ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal5k16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX927113.12| Zebrafish DNA sequence from clone DKEY-5N1 in l... 42 0.45
2emb|BX942814.11| Zebrafish DNA sequence from clone DKEY-45F10 in... 42 0.45
3gb|AC119877.9| Mus musculus chromosome 3, clone RP24-324H23, com... 40 1.8
4gb|AC186367.2| Gallus gallus BAC clone TAM31-55N19 from chromoso... 40 1.8
5gb|AC111140.11| Mus musculus chromosome 3, clone RP23-369L16, co... 40 1.8
6emb|AL390205.17| Human DNA sequence from clone RP11-15H7 on chro... 40 1.8
7gb|AF331848.1| Mus musculus trophinin gene, complete cds 40 1.8
8emb|AL672150.19| Mouse DNA sequence from clone RP23-338A17 on ch... 40 1.8
9gb|AC127545.4| Mus musculus BAC clone RP24-562H22 from chromosom... 38 7.0
10gb|AC102604.13| Mus musculus chromosome 19, clone RP23-385L22, c... 38 7.0
11emb|AL390715.23| Human DNA sequence from clone RP11-167O6 on chr... 38 7.0
12emb|AL355482.13| Human DNA sequence from clone RP11-538D16 on ch... 38 7.0
13gb|AE016828.2| Coxiella burnetii RSA 493, complete genome 38 7.0
14gb|AC104759.10| Homo sapiens chromosome 15, clone RP11-126F18, c... 38 7.0
15gb|AC153940.3| Mus musculus 10 BAC RP24-422N15 (Roswell Park Can... 38 7.0
16gb|AC155710.5| Mus musculus 10 BAC RP24-141K13 (Roswell Park Can... 38 7.0
17gb|AF282508.2|AF282508 Homo sapiens clone 2ptel_c12t3 sequence 38 7.0
18gb|AC079779.7| Homo sapiens BAC clone RP11-356M6 from 2, complet... 38 7.0
19gb|AC011742.3| Homo sapiens BAC clone RP11-214J9 from 2, complet... 38 7.0
20gb|AE016753.1| Mus musculus chromosome 10 high-growth region, se... 38 7.0
21gb|U25847.1|HSACP1S1 Human red cell-type low molecular weight ac... 38 7.0

>emb|BX927113.12| Zebrafish DNA sequence from clone DKEY-5N1 in linkage group 18, complete
              sequence
          Length = 159070

 Score = 42.1 bits (21), Expect = 0.45
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 106    gcttggagctcttgaccctct 126
              |||||||||||||||||||||
Sbjct: 107885 gcttggagctcttgaccctct 107905



to top

>emb|BX942814.11| Zebrafish DNA sequence from clone DKEY-45F10 in linkage group 18,
             complete sequence
          Length = 106289

 Score = 42.1 bits (21), Expect = 0.45
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 106   gcttggagctcttgaccctct 126
             |||||||||||||||||||||
Sbjct: 78637 gcttggagctcttgaccctct 78617



to top

>gb|AC119877.9| Mus musculus chromosome 3, clone RP24-324H23, complete sequence
          Length = 155784

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     agaggaagggaaaggcagga 22
             ||||||||||||||||||||
Sbjct: 25419 agaggaagggaaaggcagga 25400



to top

>gb|AC186367.2| Gallus gallus BAC clone TAM31-55N19 from chromosome 17, complete sequence
          Length = 181509

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      agaggaagggaaaggcagga 22
              ||||||||||||||||||||
Sbjct: 117668 agaggaagggaaaggcagga 117687



to top

>gb|AC111140.11| Mus musculus chromosome 3, clone RP23-369L16, complete sequence
          Length = 236182

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     agaggaagggaaaggcagga 22
             ||||||||||||||||||||
Sbjct: 18388 agaggaagggaaaggcagga 18407



to top

>emb|AL390205.17| Human DNA sequence from clone RP11-15H7 on chromosome 6 Contains an ATP
             synthase H+ transporting mitochondrial F0 complex subunit
             b variant 1 (ATP5F1) pseudogene and a thyroid hormone
             receptor interactor 4 (TRIP4) pseudogene, complete
             sequence
          Length = 155680

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     agaggaagggaaaggcagga 22
             ||||||||||||||||||||
Sbjct: 42852 agaggaagggaaaggcagga 42833



to top

>gb|AF331848.1| Mus musculus trophinin gene, complete cds
          Length = 16270

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   tcttgaccctcttcttaggc 134
             ||||||||||||||||||||
Sbjct: 15653 tcttgaccctcttcttaggc 15672



to top

>emb|AL672150.19| Mouse DNA sequence from clone RP23-338A17 on chromosome X, complete
             sequence
          Length = 196140

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 115   tcttgaccctcttcttaggc 134
             ||||||||||||||||||||
Sbjct: 94001 tcttgaccctcttcttaggc 93982



to top

>gb|AC127545.4| Mus musculus BAC clone RP24-562H22 from chromosome 19, complete sequence
          Length = 146015

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      acagaggaagggaaaggca 19
              |||||||||||||||||||
Sbjct: 145226 acagaggaagggaaaggca 145208



to top

>gb|AC102604.13| Mus musculus chromosome 19, clone RP23-385L22, complete sequence
          Length = 212387

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 1      acagaggaagggaaaggca 19
              |||||||||||||||||||
Sbjct: 163959 acagaggaagggaaaggca 163977



to top

>emb|AL390715.23| Human DNA sequence from clone RP11-167O6 on chromosome 10 Contains the
             ARHGAP12 gene for Rho GTPase activating protein 12 and two
             CpG islands, complete sequence
          Length = 189161

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 3     agaggaagggaaaggcagg 21
             |||||||||||||||||||
Sbjct: 35056 agaggaagggaaaggcagg 35038



to top

>emb|AL355482.13| Human DNA sequence from clone RP11-538D16 on chromosome 1q25.1-31.3
             Contains the gene for a protein similar to zinc finger
             protein 135 (clone pHZ-17) zinc finger protein 61
             (LOC127665) and two novel genes (LOC149157), complete
             sequence
          Length = 74515

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     agaggaagggaaaggcagg 21
             |||||||||||||||||||
Sbjct: 18696 agaggaagggaaaggcagg 18714



to top

>gb|AE016828.2| Coxiella burnetii RSA 493, complete genome
          Length = 1995281

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 116    cttgaccctcttcttaggc 134
              |||||||||||||||||||
Sbjct: 933723 cttgaccctcttcttaggc 933741



to top

>gb|AC104759.10| Homo sapiens chromosome 15, clone RP11-126F18, complete sequence
          Length = 173986

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 105    ggcttggagctcttgaccc 123
              |||||||||||||||||||
Sbjct: 154434 ggcttggagctcttgaccc 154416



to top

>gb|AC153940.3| Mus musculus 10 BAC RP24-422N15 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 142278

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     agaggaagggaaaggcagg 21
             |||||||||||||||||||
Sbjct: 77726 agaggaagggaaaggcagg 77744



to top

>gb|AC155710.5| Mus musculus 10 BAC RP24-141K13 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 183533

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 3      agaggaagggaaaggcagg 21
              |||||||||||||||||||
Sbjct: 178597 agaggaagggaaaggcagg 178615



to top

>gb|AF282508.2|AF282508 Homo sapiens clone 2ptel_c12t3 sequence
          Length = 766

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 1   acagaggaagggaaaggca 19
           |||||||||||||||||||
Sbjct: 685 acagaggaagggaaaggca 667



to top

>gb|AC079779.7| Homo sapiens BAC clone RP11-356M6 from 2, complete sequence
          Length = 155399

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     acagaggaagggaaaggca 19
             |||||||||||||||||||
Sbjct: 81613 acagaggaagggaaaggca 81595



to top

>gb|AC011742.3| Homo sapiens BAC clone RP11-214J9 from 2, complete sequence
          Length = 181210

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 1      acagaggaagggaaaggca 19
              |||||||||||||||||||
Sbjct: 167356 acagaggaagggaaaggca 167374



to top

>gb|AE016753.1| Mus musculus chromosome 10 high-growth region, section 1 of 2 of the
              complete sequence
          Length = 350029

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 3      agaggaagggaaaggcagg 21
              |||||||||||||||||||
Sbjct: 342621 agaggaagggaaaggcagg 342603



to top

>gb|U25847.1|HSACP1S1 Human red cell-type low molecular weight acid phosphatase (ACP1)
            gene, 5' flanking region and exons 1-4
          Length = 10191

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 1    acagaggaagggaaaggca 19
            |||||||||||||||||||
Sbjct: 7904 acagaggaagggaaaggca 7886


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 814,768
Number of Sequences: 3902068
Number of extensions: 814768
Number of successful extensions: 63610
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63565
Number of HSP's gapped (non-prelim): 45
length of query: 147
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 126
effective length of database: 17,151,101,840
effective search space: 2161038831840
effective search space used: 2161038831840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top