ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal6b14 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY062186.1| Oryza sativa chromatin-remodeling factor CHD3 (PKL) mRNA, complete cds Length = 4443 Score = 105 bits (53), Expect = 2e-19 Identities = 152/185 (82%) Strand = Plus / Minus Query: 503 aggaacattttgttcagtaagatcatcaggaacaggagttttcgtttttatcacagcata 562 ||||| || |||||||| ||||||||||||||||| ||||| ||||| |||||||| || Sbjct: 3609 aggaaaatcttgttcagcgagatcatcaggaacaggggtttttgttttaatcacagcgta 3550 Query: 563 ttcaatgtccaagcatttttctagaatatggtatctctttctgataaactcaacaatctt 622 ||||| | ||| ||| | || | || ||||||||||||||| ||||||||||| ||||| Sbjct: 3549 ttcaagattcaaacatctctccaaaagatggtatctctttctaataaactcaactatctt 3490 Query: 623 tctctggatgtccctgtattgggataggcttgttgggttcacctgcacttcctgtgtgct 682 |||||| | |||||||| ||| | ||| ||||||||| ||| |||| |||||||| Sbjct: 3489 tctctgtgtatccctgtaatggatcatgctcgttgggttcgactggccttcttgtgtgct 3430 Query: 683 ttcca 687 ||||| Sbjct: 3429 ttcca 3425 Score = 61.9 bits (31), Expect = 3e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 125 cctacacattaaccatcgatttccattttgtcctccggctttacagt 171 |||||| |||||| ||||||||||||||||||||||| ||| ||||| Sbjct: 4091 cctacaaattaactatcgatttccattttgtcctccgccttaacagt 4045 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 332 tcaaactgatggaggctgttggctagactcgcggaagctgccttgtcaccg 382 ||||||| ||||||||| ||||||| || | ||||||||||||||||||| Sbjct: 3842 tcaaacttatggaggctattggctaaaccggaggaagctgccttgtcaccg 3792
>dbj|AK065390.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013023A02, full insert sequence Length = 1605 Score = 105 bits (53), Expect = 2e-19 Identities = 152/185 (82%) Strand = Plus / Minus Query: 503 aggaacattttgttcagtaagatcatcaggaacaggagttttcgtttttatcacagcata 562 ||||| || |||||||| ||||||||||||||||| ||||| ||||| |||||||| || Sbjct: 853 aggaaaatcttgttcagcgagatcatcaggaacaggggtttttgttttaatcacagcgta 794 Query: 563 ttcaatgtccaagcatttttctagaatatggtatctctttctgataaactcaacaatctt 622 ||||| | ||| ||| | || | || ||||||||||||||| ||||||||||| ||||| Sbjct: 793 ttcaagattcaaacatctctccaaaagatggtatctctttctaataaactcaactatctt 734 Query: 623 tctctggatgtccctgtattgggataggcttgttgggttcacctgcacttcctgtgtgct 682 |||||| | |||||||| ||| | ||| ||||||||| ||| |||| |||||||| Sbjct: 733 tctctgtgtatccctgtaatggatcatgctcgttgggttcgactggccttcttgtgtgct 674 Query: 683 ttcca 687 ||||| Sbjct: 673 ttcca 669 Score = 61.9 bits (31), Expect = 3e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 125 cctacacattaaccatcgatttccattttgtcctccggctttacagt 171 |||||| |||||| ||||||||||||||||||||||| ||| ||||| Sbjct: 1335 cctacaaattaactatcgatttccattttgtcctccgccttaacagt 1289 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 332 tcaaactgatggaggctgttggctagactcgcggaagctgccttgtcaccg 382 ||||||| ||||||||| ||||||| || | ||||||||||||||||||| Sbjct: 1086 tcaaacttatggaggctattggctaaaccggaggaagctgccttgtcaccg 1036
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 67.9 bits (34), Expect = 4e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 590 atggtatctctttctgataaactcaacaatctttctctggatgtccctgtattgggatag 649 ||||||||||||||| ||||||||||| ||||||||||| | |||||||| ||| | Sbjct: 4180628 atggtatctctttctaataaactcaactatctttctctgtgtatccctgtaatggatcat 4180687 Query: 650 gcttgttgggttcacctgcacttcctgtgtgctttcca 687 ||| ||||||||| ||| |||| ||||||||||||| Sbjct: 4180688 gctcgttgggttcgactggccttcttgtgtgctttcca 4180725 Score = 61.9 bits (31), Expect = 3e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 125 cctacacattaaccatcgatttccattttgtcctccggctttacagt 171 |||||| |||||| ||||||||||||||||||||||| ||| ||||| Sbjct: 4178383 cctacaaattaactatcgatttccattttgtcctccgccttaacagt 4178429 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 332 tcaaactgatggaggctgttggctagactcgcggaagctgccttgtcaccg 382 ||||||| ||||||||| ||||||| || | ||||||||||||||||||| Sbjct: 4178632 tcaaacttatggaggctattggctaaaccggaggaagctgccttgtcaccg 4178682 Score = 48.1 bits (24), Expect = 0.039 Identities = 42/48 (87%) Strand = Plus / Plus Query: 503 aggaacattttgttcagtaagatcatcaggaacaggagttttcgtttt 550 ||||| || |||||||| ||||||||||||||||| ||||| ||||| Sbjct: 4180431 aggaaaatcttgttcagcgagatcatcaggaacaggggtttttgtttt 4180478
>dbj|AP005919.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0554A06 Length = 165311 Score = 67.9 bits (34), Expect = 4e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 590 atggtatctctttctgataaactcaacaatctttctctggatgtccctgtattgggatag 649 ||||||||||||||| ||||||||||| ||||||||||| | |||||||| ||| | Sbjct: 25849 atggtatctctttctaataaactcaactatctttctctgtgtatccctgtaatggatcat 25908 Query: 650 gcttgttgggttcacctgcacttcctgtgtgctttcca 687 ||| ||||||||| ||| |||| ||||||||||||| Sbjct: 25909 gctcgttgggttcgactggccttcttgtgtgctttcca 25946 Score = 61.9 bits (31), Expect = 3e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 125 cctacacattaaccatcgatttccattttgtcctccggctttacagt 171 |||||| |||||| ||||||||||||||||||||||| ||| ||||| Sbjct: 23604 cctacaaattaactatcgatttccattttgtcctccgccttaacagt 23650 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 332 tcaaactgatggaggctgttggctagactcgcggaagctgccttgtcaccg 382 ||||||| ||||||||| ||||||| || | ||||||||||||||||||| Sbjct: 23853 tcaaacttatggaggctattggctaaaccggaggaagctgccttgtcaccg 23903 Score = 48.1 bits (24), Expect = 0.039 Identities = 42/48 (87%) Strand = Plus / Plus Query: 503 aggaacattttgttcagtaagatcatcaggaacaggagttttcgtttt 550 ||||| || |||||||| ||||||||||||||||| ||||| ||||| Sbjct: 25652 aggaaaatcttgttcagcgagatcatcaggaacaggggtttttgtttt 25699
>dbj|AP007226.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBb0036B04 Length = 136159 Score = 67.9 bits (34), Expect = 4e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 590 atggtatctctttctgataaactcaacaatctttctctggatgtccctgtattgggatag 649 ||||||||||||||| ||||||||||| ||||||||||| | |||||||| ||| | Sbjct: 113887 atggtatctctttctaataaactcaactatctttctctgtgtatccctgtaatggatcat 113946 Query: 650 gcttgttgggttcacctgcacttcctgtgtgctttcca 687 ||| ||||||||| ||| |||| ||||||||||||| Sbjct: 113947 gctcgttgggttcgactggccttcttgtgtgctttcca 113984 Score = 61.9 bits (31), Expect = 3e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 125 cctacacattaaccatcgatttccattttgtcctccggctttacagt 171 |||||| |||||| ||||||||||||||||||||||| ||| ||||| Sbjct: 111642 cctacaaattaactatcgatttccattttgtcctccgccttaacagt 111688 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 332 tcaaactgatggaggctgttggctagactcgcggaagctgccttgtcaccg 382 ||||||| ||||||||| ||||||| || | ||||||||||||||||||| Sbjct: 111891 tcaaacttatggaggctattggctaaaccggaggaagctgccttgtcaccg 111941 Score = 48.1 bits (24), Expect = 0.039 Identities = 42/48 (87%) Strand = Plus / Plus Query: 503 aggaacattttgttcagtaagatcatcaggaacaggagttttcgtttt 550 ||||| || |||||||| ||||||||||||||||| ||||| ||||| Sbjct: 113690 aggaaaatcttgttcagcgagatcatcaggaacaggggtttttgtttt 113737
>gb|AY062188.1|AY062187S2 Oryza sativa (indica cultivar-group) chromatin-remodeling factor CHD3 (PKL) gene, exon 27 and complete cds Length = 1007 Score = 61.9 bits (31), Expect = 3e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 125 cctacacattaaccatcgatttccattttgtcctccggctttacagt 171 |||||| |||||| ||||||||||||||||||||||| ||| ||||| Sbjct: 56 cctacaaattaactatcgatttccattttgtcctccgccttaacagt 10
>gb|AC129926.4| Homo sapiens chromosome 17, clone RP11-663N22, complete sequence Length = 208551 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 541 ttttcgtttttatcacagcatattc 565 |||||||||||||||||| |||||| Sbjct: 69196 ttttcgtttttatcacagaatattc 69220 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 544 tcgtttttatcacagcatattcaa 567 ||||||||||||||| |||||||| Sbjct: 95179 tcgtttttatcacaggatattcaa 95202
>emb|CR378667.1| Photobacterium profundum SS9; segment 5/12 Length = 349080 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 499 ccataggaacattttgttcagtaag 523 |||||||| |||||||||||||||| Sbjct: 68924 ccataggatcattttgttcagtaag 68900
>gb|AC105282.5| Homo sapiens chromosome 18, clone RP11-452F20, complete sequence Length = 167258 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 648 aggcttgttgggttcacctgc 668 ||||||||||||||||||||| Sbjct: 92414 aggcttgttgggttcacctgc 92394
>gb|AC087297.13| Homo sapiens chromosome 17, clone RP11-362P24, complete sequence Length = 179026 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 541 ttttcgtttttatcacagcatattc 565 |||||||||||||||||| |||||| Sbjct: 54305 ttttcgtttttatcacagaatattc 54329 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 544 tcgtttttatcacagcatattcaa 567 ||||||||||||||| |||||||| Sbjct: 80289 tcgtttttatcacaggatattcaa 80312
>gb|AC091189.4| Homo sapiens chromosome 8, clone RP11-606D13, complete sequence Length = 174458 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 546 gtttttatcacagcatattca 566 ||||||||||||||||||||| Sbjct: 74989 gtttttatcacagcatattca 74969
>gb|AC105226.4| Homo sapiens chromosome 8, clone RP11-970F14, complete sequence Length = 107318 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 546 gtttttatcacagcatattca 566 ||||||||||||||||||||| Sbjct: 80742 gtttttatcacagcatattca 80722
>gb|AC116553.2| Homo sapiens chromosome 16 clone RP11-43P5, complete sequence Length = 173692 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 546 gtttttatcacagcatattca 566 ||||||||||||||||||||| Sbjct: 167999 gtttttatcacagcatattca 167979
>gb|AC019041.8| Homo sapiens BAC clone RP11-4K20 from 2, complete sequence Length = 183358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 551 tatcacagcatattcaatgtc 571 ||||||||||||||||||||| Sbjct: 134413 tatcacagcatattcaatgtc 134393
>gb|AC106785.3| Homo sapiens chromosome 16 clone RP11-352B15, complete sequence Length = 177461 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 546 gtttttatcacagcatattca 566 ||||||||||||||||||||| Sbjct: 92732 gtttttatcacagcatattca 92752
>gb|AC150385.2| Branchiostoma floridae clone CH302-101G3, complete sequence Length = 121661 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 659 gttcacctgcacttcctgtg 678 |||||||||||||||||||| Sbjct: 46024 gttcacctgcacttcctgtg 46043
>ref|XM_523395.1| PREDICTED: Pan troglodytes similar to RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein (LOC468003), mRNA Length = 4032 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 342 ggaggctgttggctagactcgcgg 365 ||||||||||||||| |||||||| Sbjct: 1525 ggaggctgttggctacactcgcgg 1502
>ref|XM_519928.1| PREDICTED: Pan troglodytes similar to mitochondrial ribosomal protein L13 (LOC464359), mRNA Length = 853 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 578 tttttctagaatatggtatctctt 601 |||| ||||||||||||||||||| Sbjct: 101 ttttgctagaatatggtatctctt 124
>gb|U93872.2| Kaposi's sarcoma-associated herpesvirus glycoprotein M, DNA replication protein, glycoprotein, DNA replication protein, FLICE inhibitory protein and v-cyclin genes, complete cds, and tegument protein gene, partial cds Length = 133661 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 tttgggggtagcagcgccgt 287 |||||||||||||||||||| Sbjct: 56028 tttgggggtagcagcgccgt 56047
>gb|AE001389.2| Plasmodium falciparum 3D7 chromosome 2 section 26 of 73 of the complete sequence Length = 10129 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 aagatcatcaggaacaggag 540 |||||||||||||||||||| Sbjct: 3674 aagatcatcaggaacaggag 3655
>gb|BC009190.2| Homo sapiens mitochondrial ribosomal protein L13, mRNA (cDNA clone MGC:15170 IMAGE:3956315), complete cds Length = 860 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 578 tttttctagaatatggtatctctt 601 |||| ||||||||||||||||||| Sbjct: 83 ttttgctagaatatggtatctctt 106
>ref|NM_014078.4| Homo sapiens mitochondrial ribosomal protein L13 (MRPL13), nuclear gene encoding mitochondrial protein, mRNA Length = 1113 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 578 tttttctagaatatggtatctctt 601 |||| ||||||||||||||||||| Sbjct: 352 ttttgctagaatatggtatctctt 375
>gb|AF148805.2| Human herpesvirus 8 isolate GK18, complete genome Length = 137969 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 tttgggggtagcagcgccgt 287 |||||||||||||||||||| Sbjct: 55828 tttgggggtagcagcgccgt 55847
>emb|Z69384.1|CET11G6 Caenorhabditis elegans Cosmid T11G6, complete sequence Length = 29461 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 317 tcctcacatactttctcaaa 336 |||||||||||||||||||| Sbjct: 12995 tcctcacatactttctcaaa 12976
>emb|AL691463.2| Human DNA sequence from clone RP11-290H6 on chromosome 10, complete sequence Length = 12679 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 418 aagcacaccacacatagatt 437 |||||||||||||||||||| Sbjct: 6491 aagcacaccacacatagatt 6510
>emb|BX572097.1| Prochlorococcus marinus MIT9313 complete genome; segment 3/7 Length = 349823 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 634 ccctgtattgggataggctt 653 |||||||||||||||||||| Sbjct: 124100 ccctgtattgggataggctt 124081
>emb|AL845465.2| Mouse DNA sequence from clone RP23-119B10 on chromosome 11, complete sequence Length = 37402 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 408 cgctgtcttcaagcacacca 427 |||||||||||||||||||| Sbjct: 18304 cgctgtcttcaagcacacca 18323
>gb|BC021744.2| Homo sapiens mitochondrial ribosomal protein L13, mRNA (cDNA clone MGC:33899 IMAGE:5260243), complete cds Length = 1101 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 578 tttttctagaatatggtatctctt 601 |||| ||||||||||||||||||| Sbjct: 331 ttttgctagaatatggtatctctt 354
>gb|AC107877.4| Homo sapiens chromosome 8, clone RP11-74P9, complete sequence Length = 181925 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 578 tttttctagaatatggtatctctt 601 |||| ||||||||||||||||||| Sbjct: 102787 ttttgctagaatatggtatctctt 102764
>gb|AC091819.3| Homo sapiens chromosome 5 clone CTC-264O10, complete sequence Length = 118603 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 608 aaactcaacaatctttctct 627 |||||||||||||||||||| Sbjct: 46183 aaactcaacaatctttctct 46202
>gb|AC011395.5| Homo sapiens chromosome 5 clone CTB-187I2, complete sequence Length = 96489 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 608 aaactcaacaatctttctct 627 |||||||||||||||||||| Sbjct: 32137 aaactcaacaatctttctct 32118
>gb|AC162801.2| Mus musculus BAC clone RP24-65E6 from chromosome 12, complete sequence Length = 225198 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 586 gaatatggtatctctttctg 605 |||||||||||||||||||| Sbjct: 92408 gaatatggtatctctttctg 92427
>gb|AF112214.1|AF112214 Homo sapiens ribosomal protein L13 mRNA, complete cds Length = 862 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 578 tttttctagaatatggtatctctt 601 |||| ||||||||||||||||||| Sbjct: 81 ttttgctagaatatggtatctctt 104
>emb|AL928958.15| Mouse DNA sequence from clone RP23-344N23 on chromosome 2, complete sequence Length = 163351 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 413 tcttcaagcacaccacacat 432 |||||||||||||||||||| Sbjct: 22444 tcttcaagcacaccacacat 22463
>dbj|AP005364.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1970D8, complete sequence Length = 168850 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 578 tttttctagaatatggtatctctt 601 |||| ||||||||||||||||||| Sbjct: 124382 ttttgctagaatatggtatctctt 124359
>gb|U75698.1|KSU75698 Kaposi's sarcoma-associated herpesvirus long unique region, 80 putative ORF's and kaposin gene, complete cds Length = 137508 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 tttgggggtagcagcgccgt 287 |||||||||||||||||||| Sbjct: 55729 tttgggggtagcagcgccgt 55748
>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome Length = 1751080 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 458 tctcaacacttcactgatatctgg 481 |||||||||||||||||| ||||| Sbjct: 600016 tctcaacacttcactgatttctgg 600039
>emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in linkage group 3, complete sequence Length = 170964 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 540 gttttcgtttttatcacagcatat 563 |||| ||||||||||||||||||| Sbjct: 60270 gtttacgtttttatcacagcatat 60293
>gb|AC164879.2| Mus musculus BAC clone RP23-354H10 from chromosome 14, complete sequence Length = 210602 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 596 tctctttctgataaactcaa 615 |||||||||||||||||||| Sbjct: 81609 tctctttctgataaactcaa 81590
>gb|AC005273.1|AC005273 Homo sapiens chromosome 17, clone hRPK.879_D_6, complete sequence Length = 122250 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 660 ttcacctgcacttcctgtgt 679 |||||||||||||||||||| Sbjct: 42373 ttcacctgcacttcctgtgt 42392
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 40.1 bits (20), Expect = 9.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 426 cacacatagattggtacaag 445 |||||||||||||||||||| Sbjct: 428016 cacacatagattggtacaag 427997
>dbj|AB049640.1| Homo sapiens MRPL13 mRNA for mitochondrial ribosomal protein L13 (L13mt), complete cds Length = 839 Score = 40.1 bits (20), Expect = 9.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 578 tttttctagaatatggtatctctt 601 |||| ||||||||||||||||||| Sbjct: 78 ttttgctagaatatggtatctctt 101 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,553,221 Number of Sequences: 3902068 Number of extensions: 5553221 Number of successful extensions: 100867 Number of sequences better than 10.0: 42 Number of HSP's better than 10.0 without gapping: 42 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 100669 Number of HSP's gapped (non-prelim): 196 length of query: 687 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 664 effective length of database: 17,143,297,704 effective search space: 11383149675456 effective search space used: 11383149675456 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
