>gb|AY808336.1| Schistosoma japonicum SJCHGC02128 protein mRNA, partial cds
          Length = 671

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 35/37 (94%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 67  aatacagtttgtccatggnattgagtgaatacagttt 103
           ||||||||||| |||||| ||||||||||||||||||
Sbjct: 38  aatacagtttgcccatgg-attgagtgaatacagttt 3

>dbj|AB228030.1| Aspergillus oryzae cDNA, contig sequence: AoEST4903
          Length = 351

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 35/37 (94%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 67  aatacagtttgtccatggnattgagtgaatacagttt 103
           ||||||||||| |||||| ||||||||||||||||||
Sbjct: 64  aatacagtttgcccatgg-attgagtgaatacagttt 29

>gb|AY810440.1| Schistosoma japonicum clone SJCHGC09357 unknown mRNA
          Length = 1145

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 35/37 (94%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 67   aatacagtttgtccatggnattgagtgaatacagttt 103
            ||||||||||| |||||| ||||||||||||||||||
Sbjct: 1056 aatacagtttgcccatgg-attgagtgaatacagttt 1091

>gb|AY813070.1| Schistosoma japonicum SJCHGC02109 protein mRNA, complete cds
          Length = 683

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 72  agtttgtccatggnattgagtgaatacagttt 103
           |||||| |||||| ||||||||||||||||||
Sbjct: 38  agtttgcccatgg-attgagtgaatacagttt 8

>gb|AC162892.7| Mus musculus chromosome 5, clone RP23-257D19, complete sequence
          Length = 155647

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    atcagttatctcaactctc 41
             |||||||||||||||||||
Sbjct: 90370 atcagttatctcaactctc 90388

>gb|AF241733.2| Homo sapiens chromosome X clone RP1-123H2 map p11.4, complete sequence
          Length = 133159

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 16    aagtcacatcagttatctc 34
             |||||||||||||||||||
Sbjct: 34324 aagtcacatcagttatctc 34342

>emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022E24 on chromosome 20 Contains the
              3' end of the OPRL1 gene for opiate receptor-like 1
              protein, the GPR8 gene encoding a G protein-coupled
              receptor, the KIAA0835 gene encoding a protein similar to
              the myelin transcription factor 1 (MYT1), a novel gene, 7
              CpG islands, ESTs, STSs and GSSs, complete sequence
          Length = 179888

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     acacaagtcacatcagtta 30
              |||||||||||||||||||
Sbjct: 116244 acacaagtcacatcagtta 116226

>emb|AL031679.1|HS836E8 Human DNA sequence from clone RP5-836E8 on chromosome 20p12 Contains a
             FUSIP1 pseudogene (pFUSIP1) and a CpG island, complete
             sequence
          Length = 119296

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                       
Query: 64    tgaaatacagtttgtccatggnattg 89
             |||||||||||||||||| || ||||
Sbjct: 27333 tgaaatacagtttgtccagggcattg 27358

>gb|AC008629.7| Homo sapiens chromosome 5 clone CTB-161M19, complete sequence
          Length = 151881

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 59   acaagtgaaatacagtttg 77
            |||||||||||||||||||
Sbjct: 3621 acaagtgaaatacagtttg 3603

>gb|AC010462.6| Homo sapiens chromosome 5 clone CTD-2276M2, complete sequence
          Length = 136506

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 59    acaagtgaaatacagtttg 77
             |||||||||||||||||||
Sbjct: 15411 acaagtgaaatacagtttg 15429

>ref|NG_001017.1| Homo sapiens FUSIP1 pseudogene (pFUSIP1) on chromosome 20
          Length = 722

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 64  tgaaatacagtttgtccatggnattg 89
           |||||||||||||||||| || ||||
Sbjct: 340 tgaaatacagtttgtccagggcattg 365

>gb|AC173996.2| Pan troglodytes chromosome X clone PTB-074P14 map human ortholog p11.4,
              complete sequence
          Length = 160565

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 16     aagtcacatcagttatctc 34
              |||||||||||||||||||
Sbjct: 139880 aagtcacatcagttatctc 139898

>gb|AC012459.7| Homo sapiens BAC clone RP11-527G2 from 2, complete sequence
          Length = 175554

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 62    agtgaaatacagtttgtccatgg 84
             |||||||||||||||||| ||||
Sbjct: 52904 agtgaaatacagtttgtcaatgg 52926

>gb|AC154008.1| Mus musculus 6 BAC RP24-470H20 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 139613

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 64    tgaaatacagtttgtccat 82
             |||||||||||||||||||
Sbjct: 17819 tgaaatacagtttgtccat 17837

>gb|AC154007.6| Mus musculus 6 BAC RP24-484F15 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 169935

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 64     tgaaatacagtttgtccat 82
              |||||||||||||||||||
Sbjct: 132515 tgaaatacagtttgtccat 132533

>gb|AC175364.1| Pan troglodytes chromosome X clone CH251-210F7 map human ortholog
             p11.4, complete sequence
          Length = 153433

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 16    aagtcacatcagttatctc 34
             |||||||||||||||||||
Sbjct: 22916 aagtcacatcagttatctc 22934


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 586,816
Number of Sequences: 3902068
Number of extensions: 586816
Number of successful extensions: 36582
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 36559
Number of HSP's gapped (non-prelim): 24
length of query: 104
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 83
effective length of database: 17,151,101,840
effective search space: 1423541452720
effective search space used: 1423541452720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)