>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 33/33 (100%)
 Strand = Plus / Plus

                                                
Query: 267     ttacatgctcggcttcgcgctgagacggctcgc 299
               |||||||||||||||||||||||||||||||||
Sbjct: 1767619 ttacatgctcggcttcgcgctgagacggctcgc 1767651

>gb|AY339372.1| Oryza sativa (japonica cultivar-group) catalase mRNA, complete cds
          Length = 1861

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 267  ttacatgctcggcttcgcgctgagacggctcgc 299
            |||||||||||||||||||||||||||||||||
Sbjct: 1562 ttacatgctcggcttcgcgctgagacggctcgc 1530

>gb|DQ118681.1| Oryza sativa (indica cultivar-group) catalase-C mRNA, complete cds
          Length = 1503

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 267  ttacatgctcggcttcgcgctgagacggctcgc 299
            |||||||||||||||||||||||||||||||||
Sbjct: 1503 ttacatgctcggcttcgcgctgagacggctcgc 1471

>gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1004C08,
             complete sequence
          Length = 133090

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                              
Query: 267   ttacatgctcggcttcgcgctgagacggctcgc 299
             |||||||||||||||||||||||||||||||||
Sbjct: 66743 ttacatgctcggcttcgcgctgagacggctcgc 66711

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 33/33 (100%)
 Strand = Plus / Plus

                                                
Query: 267     ttacatgctcggcttcgcgctgagacggctcgc 299
               |||||||||||||||||||||||||||||||||
Sbjct: 1767617 ttacatgctcggcttcgcgctgagacggctcgc 1767649

>dbj|AK066378.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013060B21, full
            insert sequence
          Length = 1945

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 267  ttacatgctcggcttcgcgctgagacggctcgc 299
            |||||||||||||||||||||||||||||||||
Sbjct: 1688 ttacatgctcggcttcgcgctgagacggctcgc 1656

>dbj|AK062174.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-C11, full
            insert sequence
          Length = 1763

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 267  ttacatgctcggcttcgcgctgagacggctcgc 299
            |||||||||||||||||||||||||||||||||
Sbjct: 1540 ttacatgctcggcttcgcgctgagacggctcgc 1508

>dbj|AB020502.1| Oryza sativa mRNA for catalase, complete cds
          Length = 1778

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 267  ttacatgctcggcttcgcgctgagacggctcgc 299
            |||||||||||||||||||||||||||||||||
Sbjct: 1513 ttacatgctcggcttcgcgctgagacggctcgc 1481

>dbj|D86611.1| Oryza sativa (japonica cultivar-group) CatC gene for catalase,
            complete cds
          Length = 4167

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 267  ttacatgctcggcttcgcgctgagacggctcgc 299
            |||||||||||||||||||||||||||||||||
Sbjct: 3876 ttacatgctcggcttcgcgctgagacggctcgc 3844

>emb|AJ634002.1| Schedonorus arundinaceus mRNA for catalase (cat1 gene)
          Length = 1735

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 20   ggctcttgtacacattattacatgaatgacagacg 54
            |||||||||||| ||||||||||||||||||||||
Sbjct: 1691 ggctcttgtacaaattattacatgaatgacagacg 1657



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 267  ttacatgctcggcttcgcgctgagacggc 295
            |||||||||||||||| ||||||| ||||
Sbjct: 1482 ttacatgctcggcttcacgctgaggcggc 1454

>ref|XM_470174.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1626

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                          
Query: 270  catgctcggcttcgcgctgagacggctcgc 299
            ||||||||||||||||||||||||||||||
Sbjct: 1476 catgctcggcttcgcgctgagacggctcgc 1447

>emb|X54819.1|ZMCAT2R Maize mRNA for catalase 2
          Length = 1778

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 267  ttacatgctcggcttcgcgctgagacggctcgcaagcttct 307
            ||||||||||||||| |||||||| |||||||| |||||||
Sbjct: 1515 ttacatgctcggcttggcgctgaggcggctcgcgagcttct 1475

>emb|Z54358.1|ZMCAT2GN Z.mays cat2 gene
          Length = 3662

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 267  ttacatgctcggcttcgcgctgagacggctcgcaagcttct 307
            ||||||||||||||| |||||||| |||||||| |||||||
Sbjct: 3662 ttacatgctcggcttggcgctgaggcggctcgcgagcttct 3622

>gb|AY110648.1| Zea mays CL1739_1 mRNA sequence
          Length = 1813

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 267  ttacatgctcggcttcgcgctgagacggctcgcaagcttct 307
            ||||||||||||||| |||||||| |||||||| |||||||
Sbjct: 1529 ttacatgctcggcttggcgctgaggcggctcgcgagcttct 1489

>gb|AY107763.1| Zea mays PCO104975 mRNA sequence
          Length = 1200

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 267 ttacatgctcggcttcgcgctgagacggctcgcaagcttct 307
           ||||||||||||||| |||||||| |||||||| |||||||
Sbjct: 731 ttacatgctcggcttggcgctgaggcggctcgcgagcttct 691

>gb|J02976.1|MZECAT2 Maize catalase (Cat2) mRNA, 3' end
          Length = 1793

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 267  ttacatgctcggcttcgcgctgagacggctcgcaagcttct 307
            ||||||||||||||| |||||||| |||||||| |||||||
Sbjct: 1527 ttacatgctcggcttggcgctgaggcggctcgcgagcttct 1487

>dbj|D86327.1| Triticum aestivum mRNA for catalase, complete cds
          Length = 1573

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 267  ttacatgctcggcttcgcgctgagacggctcgcaagcttct 307
            ||||||||||||||| | ||||||||||||||| |||||||
Sbjct: 1501 ttacatgctcggcttggagctgagacggctcgcgagcttct 1461



 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 160  tttgccgataagagggaaga 179
            ||||||||||||||||||||
Sbjct: 1573 tttgccgataagagggaaga 1554


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,801,378
Number of Sequences: 3902068
Number of extensions: 1801378
Number of successful extensions: 29118
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29078
Number of HSP's gapped (non-prelim): 40
length of query: 307
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 285
effective length of database: 17,147,199,772
effective search space: 4886951935020
effective search space used: 4886951935020
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)