7.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 152 gtcaactccatgatggcgctgacgatgtcgcc 183 |||| ||||||||||| | ||||||||||||| Sbjct: 79339 gtcagctccatgatggtgttgacgatgtcgcc 79370
>ref|XM_847221.1| PREDICTED: Canis familiaris similar to nascent polypeptide-associated complex alpha polypeptide (LOC609875), mRNA Length = 360 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 157 ctccatgatggcgctgacgatgtc 180 ||||||||||||| |||||||||| Sbjct: 348 ctccatgatggcgttgacgatgtc 325
>gb|AC114819.4| Mus musculus BAC clone RP23-52J20 from chromosome 8, complete sequence Length = 204239 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 451 gaagacatctggcttggaga 470 |||||||||||||||||||| Sbjct: 16326 gaagacatctggcttggaga 16307
>gb|AC117211.3| Mus musculus BAC clone RP23-287M3 from 3, complete sequence Length = 206579 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 516 caccagtaatggccttcatg 535 |||||||||||||||||||| Sbjct: 38895 caccagtaatggccttcatg 38876
>emb|CR688321.2|CNS0FU25 Tetraodon nigroviridis full-length cDNA Length = 1371 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 158 tccatgatggcgctgacgatgtcg 181 |||||||||||| ||||||||||| Sbjct: 1257 tccatgatggcgttgacgatgtcg 1234
>emb|CR686631.2|CNS0FSR7 Tetraodon nigroviridis full-length cDNA Length = 1357 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 158 tccatgatggcgctgacgatgtcg 181 |||||||||||| ||||||||||| Sbjct: 1260 tccatgatggcgttgacgatgtcg 1237
>emb|X04891.1|TN21TNPA Transposon Tn21 tnpA gene for transposase Length = 3176 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tcgtcctgggctgctgccat 309 |||||||||||||||||||| Sbjct: 2174 tcgtcctgggctgctgccat 2155
>emb|BX927338.6| Zebrafish DNA sequence from clone CH211-223O15 in linkage group 5, complete sequence Length = 187498 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 447 tcttgaagacatctggcttg 466 |||||||||||||||||||| Sbjct: 24092 tcttgaagacatctggcttg 24111
>ref|NM_165950.1| Drosophila melanogaster Nascent polypeptide associated complex protein alpha subunit CG8759-RC, transcript variant C (Nacalpha), mRNA Length = 874 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 157 ctccatgatggcgctgacgatgtc 180 ||||||||||||| |||||||||| Sbjct: 695 ctccatgatggcgttgacgatgtc 672
>ref|NM_134312.2| Drosophila melanogaster Nascent polypeptide associated complex protein alpha subunit CG8759-RA, transcript variant A (Nacalpha), mRNA Length = 870 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 157 ctccatgatggcgctgacgatgtc 180 ||||||||||||| |||||||||| Sbjct: 686 ctccatgatggcgttgacgatgtc 663
>ref|NM_057868.3| Drosophila melanogaster Nascent polypeptide associated complex protein alpha subunit CG8759-RB, transcript variant B (Nacalpha), mRNA Length = 897 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 157 ctccatgatggcgctgacgatgtc 180 ||||||||||||| |||||||||| Sbjct: 713 ctccatgatggcgttgacgatgtc 690
>gb|AY075332.1| Drosophila melanogaster GH11940 full length cDNA Length = 890 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 157 ctccatgatggcgctgacgatgtc 180 ||||||||||||| |||||||||| Sbjct: 684 ctccatgatggcgttgacgatgtc 661
>gb|AE003821.4| Drosophila melanogaster chromosome 2R, section 29 of 73 of the complete sequence Length = 294168 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 157 ctccatgatggcgctgacgatgtc 180 ||||||||||||| |||||||||| Sbjct: 238219 ctccatgatggcgttgacgatgtc 238242
>gb|AF017783.2|AF017783 Drosophila melanogaster alpha NAC, diacylglycerol kinase epsilon and ubiquinol-cytochrome C reductase complex genes, complete cds; and unknown gene Length = 4728 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 157 ctccatgatggcgctgacgatgtc 180 ||||||||||||| |||||||||| Sbjct: 779 ctccatgatggcgttgacgatgtc 756
>gb|AY109787.1| Zea mays CL9345_1 mRNA sequence Length = 846 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 275 tcatcgatctcctcatcgtc 294 |||||||||||||||||||| Sbjct: 347 tcatcgatctcctcatcgtc 366
>gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, region 49C1-49D3, P1 clones DS04499, DS06146, and DS00455, complete sequence Length = 145055 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 157 ctccatgatggcgctgacgatgtc 180 ||||||||||||| |||||||||| Sbjct: 59899 ctccatgatggcgttgacgatgtc 59922
>emb|BX255901.3| Mouse DNA sequence from clone RP23-200D14 on chromosome 4, complete sequence Length = 16695 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 260 ttgtcaacaccagtctcatc 279 |||||||||||||||||||| Sbjct: 14660 ttgtcaacaccagtctcatc 14679
>emb|Y08969.1|DMNACPRAL D.melanogaster mRNA for NAC protein alpha subunit Length = 829 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 157 ctccatgatggcgctgacgatgtc 180 ||||||||||||| |||||||||| Sbjct: 646 ctccatgatggcgttgacgatgtc 623 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,607,952 Number of Sequences: 3902068 Number of extensions: 3607952 Number of successful extensions: 63210 Number of sequences better than 10.0: 132 Number of HSP's better than 10.0 without gapping: 132 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 62938 Number of HSP's gapped (non-prelim): 265 length of query: 543 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 520 effective length of database: 17,143,297,704 effective search space: 8914514806080 effective search space used: 8914514806080 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)