ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal6f03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY808336.1| Schistosoma japonicum SJCHGC02128 protein mRNA, p... 80 1e-12
2gb|AY810440.1| Schistosoma japonicum clone SJCHGC09357 unknown mRNA 80 1e-12
3dbj|AB228030.1| Aspergillus oryzae cDNA, contig sequence: AoEST4903 74 9e-11
4gb|AY813070.1| Schistosoma japonicum SJCHGC02109 protein mRNA, c... 64 8e-08
5gb|BC111587.1| Homo sapiens dystrophin (muscular dystrophy, Duch... 52 3e-04
6ref|NM_004006.1| Homo sapiens dystrophin (muscular dystrophy, Du... 52 3e-04
7ref|NM_004007.1| Homo sapiens dystrophin (muscular dystrophy, Du... 52 3e-04
8ref|NM_004009.1| Homo sapiens dystrophin (muscular dystrophy, Du... 52 3e-04
9ref|NM_004010.1| Homo sapiens dystrophin (muscular dystrophy, Du... 52 3e-04
10ref|NM_000109.2| Homo sapiens dystrophin (muscular dystrophy, Du... 52 3e-04
11gb|BC036103.1| Homo sapiens dystrophin (muscular dystrophy, Duch... 52 3e-04
12gb|AF213415.1|AF213415 Homo sapiens dystrophin (DMD) gene, exon ... 52 3e-04
13gb|M18533.1|HUMDYS Homo sapiens dystrophin (DMD) mRNA, complete cds 52 3e-04
14gb|AC004468.1|AC004468 Homo sapiens Xp21 PAC RPCI1-37A12 contain... 52 3e-04
15emb|X06178.1|HSDMDA1 Human adult muscle mRNA fragment of DMD gen... 48 0.005
16emb|X14298.1|HSDMDR Human mRNA for dystrophin 48 0.005
17ref|XM_520996.1| PREDICTED: Pan troglodytes similar to dystrophi... 44 0.077
18emb|CT009681.2| Pan troglodytes chromosome X BAC PTB-134F20, com... 44 0.077
19gb|AY068584.1| Schmidtea mediterranea clone H.67.9a(T3) unknown ... 44 0.077
20gb|AC162892.7| Mus musculus chromosome 5, clone RP23-257D19, com... 38 4.8
21gb|AF241733.2| Homo sapiens chromosome X clone RP1-123H2 map p11... 38 4.8
22emb|Z83104.1|CEF09B12 Caenorhabditis elegans Cosmid F09B12, comp... 38 4.8
23emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022... 38 4.8
24emb|AL117341.26|HSBA512N4 Human DNA sequence from clone RP11-512... 38 4.8
25gb|AC069547.7| Homo sapiens chromosome 10 clone RP11-521C22, com... 38 4.8
26gb|AC173996.2| Pan troglodytes chromosome X clone PTB-074P14 map... 38 4.8
27gb|AC175364.1| Pan troglodytes chromosome X clone CH251-210F7 ma... 38 4.8

>gb|AY808336.1| Schistosoma japonicum SJCHGC02128 protein mRNA, partial cds
          Length = 671

 Score = 79.8 bits (40), Expect = 1e-12
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                   
Query: 66  agtgaatacagtttgcccatggattgagtgaatacagttt 105
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 42  agtgaatacagtttgcccatggattgagtgaatacagttt 3



to top

>gb|AY810440.1| Schistosoma japonicum clone SJCHGC09357 unknown mRNA
          Length = 1145

 Score = 79.8 bits (40), Expect = 1e-12
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                    
Query: 66   agtgaatacagtttgcccatggattgagtgaatacagttt 105
            ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1052 agtgaatacagtttgcccatggattgagtgaatacagttt 1091



to top

>dbj|AB228030.1| Aspergillus oryzae cDNA, contig sequence: AoEST4903
          Length = 351

 Score = 73.8 bits (37), Expect = 9e-11
 Identities = 37/37 (100%)
 Strand = Plus / Minus

                                                
Query: 69  gaatacagtttgcccatggattgagtgaatacagttt 105
           |||||||||||||||||||||||||||||||||||||
Sbjct: 65  gaatacagtttgcccatggattgagtgaatacagttt 29



to top

>gb|AY813070.1| Schistosoma japonicum SJCHGC02109 protein mRNA, complete cds
          Length = 683

 Score = 63.9 bits (32), Expect = 8e-08
 Identities = 39/40 (97%), Gaps = 1/40 (2%)
 Strand = Plus / Minus

                                                   
Query: 66  agtgaatacagtttgcccatggattgagtgaatacagttt 105
           |||||||| |||||||||||||||||||||||||||||||
Sbjct: 46  agtgaata-agtttgcccatggattgagtgaatacagttt 8



to top

>gb|BC111587.1| Homo sapiens dystrophin (muscular dystrophy, Duchenne and Becker
            types), mRNA (cDNA clone MGC:133407 IMAGE:40080544),
            complete cds, with stop codon, in Gateway system
          Length = 11112

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 66   agtgaatacagtttgcccatggattg 91
            ||||||||||||||||||||||||||
Sbjct: 1898 agtgaatacagtttgcccatggattg 1873



to top

>ref|NM_004006.1| Homo sapiens dystrophin (muscular dystrophy, Duchenne and Becker
            types) (DMD), transcript variant Dp427m, mRNA
          Length = 13993

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 66   agtgaatacagtttgcccatggattg 91
            ||||||||||||||||||||||||||
Sbjct: 2112 agtgaatacagtttgcccatggattg 2087



to top

>ref|NM_004007.1| Homo sapiens dystrophin (muscular dystrophy, Duchenne and Becker
            types) (DMD), transcript variant Dp427l, mRNA
          Length = 13764

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 66   agtgaatacagtttgcccatggattg 91
            ||||||||||||||||||||||||||
Sbjct: 1883 agtgaatacagtttgcccatggattg 1858



to top

>ref|NM_004009.1| Homo sapiens dystrophin (muscular dystrophy, Duchenne and Becker
            types) (DMD), transcript variant Dp427p1, mRNA
          Length = 14000

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 66   agtgaatacagtttgcccatggattg 91
            ||||||||||||||||||||||||||
Sbjct: 2119 agtgaatacagtttgcccatggattg 2094



to top

>ref|NM_004010.1| Homo sapiens dystrophin (muscular dystrophy, Duchenne and Becker
            types) (DMD), transcript variant Dp427p2, mRNA
          Length = 14082

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 66   agtgaatacagtttgcccatggattg 91
            ||||||||||||||||||||||||||
Sbjct: 2201 agtgaatacagtttgcccatggattg 2176



to top

>ref|NM_000109.2| Homo sapiens dystrophin (muscular dystrophy, Duchenne and Becker
            types) (DMD), transcript variant Dp427c, mRNA
          Length = 14069

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 66   agtgaatacagtttgcccatggattg 91
            ||||||||||||||||||||||||||
Sbjct: 2188 agtgaatacagtttgcccatggattg 2163



to top

>gb|BC036103.1| Homo sapiens dystrophin (muscular dystrophy, Duchenne and Becker
            types), mRNA (cDNA clone IMAGE:5274415), complete cds
          Length = 3870

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 66   agtgaatacagtttgcccatggattg 91
            ||||||||||||||||||||||||||
Sbjct: 2020 agtgaatacagtttgcccatggattg 1995



to top

>gb|AF213415.1|AF213415 Homo sapiens dystrophin (DMD) gene, exon 16 and partial cds
          Length = 454

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 66  agtgaatacagtttgcccatggattg 91
           ||||||||||||||||||||||||||
Sbjct: 247 agtgaatacagtttgcccatggattg 222



to top

>gb|M18533.1|HUMDYS Homo sapiens dystrophin (DMD) mRNA, complete cds
          Length = 13957

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 66   agtgaatacagtttgcccatggattg 91
            ||||||||||||||||||||||||||
Sbjct: 2076 agtgaatacagtttgcccatggattg 2051



to top

>gb|AC004468.1|AC004468 Homo sapiens Xp21 PAC RPCI1-37A12 containing exons 10 to 16 of the
              Duchenne Muscular Dystrophy gene, complete sequence
          Length = 127757

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 66     agtgaatacagtttgcccatggattg 91
              ||||||||||||||||||||||||||
Sbjct: 113322 agtgaatacagtttgcccatggattg 113297



to top

>emb|X06178.1|HSDMDA1 Human adult muscle mRNA fragment of DMD gene (DMD= Duchenne
           muscular dystrophy)
          Length = 1966

 Score = 48.1 bits (24), Expect = 0.005
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 68  tgaatacagtttgcccatggattg 91
           ||||||||||||||||||||||||
Sbjct: 412 tgaatacagtttgcccatggattg 389



to top

>emb|X14298.1|HSDMDR Human mRNA for dystrophin
          Length = 12446

 Score = 48.1 bits (24), Expect = 0.005
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 68   tgaatacagtttgcccatggattg 91
            ||||||||||||||||||||||||
Sbjct: 1964 tgaatacagtttgcccatggattg 1941



to top

>ref|XM_520996.1| PREDICTED: Pan troglodytes similar to dystrophin Dp427c isoform;
           dystrophin (muscular dystrophy, Duchenne and Becker
           types), includes DXS142, DXS164, DXS206, DXS230, DXS239,
           DXS268, DXS269, DXS270, DXS272 (LOC465559), mRNA
          Length = 4674

 Score = 44.1 bits (22), Expect = 0.077
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 66  agtgaatacagtttgcccatggattg 91
           |||||||| |||||||||||||||||
Sbjct: 881 agtgaatatagtttgcccatggattg 856



to top

>emb|CT009681.2| Pan troglodytes chromosome X BAC PTB-134F20, complete sequence
          Length = 180303

 Score = 44.1 bits (22), Expect = 0.077
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 66    agtgaatacagtttgcccatggattg 91
             |||||||| |||||||||||||||||
Sbjct: 46200 agtgaatatagtttgcccatggattg 46175



to top

>gb|AY068584.1| Schmidtea mediterranea clone H.67.9a(T3) unknown mRNA sequence
          Length = 601

 Score = 44.1 bits (22), Expect = 0.077
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 76 gtttgcccatggattgagtgaa 97
          ||||||||||||||||||||||
Sbjct: 34 gtttgcccatggattgagtgaa 13



to top

>gb|AC162892.7| Mus musculus chromosome 5, clone RP23-257D19, complete sequence
          Length = 155647

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 27    atcagttatctcaactctc 45
             |||||||||||||||||||
Sbjct: 90370 atcagttatctcaactctc 90388



to top

>gb|AF241733.2| Homo sapiens chromosome X clone RP1-123H2 map p11.4, complete sequence
          Length = 133159

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 20    aagtcacatcagttatctc 38
             |||||||||||||||||||
Sbjct: 34324 aagtcacatcagttatctc 34342



to top

>emb|Z83104.1|CEF09B12 Caenorhabditis elegans Cosmid F09B12, complete sequence
          Length = 28278

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 52    caaacccggatacaagtga 70
             |||||||||||||||||||
Sbjct: 14766 caaacccggatacaagtga 14748



to top

>emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022E24 on chromosome 20 Contains the
              3' end of the OPRL1 gene for opiate receptor-like 1
              protein, the GPR8 gene encoding a G protein-coupled
              receptor, the KIAA0835 gene encoding a protein similar to
              the myelin transcription factor 1 (MYT1), a novel gene, 7
              CpG islands, ESTs, STSs and GSSs, complete sequence
          Length = 179888

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 16     acacaagtcacatcagtta 34
              |||||||||||||||||||
Sbjct: 116244 acacaagtcacatcagtta 116226



to top

>emb|AL117341.26|HSBA512N4 Human DNA sequence from clone RP11-512N4 on chromosome 10 Contains part
             of the gene for MOB protein, two novel genes and a CpG
             island, complete sequence
          Length = 181300

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 60    gatacaagtgaatacagtt 78
             |||||||||||||||||||
Sbjct: 15187 gatacaagtgaatacagtt 15205



to top

>gb|AC069547.7| Homo sapiens chromosome 10 clone RP11-521C22, complete sequence
          Length = 189144

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 60     gatacaagtgaatacagtt 78
              |||||||||||||||||||
Sbjct: 141189 gatacaagtgaatacagtt 141207



to top

>gb|AC173996.2| Pan troglodytes chromosome X clone PTB-074P14 map human ortholog p11.4,
              complete sequence
          Length = 160565

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 20     aagtcacatcagttatctc 38
              |||||||||||||||||||
Sbjct: 139880 aagtcacatcagttatctc 139898



to top

>gb|AC175364.1| Pan troglodytes chromosome X clone CH251-210F7 map human ortholog
             p11.4, complete sequence
          Length = 153433

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 20    aagtcacatcagttatctc 38
             |||||||||||||||||||
Sbjct: 22916 aagtcacatcagttatctc 22934


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 635,970
Number of Sequences: 3902068
Number of extensions: 635970
Number of successful extensions: 42648
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42595
Number of HSP's gapped (non-prelim): 53
length of query: 106
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 85
effective length of database: 17,151,101,840
effective search space: 1457843656400
effective search space used: 1457843656400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top