ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal5m02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC005218.1| Homo sapiens chromosome 5, P1 clone 737H5 (LBNL H36), complete sequence Length = 75184 Score = 42.1 bits (21), Expect = 0.54 Identities = 21/21 (100%) Strand = Plus / Minus Query: 37 aagtgtctcaatgacatgctg 57 ||||||||||||||||||||| Sbjct: 16218 aagtgtctcaatgacatgctg 16198
>gb|U41277.1| Caenorhabditis elegans cosmid C06E4, complete sequence Length = 31201 Score = 42.1 bits (21), Expect = 0.54 Identities = 24/25 (96%) Strand = Plus / Minus Query: 64 tttcctccatgaaacccttccttat 88 |||||||| |||||||||||||||| Sbjct: 17472 tttcctccttgaaacccttccttat 17448
>gb|AC008695.9|AC008695 Homo sapiens chromosome 5 clone CTB-6P6, complete sequence Length = 152764 Score = 42.1 bits (21), Expect = 0.54 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 aagtgtctcaatgacatgctg 57 ||||||||||||||||||||| Sbjct: 68664 aagtgtctcaatgacatgctg 68684
>gb|AC016906.7| Homo sapiens BAC clone RP11-436E24 from 2, complete sequence Length = 183045 Score = 42.1 bits (21), Expect = 0.54 Identities = 21/21 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccatga 75 ||||||||||||||||||||| Sbjct: 176671 ctgctttattttcctccatga 176691
>dbj|AP001791.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-427G12, complete sequence Length = 140000 Score = 42.1 bits (21), Expect = 0.54 Identities = 21/21 (100%) Strand = Plus / Plus Query: 65 ttcctccatgaaacccttcct 85 ||||||||||||||||||||| Sbjct: 92351 ttcctccatgaaacccttcct 92371
>ref|XM_415139.1| PREDICTED: Gallus gallus similar to 4930438O03Rik protein (LOC416846), mRNA Length = 1166 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 121 aagcaaataaaaaccattca 140 |||||||||||||||||||| Sbjct: 1116 aagcaaataaaaaccattca 1135
>gb|AC133902.12| Mus musculus chromosome 10, clone RP24-538B17, complete sequence Length = 199604 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 ccaaaagcaaataaaaacca 136 |||||||||||||||||||| Sbjct: 150698 ccaaaagcaaataaaaacca 150679
>gb|AC116503.17| Mus musculus chromosome 9, clone RP24-302M3, complete sequence Length = 199065 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 aaaagcaaataaaaaccatt 138 |||||||||||||||||||| Sbjct: 18863 aaaagcaaataaaaaccatt 18844
>gb|AC103982.10| Homo sapiens chromosome 15, clone RP11-343B18, complete sequence Length = 197370 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 ctgctttattttcctccatg 74 |||||||||||||||||||| Sbjct: 84126 ctgctttattttcctccatg 84107
>gb|AC122273.4| Mus musculus BAC clone RP23-228B2 from 9, complete sequence Length = 196627 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 119 aaaagcaaataaaaaccatt 138 |||||||||||||||||||| Sbjct: 5952 aaaagcaaataaaaaccatt 5971
>emb|CR692514.2|CNS0FXAM Tetraodon nigroviridis full-length cDNA Length = 665 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 ccaaaagcaaataaaaacca 136 |||||||||||||||||||| Sbjct: 631 ccaaaagcaaataaaaacca 650
>emb|AL354680.14| Human DNA sequence from clone RP11-536F8 on chromosome 6p23-24.3 Contains part of gene KIAA1733 and a CpG island, complete sequence Length = 194845 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 56 tgctttattttcctccatga 75 |||||||||||||||||||| Sbjct: 47147 tgctttattttcctccatga 47128
>emb|AL139405.11| Human DNA sequence from clone RP11-393E10 on chromosome 10 Contains the 5' end of a variant of the gene for a novel protein (FLJ10210) and the 3' end of the gene for a novel protein (MGC11034), complete sequence Length = 179829 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 ctgctttattttcctccatg 74 |||||||||||||||||||| Sbjct: 120394 ctgctttattttcctccatg 120375
>gb|AC107031.6| Homo sapiens 12 BAC RP11-607P23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 84540 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 ctgctttattttcctccatg 74 |||||||||||||||||||| Sbjct: 75439 ctgctttattttcctccatg 75420
>gb|AC084429.5| Mus Musculus Chromosome 2 Clone RP23-291P1, complete sequence Length = 181684 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 caaataaaaaccattcattc 143 |||||||||||||||||||| Sbjct: 156511 caaataaaaaccattcattc 156492
>gb|AC025561.6| Homo sapiens BAC clone RP11-673E21 from 4, complete sequence Length = 154280 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccatg 74 |||||||||||||||||||| Sbjct: 116052 ctgctttattttcctccatg 116071
>dbj|AK081316.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130004C03 product:unclassifiable, full insert sequence Length = 1788 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 aaaagcaaataaaaaccatt 138 |||||||||||||||||||| Sbjct: 1316 aaaagcaaataaaaaccatt 1297
>gb|AC079828.4|AC079828 Arabidopsis thaliana chromosome 1 BAC F23H24 genomic sequence, complete sequence Length = 45337 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 118 caaaagcaaataaaaaccat 137 |||||||||||||||||||| Sbjct: 16124 caaaagcaaataaaaaccat 16143
>gb|AC149053.3| Mus musculus BAC clone RP24-502E20 from chromosome 7, complete sequence Length = 221785 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 66 tcctccatgaaacccttcct 85 |||||||||||||||||||| Sbjct: 113702 tcctccatgaaacccttcct 113721
>gb|AF118762.2|MMIGRP1 Mus musculus islet-specific glucose-6-phosphatase catalytic subunit-related protein (IGRP) gene, promoter region and exon 1 Length = 1596 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 caaataaaaaccattcattc 143 |||||||||||||||||||| Sbjct: 904 caaataaaaaccattcattc 923
>gb|AC006368.2| Homo sapiens BAC clone RP11-252C12 from 2, complete sequence Length = 171089 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 46 aatgacatgctgctttattt 65 |||||||||||||||||||| Sbjct: 152965 aatgacatgctgctttattt 152984
>gb|AC067959.5| Homo sapiens BAC clone RP11-79J24 from 2, complete sequence Length = 59030 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 ctgctttattttcctccatg 74 |||||||||||||||||||| Sbjct: 28455 ctgctttattttcctccatg 28436
>emb|AL929170.16| Mouse DNA sequence from clone RP23-451M16 on chromosome 2, complete sequence Length = 164121 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 caaataaaaaccattcattc 143 |||||||||||||||||||| Sbjct: 15268 caaataaaaaccattcattc 15287
>emb|AL807741.8| Mouse DNA sequence from clone RP23-224B9 on chromosome 2, complete sequence Length = 165777 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 aaaagcaaataaaaaccatt 138 |||||||||||||||||||| Sbjct: 29299 aaaagcaaataaaaaccatt 29280
>gb|AC110560.11| Mus musculus chromosome 3, clone RP23-254K1, complete sequence Length = 156067 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 125 aaataaaaaccattcattc 143 ||||||||||||||||||| Sbjct: 31430 aaataaaaaccattcattc 31412
>gb|BC084760.1| Xenopus laevis similar to proliferation-associated 2G4, 38kD, mRNA (cDNA clone MGC:81621 IMAGE:6863929), complete cds Length = 1633 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 820 tcaatgacatgctgcttta 802
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 143 cactggtgcagacgatgaa 161 ||||||||||||||||||| Sbjct: 3120515 cactggtgcagacgatgaa 3120497
>ref|XM_591108.2| PREDICTED: Bos taurus similar to olfactory receptor Olr1643 (LOC513435), mRNA Length = 960 Score = 38.2 bits (19), Expect = 8.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 133 accattcattcactggtgcagac 155 |||||||| |||||||||||||| Sbjct: 457 accattcactcactggtgcagac 479
>gb|BC073401.1| Xenopus laevis MGC80858 protein, mRNA (cDNA clone MGC:80858 IMAGE:5514690), complete cds Length = 1319 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 612 tcaatgacatgctgcttta 594
>gb|AC089994.2| Felis catus clone RP86-181L4, complete sequence Length = 142512 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 132 aaccattcattcactggtg 150 ||||||||||||||||||| Sbjct: 107769 aaccattcattcactggtg 107751
>gb|DQ279927.1| Human herpesvirus 4 strain AG876, complete genome Length = 172764 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 64 tttcctccatgaaaccctt 82 ||||||||||||||||||| Sbjct: 69821 tttcctccatgaaaccctt 69839
>gb|AY519500.1| Gallus gallus CNR/Pcdh-alpha gene cluster, complete sequence Length = 187517 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 59 tttattttcctccatgaaa 77 ||||||||||||||||||| Sbjct: 3735 tttattttcctccatgaaa 3717
>gb|AC022062.10| Mus musculus chromosome 5, clone RP23-57P23, complete sequence Length = 235363 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 118 caaaagcaaataaaaacca 136 ||||||||||||||||||| Sbjct: 48113 caaaagcaaataaaaacca 48131
>gb|BC044287.1| Xenopus laevis similar to proliferation-associated 2G4, 38kD, mRNA (cDNA clone IMAGE:5542833), partial cds Length = 1316 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 602 tcaatgacatgctgcttta 584
>gb|BC059755.1| Xenopus tropicalis cDNA clone IMAGE:5381960, partial cds Length = 1164 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 632 tcaatgacatgctgcttta 614
>emb|CR382337.11| Zebrafish DNA sequence from clone DKEY-26N5 in linkage group 25, complete sequence Length = 217882 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 61 tattttcctccatgaaacc 79 ||||||||||||||||||| Sbjct: 115582 tattttcctccatgaaacc 115600
>gb|AC124694.3| Mus musculus BAC clone RP24-171H8 from chromosome 14, complete sequence Length = 154741 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 128 taaaaaccattcattcact 146 ||||||||||||||||||| Sbjct: 77631 taaaaaccattcattcact 77613
>gb|AC124480.5| Mus musculus BAC clone RP24-117B21 from chromosome 5, complete sequence Length = 189616 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 118 caaaagcaaataaaaacca 136 ||||||||||||||||||| Sbjct: 183615 caaaagcaaataaaaacca 183633
>ref|XM_763667.1| Giardia lamblia ATCC 50803 serine/threonine protein kinase (GLP_59_15138_16382) partial mRNA Length = 1245 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 43 ctcaatgacatgctgcttt 61 ||||||||||||||||||| Sbjct: 207 ctcaatgacatgctgcttt 189
>emb|AL713895.8| Human DNA sequence from clone RP11-10C13 on chromosome 10 Contains the 5' end of the TRIP8 gene for thyroid hormone receptor interactor 8 (KIAA1380, DKFZp761F0118) and the 3' end of a novel gene (FLJ14374), complete sequence Length = 54028 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 5077 ctgctttattttcctccat 5059
>emb|AL590398.9| Human DNA sequence from clone RP11-446G24 on chromosome 6 Contains the 5' end of the HDAC2 gene for histone deacetylase 2 (human transcriptional regulator homolog RPD3, YAF1), two putative novel genes, a pseudogene similar to mouse D7Rp2e (DNA segment, Chr7, Roswell Park 2 complex, expressed) and a CpG island, complete sequence Length = 78366 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 114 cagccaaaagcaaataaaa 132 ||||||||||||||||||| Sbjct: 26250 cagccaaaagcaaataaaa 26232
>emb|AL445685.18| Human DNA sequence from clone RP11-91A18 on chromosome 1 Contains the 5' end of the RAB3B gene for RAB3B member RAS oncogene family, a 40s ribosomal protein S26 (RPS26) pseudogene, the gene for endoplasmic reticulum thioredoxin superfamily member 18 kDa (TLP19), three novel genes, the 5' end of the gene for a novel protein similar to RNA polymerase B transcription factor 3 (MGC23908) and a CpG island, complete sequence Length = 142790 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 67 cctccatgaaacccttcct 85 ||||||||||||||||||| Sbjct: 137988 cctccatgaaacccttcct 138006
>emb|AL392103.6| Human DNA sequence from clone RP11-477L16 on chromosome 10 Contains a pseudogene similar to part of nuclease sensitive element binding protein 1 (NSEP1, part of the gene for SEC15 (S. cerevisiae)-like (SEC15L), and one CpG island, complete sequence Length = 125087 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 63 ttttcctccatgaaaccct 81 ||||||||||||||||||| Sbjct: 117042 ttttcctccatgaaaccct 117060
>emb|AL358934.19| Human DNA sequence from clone RP11-459D20 on chromosome 9 Contains a transcription factor IIA small 12 kDa subunit (GTF2A2) pseudogene, complete sequence Length = 95922 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 94886 ctgctttattttcctccat 94904
>gb|AC119567.11| Homo sapiens X BAC RP11-416J16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 79556 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 49070 ctgctttattttcctccat 49088
>emb|AL118522.32|HSDJ781B1 Human DNA sequence from clone RP4-781B1 on chromosome 20 Contains the 5' end of a novel gene, the KCNK15 gene for potassium channel subfamily K member 15, a novel gene, the RIMS4 gene for regulating synaptic membrane exocytosis 4 and three CpG islands, complete sequence Length = 107109 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 45 caatgacatgctgctttat 63 ||||||||||||||||||| Sbjct: 89560 caatgacatgctgctttat 89542
>emb|AL034423.21|HS1185N5 Human DNA sequence from clone RP5-1185N5 on chromosome 20q13.11-13.2 Contains the UBE2V1 gene for ubiquitin-conjugating enzyme E2 variant 1 and two CpG islands, complete sequence Length = 113589 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 85316 ctgctttattttcctccat 85334
>gb|AC158571.3| Mus musculus chromosome 3, clone RP23-117E23, complete sequence Length = 197545 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 125 aaataaaaaccattcattc 143 ||||||||||||||||||| Sbjct: 185664 aaataaaaaccattcattc 185646
>emb|AL672018.6| Mouse DNA sequence from clone RP23-365O24 on chromosome 11 Contains part of a novel gene, the Bcl11a gene for B-cell CLL/lymphoma 11A (zinc finger protein), a novel gene and a CpG island, complete sequence Length = 84877 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 acatgctgctttattttcc 68 ||||||||||||||||||| Sbjct: 29090 acatgctgctttattttcc 29108
>emb|CR382340.7| Zebrafish DNA sequence from clone DKEY-151G10 in linkage group 23, complete sequence Length = 158509 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 33650 tcaatgacatgctgcttta 33668
>gb|AC011461.5| Homo sapiens chromosome 19 clone CTC-429L19, complete sequence Length = 100680 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 69 tccatgaaacccttcctta 87 ||||||||||||||||||| Sbjct: 45108 tccatgaaacccttcctta 45090
>gb|AC146694.12| Pan troglodytes clone rp43-178l17, complete sequence Length = 229508 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 126 aataaaaaccattcattca 144 ||||||||||||||||||| Sbjct: 46613 aataaaaaccattcattca 46631
>dbj|AK055182.1| Homo sapiens cDNA FLJ30620 fis, clone CTONG2001598 Length = 2771 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 272 ctgctttattttcctccat 290
>gb|AC020642.7| Homo sapiens chromosome 10 clone RP11-275D14, complete sequence Length = 145697 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 117 ccaaaagcaaataaaaacc 135 ||||||||||||||||||| Sbjct: 58346 ccaaaagcaaataaaaacc 58364
>gb|AF243864.1| Hemiramphus brasiliensis isolate N5a cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 541 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 60 ttattttcctccatgaaac 78 ||||||||||||||||||| Sbjct: 467 ttattttcctccatgaaac 485
>gb|AC107878.2| Homo sapiens chromosome 18, clone RP11-138C8, complete sequence Length = 182375 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 118 caaaagcaaataaaaacca 136 ||||||||||||||||||| Sbjct: 106367 caaaagcaaataaaaacca 106349
>gb|AC073607.19| Homo sapiens 12 BAC RP11-462G20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 165085 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 61 tattttcctccatgaaacc 79 ||||||||||||||||||| Sbjct: 58214 tattttcctccatgaaacc 58196
>ref|XM_680694.1| PREDICTED: Danio rerio similar to Proliferation-associated 2G4-like, transcript variant 1 (LOC558579), mRNA Length = 2016 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 711 tcaatgacatgctgcttta 693
>ref|XM_703017.1| PREDICTED: Danio rerio similar to Proliferation-associated 2G4-like, transcript variant 3 (LOC558579), mRNA Length = 1941 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 723 tcaatgacatgctgcttta 705
>ref|XM_703016.1| PREDICTED: Danio rerio similar to Proliferation-associated 2G4-like, transcript variant 2 (LOC558579), mRNA Length = 1959 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 654 tcaatgacatgctgcttta 636
>gb|AC092799.2| Homo sapiens chromosome 1 clone RP11-5F19, complete sequence Length = 162115 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 57661 ctgctttattttcctccat 57643
>emb|BX248108.11| Zebrafish DNA sequence from clone CH211-221P4, complete sequence Length = 230610 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 115 agccaaaagcaaataaaaa 133 ||||||||||||||||||| Sbjct: 133563 agccaaaagcaaataaaaa 133545
>gb|AC003029.5| Homo sapiens 12 PAC RP3-462E2 (Roswell Park Cancer institute Human PAC Library) complete sequence Length = 137830 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 125 aaataaaaaccattcattc 143 ||||||||||||||||||| Sbjct: 112468 aaataaaaaccattcattc 112486
>ref|NM_001008439.1| Xenopus tropicalis MGC79578 protein (MGC79578), mRNA Length = 1410 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 658 tcaatgacatgctgcttta 640
>gb|AC009118.11| Homo sapiens chromosome 16 clone RP11-481J2, complete sequence Length = 187988 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 123314 ctgctttattttcctccat 123332
>gb|AC115994.24| Homo sapiens chromosome 17, clone CTD-2535L24, complete sequence Length = 242913 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 131 aaaccattcattcactggt 149 ||||||||||||||||||| Sbjct: 96254 aaaccattcattcactggt 96236
>gb|AC160012.1| Medicago truncatula chromosome 2 BAC clone mth2-168l8, complete sequence Length = 145061 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 126 aataaaaaccattcattca 144 ||||||||||||||||||| Sbjct: 22288 aataaaaaccattcattca 22270
>gb|AC015912.16| Homo sapiens chromosome 17, clone RP11-670E13, complete sequence Length = 118172 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 129 aaaaaccattcattcactg 147 ||||||||||||||||||| Sbjct: 41205 aaaaaccattcattcactg 41187
>ref|NM_212641.2| Danio rerio proliferation-associated 2G4 ,b (pa2g4b), mRNA Length = 1986 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 658 tcaatgacatgctgcttta 640
>gb|AC012442.7| Homo sapiens BAC clone RP11-1I24 from 2, complete sequence Length = 173040 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 126 aataaaaaccattcattca 144 ||||||||||||||||||| Sbjct: 49803 aataaaaaccattcattca 49785
>gb|AC150431.2| Branchiostoma floridae clone CH302-9B19, complete sequence Length = 172975 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 122 agcaaataaaaaccattca 140 ||||||||||||||||||| Sbjct: 65061 agcaaataaaaaccattca 65043
>gb|AC009363.4|AC009363 Homo sapiens chromosome 14 clone CTD-2317F5 map 14q24.3, complete sequence Length = 82707 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 77503 ctgctttattttcctccat 77521
>gb|AC007182.3|AC007182 Homo sapiens chromosome 14 clone BAC 507E23 map 14q24.3, complete sequence Length = 192389 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 33443 ctgctttattttcctccat 33461
>gb|BC080337.1| Xenopus tropicalis MGC79578 protein, mRNA (cDNA clone MGC:79578 IMAGE:6978845), complete cds Length = 1410 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 658 tcaatgacatgctgcttta 640
>gb|BC071536.1| Danio rerio proliferation-associated 2G4 ,b, mRNA (cDNA clone MGC:86921 IMAGE:6905960), complete cds Length = 1986 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 658 tcaatgacatgctgcttta 640
>emb|V01555.2|EBV Epstein-Barr virus (EBV) genome, strain B95-8 Length = 172281 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 64 tttcctccatgaaaccctt 82 ||||||||||||||||||| Sbjct: 81975 tttcctccatgaaaccctt 81993
>emb|AL157996.8|CNS01RGH Human chromosome 14 DNA sequence BAC C-2525P14 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 209242 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 22824 ctgctttattttcctccat 22806
>emb|AL133445.4|CNS01DV1 Human chromosome 14 DNA sequence BAC R-1046B16 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 190946 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 11537 ctgctttattttcctccat 11555
>emb|CR761691.2| Xenopus tropicalis finished cDNA, clone TGas010d19 Length = 1147 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 615 tcaatgacatgctgcttta 597
>gb|AY961628.3| Human herpesvirus 4 strain GD1, complete genome Length = 171657 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 64 tttcctccatgaaaccctt 82 ||||||||||||||||||| Sbjct: 69704 tttcctccatgaaaccctt 69722
>emb|AL929241.13| Mouse DNA sequence from clone RP23-4L24 on chromosome 2, complete sequence Length = 168308 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 137 ttcattcactggtgcagac 155 ||||||||||||||||||| Sbjct: 111590 ttcattcactggtgcagac 111608
>gb|AF016898.1|AF016898 Homo sapiens B-ATF gene, complete cds Length = 17004 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 ctgctttattttcctccat 73 ||||||||||||||||||| Sbjct: 1488 ctgctttattttcctccat 1506
>emb|AJ507799.2|HHV507799 Human herpesvirus 4 complete wild type genome Length = 171823 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 64 tttcctccatgaaaccctt 82 ||||||||||||||||||| Sbjct: 69687 tttcctccatgaaaccctt 69705
>emb|BX005130.10| Mouse DNA sequence from clone RP23-475L14 on chromosome 2, complete sequence Length = 127298 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 134 ccattcattcactggtgca 152 ||||||||||||||||||| Sbjct: 46939 ccattcattcactggtgca 46957
>gb|BC056591.1| Danio rerio proliferation-associated 2G4 ,b, mRNA (cDNA clone MGC:65848 IMAGE:6797340), complete cds Length = 1613 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 tcaatgacatgctgcttta 62 ||||||||||||||||||| Sbjct: 630 tcaatgacatgctgcttta 612
>gb|AC087782.34| Mus musculus strain C57BL/6J chromosome 16 clone rp23-81d13, complete sequence Length = 177250 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 acatgctgctttattttcc 68 ||||||||||||||||||| Sbjct: 44543 acatgctgctttattttcc 44525
>gb|M80517.1|HS4B958RAJ Epstein-Barr virus, artifactual joining of B95-8 complete genome and the sequences from Raji of the large deletion found in B95-8 Length = 184113 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 64 tttcctccatgaaaccctt 82 ||||||||||||||||||| Sbjct: 81975 tttcctccatgaaaccctt 81993
>gb|AC101903.7| Mus musculus chromosome 1, clone RP24-227M18, complete sequence Length = 172143 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 58 ctttattttcctccatgaa 76 ||||||||||||||||||| Sbjct: 57526 ctttattttcctccatgaa 57508
>gb|M17322.1|HS4BMM Epstein-Barr virus BamHI-M fragment encoding a DNA-binding protein and a nuclear protein, 3' end and complete cds Length = 1934 Score = 38.2 bits (19), Expect = 8.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 64 tttcctccatgaaaccctt 82 ||||||||||||||||||| Sbjct: 1711 tttcctccatgaaaccctt 1729 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,888,266 Number of Sequences: 3902068 Number of extensions: 1888266 Number of successful extensions: 149056 Number of sequences better than 10.0: 89 Number of HSP's better than 10.0 without gapping: 89 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 148855 Number of HSP's gapped (non-prelim): 201 length of query: 174 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 152 effective length of database: 17,147,199,772 effective search space: 2606374365344 effective search space used: 2606374365344 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
