ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal5b20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY846824.1| Triticum aestivum ribosomal protein L18 mRNA, com... 835 0.0
2gb|BT017364.1| Zea mays clone EL01N0324F01.c mRNA sequence 478 e-132
3gb|AY104839.1| Zea mays PCO137857 mRNA sequence 478 e-132
4gb|DQ363992.1| Saccharum hybrid cultivar putative 60S ribosomal ... 424 e-115
5dbj|AK061929.1| Oryza sativa (japonica cultivar-group) cDNA clon... 392 e-106
6dbj|AK120877.1| Oryza sativa (japonica cultivar-group) cDNA clon... 392 e-106
7ref|NM_185271.1| Oryza sativa (japonica cultivar-group), predic... 389 e-105
8dbj|AK102810.1| Oryza sativa (japonica cultivar-group) cDNA clon... 377 e-101
9gb|DQ428164.1| Sorghum propinquum locus PRC0147 genomic sequence 246 6e-62
10gb|DQ428163.1| Sorghum bicolor voucher PI585454 locus PRC0147 ge... 230 3e-57
11gb|DQ428162.1| Sorghum bicolor voucher PI267539 locus PRC0147 ge... 230 3e-57
12gb|DQ428161.1| Sorghum bicolor voucher PI267408 locus PRC0147 ge... 230 3e-57
13gb|DQ428160.1| Sorghum bicolor voucher PI221607 locus PRC0147 ge... 230 3e-57
14gb|DQ428159.1| Sorghum bicolor voucher PI152702 locus PRC0147 ge... 230 3e-57
15gb|DQ428158.1| Sorghum bicolor voucher NSL92371 locus PRC0147 ge... 230 3e-57
16gb|DQ428157.1| Sorghum bicolor voucher NSL87902 locus PRC0147 ge... 230 3e-57
17gb|DQ428156.1| Sorghum bicolor voucher NSL87666 locus PRC0147 ge... 230 3e-57
18gb|DQ428155.1| Sorghum bicolor voucher NSL77217 locus PRC0147 ge... 230 3e-57
19gb|DQ428154.1| Sorghum bicolor voucher NSL77034 locus PRC0147 ge... 230 3e-57
20gb|DQ428153.1| Sorghum bicolor voucher NSL56174 locus PRC0147 ge... 230 3e-57
21gb|DQ428152.1| Sorghum bicolor voucher NSL56003 locus PRC0147 ge... 230 3e-57
22gb|DQ428151.1| Sorghum bicolor voucher NSL55243 locus PRC0147 ge... 230 3e-57
23gb|DQ428150.1| Sorghum bicolor voucher NSL51365 locus PRC0147 ge... 230 3e-57
24gb|DQ428149.1| Sorghum bicolor voucher NSL51030 locus PRC0147 ge... 230 3e-57
25gb|DQ428148.1| Sorghum bicolor voucher NSL50875 locus PRC0147 ge... 230 3e-57
26gb|DQ428147.1| Sorghum bicolor voucher BTx623 locus PRC0147 geno... 230 3e-57
27gb|AC087551.3| Oryza sativa (japonica cultivar-group) chromosome... 206 5e-50
28dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 206 5e-50
29gb|AY106208.1| Zea mays PCO085865 mRNA sequence 159 1e-35
30gb|BT019314.1| Zea mays clone Contig987.F mRNA sequence 151 3e-33
31dbj|AK121580.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 5e-19
32ref|XM_479492.1| Oryza sativa (japonica cultivar-group), mRNA 101 2e-18
33dbj|AK066329.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-18
34gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 96 1e-16
35dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
36gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome... 96 1e-16
37emb|CR734840.2|CNS0GTS7 Tetraodon nigroviridis full-length cDNA 88 3e-14
38emb|CR734324.2|CNS0GTDV Tetraodon nigroviridis full-length cDNA 88 3e-14
39emb|CR712214.2|CNS0GCHU Tetraodon nigroviridis full-length cDNA 88 3e-14
40emb|CR727240.2|CNS0GO32 Tetraodon nigroviridis full-length cDNA 88 3e-14
41emb|CR722346.2|CNS0GKB4 Tetraodon nigroviridis full-length cDNA 88 3e-14
42emb|CR722203.2|CNS0GK75 Tetraodon nigroviridis full-length cDNA 88 3e-14
43emb|CR720412.2|CNS0GITE Tetraodon nigroviridis full-length cDNA 88 3e-14
44emb|CR718786.2|CNS0GHK8 Tetraodon nigroviridis full-length cDNA 88 3e-14
45emb|CR718640.2|CNS0GHG6 Tetraodon nigroviridis full-length cDNA 88 3e-14
46emb|CR718477.2|CNS0GHBN Tetraodon nigroviridis full-length cDNA 88 3e-14
47emb|CR718216.2|CNS0GH4E Tetraodon nigroviridis full-length cDNA 88 3e-14
48emb|CR716822.2|CNS0GG1R Tetraodon nigroviridis full-length cDNA 88 3e-14
49emb|CR716557.2|CNS0GFUE Tetraodon nigroviridis full-length cDNA 88 3e-14
50emb|CR716126.2|CNS0GFII Tetraodon nigroviridis full-length cDNA 88 3e-14
51emb|CR715708.2|CNS0GF6W Tetraodon nigroviridis full-length cDNA 88 3e-14
52emb|CR713867.2|CNS0GDRR Tetraodon nigroviridis full-length cDNA 88 3e-14
53emb|CR713475.2|CNS0GDGV Tetraodon nigroviridis full-length cDNA 88 3e-14
54emb|CR713262.2|CNS0GDAY Tetraodon nigroviridis full-length cDNA 88 3e-14
55emb|CR710888.2|CNS0GBH0 Tetraodon nigroviridis full-length cDNA 88 3e-14
56emb|CR710045.2|CNS0GATL Tetraodon nigroviridis full-length cDNA 88 3e-14
57emb|CR709916.2|CNS0GAQ0 Tetraodon nigroviridis full-length cDNA 88 3e-14
58emb|CR707932.2|CNS0G96W Tetraodon nigroviridis full-length cDNA 88 3e-14
59emb|CR707373.2|CNS0G8RD Tetraodon nigroviridis full-length cDNA 88 3e-14
60emb|CR707090.2|CNS0G8JI Tetraodon nigroviridis full-length cDNA 88 3e-14
61emb|CR706834.2|CNS0G8CE Tetraodon nigroviridis full-length cDNA 88 3e-14
62emb|CR706311.2|CNS0G7XV Tetraodon nigroviridis full-length cDNA 88 3e-14
63emb|CR705355.2|CNS0G77B Tetraodon nigroviridis full-length cDNA 88 3e-14
64emb|CR705285.2|CNS0G75D Tetraodon nigroviridis full-length cDNA 88 3e-14
65emb|CR705192.2|CNS0G72S Tetraodon nigroviridis full-length cDNA 88 3e-14
66emb|CR704641.2|CNS0G6NH Tetraodon nigroviridis full-length cDNA 88 3e-14
67emb|CR701253.2|CNS0G41D Tetraodon nigroviridis full-length cDNA 88 3e-14
68emb|CR700146.2|CNS0G36M Tetraodon nigroviridis full-length cDNA 88 3e-14
69emb|CR696223.2|CNS0G05N Tetraodon nigroviridis full-length cDNA 88 3e-14
70emb|CR695482.2|CNS0FZL2 Tetraodon nigroviridis full-length cDNA 88 3e-14
71emb|CR694940.2|CNS0FZ60 Tetraodon nigroviridis full-length cDNA 88 3e-14
72emb|CR694036.2|CNS0FYGW Tetraodon nigroviridis full-length cDNA 88 3e-14
73emb|CR692628.2|CNS0FXDS Tetraodon nigroviridis full-length cDNA 88 3e-14
74emb|CR690516.2|CNS0FVR4 Tetraodon nigroviridis full-length cDNA 88 3e-14
75emb|CR688214.2|CNS0FTZ6 Tetraodon nigroviridis full-length cDNA 88 3e-14
76emb|CR687256.2|CNS0FT8K Tetraodon nigroviridis full-length cDNA 88 3e-14
77emb|CR686542.2|CNS0FSOQ Tetraodon nigroviridis full-length cDNA 88 3e-14
78emb|CR679416.2|CNS0FN6S Tetraodon nigroviridis full-length cDNA 88 3e-14
79emb|CR677668.2|CNS0FLUL Tetraodon nigroviridis full-length cDNA 88 3e-14
80emb|CR676604.2|CNS0FL14 Tetraodon nigroviridis full-length cDNA 88 3e-14
81emb|CR674481.2|CNS0FJEF Tetraodon nigroviridis full-length cDNA 88 3e-14
82emb|CR672842.2|CNS0FI4W Tetraodon nigroviridis full-length cDNA 88 3e-14
83emb|CR672907.2|CNS0FI6P Tetraodon nigroviridis full-length cDNA 88 3e-14
84emb|CR668215.2|CNS0FEKD Tetraodon nigroviridis full-length cDNA 88 3e-14
85emb|CR667583.2|CNS0FE2T Tetraodon nigroviridis full-length cDNA 88 3e-14
86emb|CR666251.2|CNS0FD1T Tetraodon nigroviridis full-length cDNA 88 3e-14
87emb|CR665491.2|CNS0FCGP Tetraodon nigroviridis full-length cDNA 88 3e-14
88emb|CR663494.2|CNS0FAX8 Tetraodon nigroviridis full-length cDNA 88 3e-14
89emb|CR662279.2|CNS0F9ZH Tetraodon nigroviridis full-length cDNA 88 3e-14
90emb|CR661654.2|CNS0F9I4 Tetraodon nigroviridis full-length cDNA 88 3e-14
91emb|CR660863.2|CNS0F8W5 Tetraodon nigroviridis full-length cDNA 88 3e-14
92emb|CR660093.2|CNS0F8AR Tetraodon nigroviridis full-length cDNA 88 3e-14
93emb|CR650864.2|CNS0F16E Tetraodon nigroviridis full-length cDNA 88 3e-14
94emb|CR650032.2|CNS0F0JA Tetraodon nigroviridis full-length cDNA 88 3e-14
95emb|CR650013.2|CNS0F0IR Tetraodon nigroviridis full-length cDNA 88 3e-14
96emb|CR647600.2|CNS0EYNQ Tetraodon nigroviridis full-length cDNA 88 3e-14
97emb|CR646130.2|CNS0EXIW Tetraodon nigroviridis full-length cDNA 88 3e-14
98emb|CR642444.2|CNS0EUOI Tetraodon nigroviridis full-length cDNA 88 3e-14
99emb|CR642257.2|CNS0EUJB Tetraodon nigroviridis full-length cDNA 88 3e-14
100emb|CR640900.2|CNS0ETHM Tetraodon nigroviridis full-length cDNA 88 3e-14
101emb|CR635790.2|CNS0EPJO Tetraodon nigroviridis full-length cDNA 88 3e-14
102emb|CR722630.2|CNS0GKJ0 Tetraodon nigroviridis full-length cDNA 84 5e-13
103emb|CR734138.2|CNS0GT8P Tetraodon nigroviridis full-length cDNA 82 2e-12
104emb|CR710189.2|CNS0GAXL Tetraodon nigroviridis full-length cDNA 80 8e-12
105emb|CR707928.2|CNS0G96S Tetraodon nigroviridis full-length cDNA 80 8e-12
106emb|CR704690.2|CNS0G6OU Tetraodon nigroviridis full-length cDNA 80 8e-12
107emb|CR659514.2|CNS0F7UO Tetraodon nigroviridis full-length cDNA 80 8e-12
108emb|CR643404.2|CNS0EVF6 Tetraodon nigroviridis full-length cDNA 80 8e-12
109emb|CR634249.2|CNS0EOCV Tetraodon nigroviridis full-length cDNA 80 8e-12
110ref|NM_111432.2| Arabidopsis thaliana RPL18 (RIBOSOMAL PROTEIN L... 76 1e-10
111gb|AC011620.8|ATAC011620 Arabidopsis thaliana chromosome III BAC... 76 1e-10
112gb|AY037224.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, com... 76 1e-10
113dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
114emb|BX823193.1|CNS0A5VT Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
115emb|BX822829.1|CNS0A4S7 Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
116dbj|AP006268.4| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
117dbj|AP004343.2| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
118gb|U15741.1|ATU15741 Arabidopsis thaliana cytoplasmic ribosomal ... 76 1e-10
119gb|AY060533.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, com... 74 5e-10
120gb|AY190744.1| Pagrus major ribosomal protein L18 mRNA, partial cds 72 2e-09
121gb|BC076332.1| Danio rerio zgc:92872, mRNA (cDNA clone MGC:92872... 72 2e-09
122gb|AY389931.1| Latimeria chalumnae ribosomal protein L18-like mR... 72 2e-09
123ref|NM_001003432.1| Danio rerio zgc:92872 (zgc:92872), mRNA 72 2e-09
124emb|AJ306691.1|SSA306691 Salmo salar partial mRNA for L18 riboso... 72 2e-09
125gb|AF240375.1|AF240375 Oreochromis niloticus clone tiL18b riboso... 70 7e-09
126gb|AF240374.1|AF240374 Oreochromis niloticus clone tiL18a riboso... 70 7e-09
127gb|AY389963.1| Gallus gallus ribosomal protein L18 mRNA, partial... 66 1e-07
128emb|BX933065.2| Gallus gallus finished cDNA, clone ChEST914g7 66 1e-07
129emb|BX932992.2| Gallus gallus finished cDNA, clone ChEST1005i18 66 1e-07
130emb|AJ004961.1|CAA004961 Cicer arietinum mRNA for cytoplasmic ri... 66 1e-07
131ref|XM_512797.1| PREDICTED: Pan troglodytes similar to ribosomal... 62 2e-06
132gb|DQ213610.1| Taeniopygia guttata clone 0058P0027B10 ribosomal ... 62 2e-06
133dbj|AK110540.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
134gb|AY610456.1| Sus scrofa clone rmed27c_g16.y1.abd, mRNA sequence 62 2e-06
135emb|BX822675.1|CNS0A7MK Arabidopsis thaliana Full-length cDNA Co... 60 7e-06
136gb|BT013100.1| Lycopersicon esculentum clone 114386R, mRNA sequence 56 1e-04
137ref|NM_130325.1| Arabidopsis thaliana structural constituent of ... 54 4e-04
138ref|NM_000979.2| Homo sapiens ribosomal protein L18 (RPL18), mRNA 54 4e-04
139gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chr... 54 4e-04
140gb|BC000374.2| Homo sapiens ribosomal protein L18, mRNA (cDNA cl... 54 4e-04
141gb|BC082960.1| Xenopus tropicalis ribosomal protein L18, mRNA (c... 54 4e-04
142ref|XM_570671.1| Cryptococcus neoformans var. neoformans JEC21 h... 54 4e-04
143ref|XM_570672.1| Cryptococcus neoformans var. neoformans JEC21 h... 54 4e-04
144gb|DQ489378.1| Homo sapiens heat shock 70kDa protein 2 (HSPA2) g... 54 4e-04
145gb|BC051359.1| Homo sapiens cDNA clone IMAGE:6646239, **** WARNI... 54 4e-04
146ref|NM_001011030.1| Xenopus tropicalis ribosomal protein L18 (rp... 54 4e-04
147gb|BC021743.2| Homo sapiens ribosomal protein L18, mRNA (cDNA cl... 54 4e-04
148emb|CR626510.1| full-length cDNA clone CS0DK008YC06 of HeLa cell... 54 4e-04
149emb|CR623252.1| full-length cDNA clone CS0DI028YB06 of Placenta ... 54 4e-04
150emb|CR622915.1| full-length cDNA clone CS0DI003YD02 of Placenta ... 54 4e-04
151emb|CR614681.1| full-length cDNA clone CS0DD008YG13 of Neuroblas... 54 4e-04
152emb|CR609223.1| full-length cDNA clone CS0DM004YL12 of Fetal liv... 54 4e-04
153emb|CR608718.1| full-length cDNA clone CS0DM014YN06 of Fetal liv... 54 4e-04
154emb|CR602585.1| full-length cDNA clone CS0DD002YH22 of Neuroblas... 54 4e-04
155emb|CR601070.1| full-length cDNA clone CS0DC010YK01 of Neuroblas... 54 4e-04
156emb|CR600364.1| full-length cDNA clone CS0DI084YG06 of Placenta ... 54 4e-04
157emb|CR600341.1| full-length cDNA clone CS0DJ007YF01 of T cells (... 54 4e-04
158emb|CR598496.1| full-length cDNA clone CS0DF016YB08 of Fetal bra... 54 4e-04
159emb|CR597869.1| full-length cDNA clone CS0DI006YF05 of Placenta ... 54 4e-04
160emb|CR591878.1| full-length cDNA clone CS0DB002YN19 of Neuroblas... 54 4e-04
161emb|CR591552.1| full-length cDNA clone CS0DL006YH09 of B cells (... 54 4e-04
162emb|CR590122.1| full-length cDNA clone CS0DI081YM04 of Placenta ... 54 4e-04
163gb|AY205233.1| Medicago sativa 60S ribosomal protein mRNA, parti... 54 4e-04
164gb|AY130454.1| Branchiostoma lanceolatum ribosomal protein L18 m... 54 4e-04
165emb|AJ563457.1|CGI563457 Crassostrea gigas partial mRNA for ribo... 54 4e-04
166dbj|AK026558.1| Homo sapiens cDNA: FLJ22905 fis, clone KAT05654,... 54 4e-04
167gb|BC009708.2| Homo sapiens ribosomal protein L18, mRNA (cDNA cl... 54 4e-04
168emb|CR760488.2| Xenopus tropicalis finished cDNA, clone TNeu129c17 54 4e-04
169emb|AL049869.6|CNS0000P Human chromosome 14 DNA sequence BAC R-9... 54 4e-04
170gb|L11566.1|HUMRPL18A Homo sapiens ribosomal protein L18 (RPL18)... 54 4e-04
171ref|NM_122667.2| Arabidopsis thaliana structural constituent of ... 52 0.002
172gb|AF481060.1| Aplysia californica 60S ribosomal protein L18 mRN... 52 0.002
173emb|CR712898.2|CNS0GD0U Tetraodon nigroviridis full-length cDNA 52 0.002
174gb|BT000711.1| Arabidopsis thaliana clone RAFL09-17-C05 (R09425)... 52 0.002
175gb|AY122996.1| Arabidopsis thaliana putative 60S ribosomal prote... 52 0.002
176gb|AY056141.1| Arabidopsis thaliana putative 60S ribosomal prote... 52 0.002
177gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 ma... 52 0.002
178emb|BX832577.1|CNS0A1WZ Arabidopsis thaliana Full-length cDNA Co... 52 0.002
179gb|AC007399.1|AC007399 Arabidopsis thaliana BAC F14I23 from chro... 52 0.002
180gb|AC022748.10| Homo sapiens chromosome 15, clone RP11-160C18, c... 50 0.007
181gb|AC067863.19| Homo sapiens chromosome 15, clone RP11-335K5, co... 50 0.007
182gb|BC106288.1| Xenopus laevis hypothetical protein MGC64299, mRN... 48 0.027
183ref|XM_527867.1| PREDICTED: Pan troglodytes similar to ribosomal... 48 0.027
184gb|BC084727.1| Rattus norvegicus ribosomal protein L18, mRNA (cD... 48 0.027
185gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosom... 48 0.027
186gb|BC072558.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl... 48 0.027
187ref|NM_009077.2| Mus musculus ribosomal protein L18 (Rpl18), mRNA 48 0.027
188gb|BC053773.1| Xenopus laevis hypothetical protein MGC64299, mRN... 48 0.027
189ref|XM_001002512.1| PREDICTED: Mus musculus similar to 60S ribos... 48 0.027
190gb|AC074085.7| Homo sapiens BAC clone RP11-3L10 from 7, complete... 48 0.027
191emb|AL591143.11| Mouse DNA sequence from clone RP23-210L24 on ch... 48 0.027
192dbj|AK149813.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.027
193dbj|AK151667.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.027
194dbj|AK145649.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.027
195dbj|AK166803.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.027
196ref|XM_374646.3| PREDICTED: Homo sapiens similar to ribosomal pr... 48 0.027
197ref|XM_937605.1| PREDICTED: Homo sapiens similar to ribosomal pr... 48 0.027
198ref|XM_069734.4| PREDICTED: Homo sapiens similar to ribosomal pr... 48 0.027
199dbj|AK153172.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.027
200dbj|AK169659.1| Mus musculus 2 days neonate thymus thymic cells ... 48 0.027
201dbj|AK168288.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 48 0.027
202dbj|AB169565.1| Macaca fascicularis brain cDNA, clone: QflA-1395... 48 0.027
203dbj|AK010510.1| Mus musculus ES cells cDNA, RIKEN full-length en... 48 0.027
204dbj|AK009044.1| Mus musculus adult male tongue cDNA, RIKEN full-... 48 0.027
205dbj|AK012580.1| Mus musculus 11 days embryo whole body cDNA, RIK... 48 0.027
206dbj|AK007263.1| Mus musculus adult male testis cDNA, RIKEN full-... 48 0.027
207gb|BC090154.1| Xenopus laevis cDNA clone MGC:98504 IMAGE:7198701... 48 0.027
208gb|BC090155.1| Xenopus laevis cDNA clone MGC:98507 IMAGE:7198715... 48 0.027
209ref|NM_031102.1| Rattus norvegicus ribosomal protein L18 (Rpl18)... 48 0.027
210gb|AF401572.1| Ictalurus punctatus ribosomal protein L18 mRNA, c... 48 0.027
211gb|BC091732.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl... 48 0.027
212emb|V01439.1|XLRIB2 Fragment of Xenopus laevis mRNA for ribosoma... 48 0.027
213emb|AL732452.5| Mouse DNA sequence from clone RP23-177C20 on chr... 48 0.027
214emb|X06223.1|XLRPL14B Xenopus laevis mRNA for ribosomal protein ... 48 0.027
215gb|BC082290.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl... 48 0.027
216gb|BC081468.1| Mus musculus ribosomal protein L18, mRNA (cDNA cl... 48 0.027
217ref|NG_005371.1| Mus musculus ribosomal protein L18 pseudogene (... 48 0.027
218gb|M20156.1|RATRPL18A Rat ribosomal protein L18 mRNA, complete cds 48 0.027
219ref|NM_001015556.2| Bos taurus ribosomal protein L18 (RPL18), mRNA 46 0.11
220gb|AC010115.6| Drosophila melanogaster 3L BAC RP98-16I16 (Roswel... 46 0.11
221gb|AY113554.1| Drosophila melanogaster RH01814 full insert cDNA 46 0.11
222ref|NM_139834.2| Drosophila melanogaster Ribosomal protein L18 C... 46 0.11
223gb|BC104507.1| Bos taurus ribosomal protein L18, mRNA (cDNA clon... 46 0.11
224gb|DQ066324.1| Ixodes scapularis isolate IS-6-12L-136 ribosomal ... 46 0.11
225gb|AC010528.8|AC010528 Homo sapiens chromosome 16 clone RP11-150... 46 0.11
226gb|AY130355.1| Myxine glutinosa ribosomal protein L18 mRNA, part... 46 0.11
227gb|AC009046.4|AC009046 Homo sapiens chromosome 16 clone RP11-200... 46 0.11
228dbj|AK174004.1| Ciona intestinalis cDNA, clone:ciad012g12, full ... 46 0.11
229gb|BT021047.1| Bos taurus ribosomal protein L18 (RPL18), mRNA, c... 46 0.11
230gb|AE003559.3| Drosophila melanogaster chromosome 3L, section 26... 46 0.11
231emb|CR533575.5| Zebrafish DNA sequence from clone CH211-215M13 i... 44 0.43
232emb|X05025.1|XLRPL14 Xenopus laevis gene for ribosomal protein L14 44 0.43
233emb|AL808124.12| Mouse DNA sequence from clone RP23-146I4 on chr... 44 0.43
234gb|AC151347.2| Xenopus tropicalis clone ISB-394A6, complete sequ... 42 1.7
235ref|XM_390042.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 42 1.7
236gb|AC142499.9| Mus musculus strain C57BL/6J clone rp23-333m15, c... 42 1.7
237gb|AC134382.13| Mus musculus strain C57BL/6J clone rp23-167l1, c... 42 1.7
238gb|AC007961.32| Mus musculus strain 129S6/SvEvTac clone rp21-594... 42 1.7
239gb|AC005302.70| Mus musculus strain 129S6/SvEvTac chromosome 10 ... 42 1.7
240dbj|AB180448.1| Plutella xylostella mRNA for Ribosomal protein L... 42 1.7
241dbj|AP004411.1| Bregmaceros nectabanus mitochondrial DNA, comple... 42 1.7
242gb|AY443750.1| Crematogaster sp. B SPQ-2003 isolate SPQ.051 cyto... 40 6.7
243gb|AY443748.1| Crematogaster sp. B SPQ-2003 isolate SPQ.049 cyto... 40 6.7
244gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome 40 6.7
245gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome 40 6.7
246gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's ... 40 6.7
247ref|XM_362039.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.7
248gb|AY463528.1| Gallus gallus prolyl 3-hydroxylase 1 (P3H1) mRNA,... 40 6.7
249ref|XM_537965.2| PREDICTED: Canis familiaris similar to ribosoma... 40 6.7
250ref|XM_849725.1| PREDICTED: Canis familiaris similar to ribosoma... 40 6.7
251ref|XM_541138.2| PREDICTED: Canis familiaris similar to ribosoma... 40 6.7
252ref|XM_962949.1| PREDICTED: Tribolium castaneum similar to CG861... 40 6.7
253gb|AC158566.8| Mus musculus chromosome 8, clone RP24-149I12, com... 40 6.7
254ref|NM_001000148.1| Rattus norvegicus olfactory receptor 107 (pr... 40 6.7
255ref|NM_001001529.1| Gallus gallus leucine proline-enriched prote... 40 6.7
256dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 40 6.7
257gb|AF240376.1|AF240376 Tilapia mossambica ribosomal protein L18 ... 40 6.7
258dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.7
259gb|AC018717.11| Homo sapiens BAC clone RP11-505H14 from 2, compl... 40 6.7
260ref|NM_204413.1| Gallus gallus nuclear factor of kappa light pol... 40 6.7
261gb|AC102544.14| Mus musculus chromosome 8, clone RP23-118B13, co... 40 6.7
262dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.7
263dbj|D16367.1|CHKP50B Gallus gallus p50B mRNA for p50B/p97 (Lyt-1... 40 6.7
264emb|AL590969.12| Mouse DNA sequence from clone RP23-281C18 on ch... 40 6.7

>gb|AY846824.1| Triticum aestivum ribosomal protein L18 mRNA, complete cds
          Length = 793

 Score =  835 bits (421), Expect = 0.0
 Identities = 479/496 (96%), Gaps = 2/496 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   taagaatctt-cnaaatat-attcgaacactggggcgatagattgtgctgctctcagtac 58
           |||||||||| | |||||| |||||||||||||||||||||||| |||| ||||||||||
Sbjct: 733 taagaatcttgcaaaatatcattcgaacactggggcgatagattttgctactctcagtac 674

                                                                       
Query: 59  taagtactttactaattactgtcaattgctcaaacagaacaacagccgctccacgcaaac 118
            ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||
Sbjct: 673 aaagtactttactaattactatcaattgctcaaacagaacaacagccgctccacacaaac 614

                                                                       
Query: 119 agcgactaaccagaaagggcaacttaaaccttgaagccacggctgttcctcctaccacga 178
           |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 613 agcgactaacaagaaagggcgacttaaaccttgaagccacggctgttcctcctaccacga 554

                                                                       
Query: 179 gccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcaca 238
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 553 accttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcaca 494

                                                                       
Query: 239 ccaggagccttgccgaagtgcctcaccgcctcacgggcattcttgggtcccctcaacagg 298
           ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 493 ccaggcgccttgccgaagtgcctcaccgcctcacgcgcattcttgggtcccctcaacagg 434

                                                                       
Query: 299 atcgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactcccca 358
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 433 atcgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactcccca 374

                                                                       
Query: 359 ccagcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcatt 418
           |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 373 ccagcattgataatccttgccctcgctgtctctgtgaacctcagagcagtaaccttcatt 314

                                                                       
Query: 419 gctgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttc 478
           ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 313 gctgggacctcttggatccgcatgtcatctgtgattgtaccaacaaccacagcaatgttc 254

                           
Query: 479 ttctcctcctttccct 494
           ||||||||||||||||
Sbjct: 253 ttctcctcctttccct 238



to top

>gb|BT017364.1| Zea mays clone EL01N0324F01.c mRNA sequence
          Length = 772

 Score =  478 bits (241), Expect = e-132
 Identities = 319/345 (92%)
 Strand = Plus / Minus

                                                                       
Query: 141 cttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccct 200
           ||||||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||||
Sbjct: 608 cttaaaccttgaacccacggctgttcctcctgccacgagccttctcgaacttccttccct 549

                                                                       
Query: 201 tggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgcc 260
           ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 548 tggagcgcacatatggcttggtgtggctgtgcggcactccaggagccttgccgaagtgcc 489

                                                                       
Query: 261 tcaccgcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttggag 320
           ||||||||||||||||||||||||| |||||||| ||||  |||||||| |||  |||||
Sbjct: 488 tcaccgcctcacgggcattcttggggcccctcaagaggactgtgttctcgccaagtggag 429

                                                                       
Query: 321 cacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgccc 380
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 428 cacggagagcaagctggtcaaatgtgaggcactccccaccagcattgacaatcctggccc 369

                                                                       
Query: 381 tcgctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatccgca 440
           | || ||||| ||||||||||| || ||||||||||||||||| | ||||||||||| | 
Sbjct: 368 ttgccgtctcggtgaacctcagggcagtaaccttcattgctggaacctcttggatcctct 309

                                                        
Query: 441 tgtcatctgtgattgtgccaacaaccacagcaatgttcttctcct 485
           |||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 308 tgtcatctgtgactgtgccaacaatcacagcaatgttcttctcct 264



to top

>gb|AY104839.1| Zea mays PCO137857 mRNA sequence
          Length = 1127

 Score =  478 bits (241), Expect = e-132
 Identities = 319/345 (92%)
 Strand = Plus / Minus

                                                                       
Query: 141 cttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccct 200
           ||||||||||||| ||||||||||||||||| |||||||||||||| |||||||| ||||
Sbjct: 833 cttaaaccttgaacccacggctgttcctcctgccacgagccttctcgaacttccttccct 774

                                                                       
Query: 201 tggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgcc 260
           ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 773 tggagcgcacatatggcttggtgtggctgtgcggcactccaggagccttgccgaagtgcc 714

                                                                       
Query: 261 tcaccgcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttggag 320
           ||||||||||||||||||||||||| |||||||| ||||  |||||||| |||  |||||
Sbjct: 713 tcaccgcctcacgggcattcttggggcccctcaagaggactgtgttctcgccaagtggag 654

                                                                       
Query: 321 cacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgccc 380
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 653 cacggagagcaagctggtcaaatgtgaggcactccccaccagcattgacaatcctggccc 594

                                                                       
Query: 381 tcgctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatccgca 440
           | || ||||| ||||||||||| || ||||||||||||||||| | ||||||||||| | 
Sbjct: 593 ttgccgtctcggtgaacctcagggcagtaaccttcattgctggaacctcttggatcctct 534

                                                        
Query: 441 tgtcatctgtgattgtgccaacaaccacagcaatgttcttctcct 485
           |||||||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 533 tgtcatctgtgactgtgccaacaatcacagcaatgttcttctcct 489



to top

>gb|DQ363992.1| Saccharum hybrid cultivar putative 60S ribosomal protein L18 mRNA,
           partial cds
          Length = 527

 Score =  424 bits (214), Expect = e-115
 Identities = 292/318 (91%)
 Strand = Plus / Minus

                                                                       
Query: 142 ttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccctt 201
           |||||||||||| ||||||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 318 ttaaaccttgaatccacggctgttcctcctgccacgagccttctcgaacttccttccctt 259

                                                                       
Query: 202 ggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgcct 261
           |||||||||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||
Sbjct: 258 ggagcgcacatatggcttggtgtggctgtgtggcacgccaggagccttgccaaagtgcct 199

                                                                       
Query: 262 caccgcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttggagc 321
           |||||||||||||||||||||||| |||||||| |||| ||||||||| |||  ||||||
Sbjct: 198 caccgcctcacgggcattcttggggcccctcaagaggaccgtgttctcgccaagtggagc 139

                                                                       
Query: 322 acggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgccct 381
           ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 138 acggagagcaagctggtcaaatgtgaggcactccccaccagcattgacaatcctggccct 79

                                                                       
Query: 382 cgctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatccgcat 441
            |||||||| ||||||||||| || ||||||||||||||||| | ||| ||||||| | |
Sbjct: 78  tgctgtctcggtgaacctcagggcagtaaccttcattgctggaacctcctggatcctctt 19

                             
Query: 442 gtcatctgtgattgtgcc 459
           ||||||||||| ||||||
Sbjct: 18  gtcatctgtgactgtgcc 1



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 67  ttactaattactgtcaattgctcaaacagaac 98
           ||||||||||||||| |||| |||||||||||
Sbjct: 395 ttactaattactgtcgattgatcaaacagaac 364



to top

>dbj|AK061929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-C09, full
           insert sequence
          Length = 839

 Score =  392 bits (198), Expect = e-106
 Identities = 312/350 (89%)
 Strand = Plus / Minus

                                                                       
Query: 140 acttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccc 199
           ||||| |||||||| ||||||||||||||||| ||||| |||||||| |||||||| |||
Sbjct: 632 acttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccc 573

                                                                       
Query: 200 ttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgc 259
           |||||||||||||| ||||| ||||||||||||||||||||||||||||| || ||||||
Sbjct: 572 ttggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgc 513

                                                                       
Query: 260 ctcaccgcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttgga 319
           || || |||||||||||||||||||| |||||||| |||| |||||||||||||   |||
Sbjct: 512 ctgacggcctcacgggcattcttgggacccctcaagaggaccgtgttctccccaagcgga 453

                                                                       
Query: 320 gcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgcc 379
           |||||||||||||||||||| || ||||||||||| || |||||||||||||||||||||
Sbjct: 452 gcacggagagcaagctggtcgaaggtgaggcactcgccgccagcattgacaatccttgcc 393

                                                                       
Query: 380 ctcgctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatccgc 439
           || || ||||| ||||||||||| || ||||||||||||   || ||||||||||||| |
Sbjct: 392 ctagccgtctccgtgaacctcagggcagtaaccttcattttcggaatctcttggatcctc 333

                                                             
Query: 440 atgtcatctgtgattgtgccaacaaccacagcaatgttcttctcctcctt 489
            ||||||| |||| ||| ||||||| |||||||||||| |||||||||||
Sbjct: 332 ttgtcatcagtgactgtaccaacaatcacagcaatgttgttctcctcctt 283



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 68  tactaattactgtcaattgctcaaacagaac 98
           |||||||||||||| ||||||||||||||||
Sbjct: 704 tactaattactgtcgattgctcaaacagaac 674



to top

>dbj|AK120877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023027I12, full
           insert sequence
          Length = 997

 Score =  392 bits (198), Expect = e-106
 Identities = 312/350 (89%)
 Strand = Plus / Minus

                                                                       
Query: 140 acttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccc 199
           ||||| |||||||| ||||||||||||||||| ||||| |||||||| |||||||| |||
Sbjct: 633 acttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccc 574

                                                                       
Query: 200 ttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgc 259
           |||||||||||||| ||||| ||||||||||||||||||||||||||||| || ||||||
Sbjct: 573 ttggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgc 514

                                                                       
Query: 260 ctcaccgcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttgga 319
           || || |||||||||||||||||||| |||||||| |||| |||||||||||||   |||
Sbjct: 513 ctgacggcctcacgggcattcttgggacccctcaagaggaccgtgttctccccaagcgga 454

                                                                       
Query: 320 gcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgcc 379
           |||||||||||||||||||| || ||||||||||| || |||||||||||||||||||||
Sbjct: 453 gcacggagagcaagctggtcgaaggtgaggcactcgccgccagcattgacaatccttgcc 394

                                                                       
Query: 380 ctcgctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatccgc 439
           || || ||||| ||||||||||| || ||||||||||||   || ||||||||||||| |
Sbjct: 393 ctagccgtctccgtgaacctcagggcagtaaccttcattttcggaatctcttggatcctc 334

                                                             
Query: 440 atgtcatctgtgattgtgccaacaaccacagcaatgttcttctcctcctt 489
            ||||||| |||| ||| ||||||| |||||||||||| |||||||||||
Sbjct: 333 ttgtcatcagtgactgtaccaacaatcacagcaatgttgttctcctcctt 284



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 68  tactaattactgtcaattgctcaaacagaac 98
           |||||||||||||| ||||||||||||||||
Sbjct: 705 tactaattactgtcgattgctcaaacagaac 675



to top

>ref|NM_185271.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 567

 Score =  389 bits (196), Expect = e-105
 Identities = 307/344 (89%)
 Strand = Plus / Minus

                                                                       
Query: 146 accttgaagccacggctgttcctcctaccacgagccttctcaaacttcctacccttggag 205
           |||||||| ||||||||||||||||| ||||| |||||||| |||||||| |||||||||
Sbjct: 563 accttgaatccacggctgttcctcctgccacgggccttctcgaacttccttcccttggag 504

                                                                       
Query: 206 cgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgcctcacc 265
           |||||||| ||||| ||||||||||||||||||||||||||||| || |||||||| || 
Sbjct: 503 cgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgcctgacg 444

                                                                       
Query: 266 gcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttggagcacgg 325
           |||||||||||||||||||| |||||||| |||| |||||||||||||   |||||||||
Sbjct: 443 gcctcacgggcattcttgggacccctcaagaggaccgtgttctccccaagcggagcacgg 384

                                                                       
Query: 326 agagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgccctcgct 385
           |||||||||||||| || ||||||||||| || ||||||||||||||||||||||| || 
Sbjct: 383 agagcaagctggtcgaaggtgaggcactcgccgccagcattgacaatccttgccctagcc 324

                                                                       
Query: 386 gtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatccgcatgtca 445
           ||||| ||||||||||| || ||||||||||||   || ||||||||||||| | |||||
Sbjct: 323 gtctccgtgaacctcagggcagtaaccttcattttcggaatctcttggatcctcttgtca 264

                                                       
Query: 446 tctgtgattgtgccaacaaccacagcaatgttcttctcctcctt 489
           || |||| ||| ||||||| |||||||||||| |||||||||||
Sbjct: 263 tcagtgactgtaccaacaatcacagcaatgttgttctcctcctt 220



to top

>dbj|AK102810.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108L02, full
           insert sequence
          Length = 824

 Score =  377 bits (190), Expect = e-101
 Identities = 310/350 (88%)
 Strand = Plus / Minus

                                                                       
Query: 140 acttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccc 199
           ||||| |||||||| ||||||||||||||||| ||||| |||||||| |||||||| |||
Sbjct: 633 acttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccc 574

                                                                       
Query: 200 ttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgc 259
           |||||||||||||| ||||| ||||||||||||||||||||||||||||| || ||||||
Sbjct: 573 ttggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgc 514

                                                                       
Query: 260 ctcaccgcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttgga 319
           || || |||||||||||||||||||| |||| ||| |||| |||||||||||||   |||
Sbjct: 513 ctgacggcctcacgggcattcttgggaccccccaagaggaccgtgttctccccaagcgga 454

                                                                       
Query: 320 gcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgcc 379
           |||| ||||||||||||||| || ||||||||||| || |||||||||||||||||||||
Sbjct: 453 gcactgagagcaagctggtcgaaggtgaggcactcgccgccagcattgacaatccttgcc 394

                                                                       
Query: 380 ctcgctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatccgc 439
           || || ||||| ||||||||||| || ||||||||||||   || ||||||||||||| |
Sbjct: 393 ctagccgtctccgtgaacctcagggcagtaaccttcattttcggaatctcttggatcctc 334

                                                             
Query: 440 atgtcatctgtgattgtgccaacaaccacagcaatgttcttctcctcctt 489
            ||||||| |||| ||| ||||||| |||||||||||| |||||||||||
Sbjct: 333 ttgtcatcagtgactgtaccaacaatcacagcaatgttgttctcctcctt 284



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 68  tactaattactgtcaattgctcaaacagaac 98
           |||||||||||||| ||||||||||||||||
Sbjct: 705 tactaattactgtcgattgctcaaacagaac 675



to top

>gb|DQ428164.1| Sorghum propinquum locus PRC0147 genomic sequence
          Length = 707

 Score =  246 bits (124), Expect = 6e-62
 Identities = 172/188 (91%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 493 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 434

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| ||||| |||||||||||||||||||| || ||||||||||||||
Sbjct: 433 agcattgacaatcctggcccttgctgtctctgtgaacctcagggcagtaaccttcattgc 374

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 373 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 314

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 313 ctcctcct 306



to top

>gb|DQ428163.1| Sorghum bicolor voucher PI585454 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428162.1| Sorghum bicolor voucher PI267539 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428161.1| Sorghum bicolor voucher PI267408 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428160.1| Sorghum bicolor voucher PI221607 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428159.1| Sorghum bicolor voucher PI152702 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428158.1| Sorghum bicolor voucher NSL92371 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428157.1| Sorghum bicolor voucher NSL87902 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428156.1| Sorghum bicolor voucher NSL87666 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428155.1| Sorghum bicolor voucher NSL77217 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428154.1| Sorghum bicolor voucher NSL77034 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428153.1| Sorghum bicolor voucher NSL56174 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428152.1| Sorghum bicolor voucher NSL56003 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428151.1| Sorghum bicolor voucher NSL55243 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428150.1| Sorghum bicolor voucher NSL51365 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428149.1| Sorghum bicolor voucher NSL51030 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428148.1| Sorghum bicolor voucher NSL50875 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|DQ428147.1| Sorghum bicolor voucher BTx623 locus PRC0147 genomic sequence
          Length = 682

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 301 cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
           ||||||||| |||  ||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 502 cgtgttctcgccaagtggagcacggagagcaagctggtcaaatgtgaggcactccccacc 443

                                                                       
Query: 361 agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
           ||||||||||||||| || || |||||||| ||||||||||| || ||||||||||||||
Sbjct: 442 agcattgacaatcctggctcttgctgtctcggtgaacctcagggcagtaaccttcattgc 383

                                                                       
Query: 421 tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
           ||| | ||| |||||||   |||||||||||| ||||||||||| |||||||||||||||
Sbjct: 382 tggaacctcctggatccttttgtcatctgtgactgtgccaacaatcacagcaatgttctt 323

                   
Query: 481 ctcctcct 488
           ||||||||
Sbjct: 322 ctcctcct 315



to top

>gb|AC087551.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0431G05,
             complete sequence
          Length = 145044

 Score =  206 bits (104), Expect = 5e-50
 Identities = 146/160 (91%)
 Strand = Plus / Minus

                                                                         
Query: 140   acttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccc 199
             ||||| |||||||| ||||||||||||||||| ||||| |||||||| |||||||| |||
Sbjct: 49878 acttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccc 49819

                                                                         
Query: 200   ttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgc 259
             |||||||||||||| ||||| ||||||||||||||||||||||||||||| || ||||||
Sbjct: 49818 ttggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgc 49759

                                                     
Query: 260   ctcaccgcctcacgggcattcttgggtcccctcaacagga 299
             || || |||||||||||||||||||| |||||||| ||||
Sbjct: 49758 ctgacggcctcacgggcattcttgggacccctcaagagga 49719



 Score =  190 bits (96), Expect = 3e-45
 Identities = 165/188 (87%)
 Strand = Plus / Minus

                                                                         
Query: 301   cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
             |||||||||||||   ||||||||||||||||||||||| || ||||||||||| || ||
Sbjct: 48716 cgtgttctccccaagcggagcacggagagcaagctggtcgaaggtgaggcactcgccgcc 48657

                                                                         
Query: 361   agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
             ||||||||||||||||||||| || ||||| ||||||||||| || ||||||||||||  
Sbjct: 48656 agcattgacaatccttgccctagccgtctccgtgaacctcagggcagtaaccttcatttt 48597

                                                                         
Query: 421   tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
              || ||||||||||||| | ||||||| |||| ||| ||||||| |||||||||||| ||
Sbjct: 48596 cggaatctcttggatcctcttgtcatcagtgactgtaccaacaatcacagcaatgttgtt 48537

                     
Query: 481   ctcctcct 488
             ||||||||
Sbjct: 48536 ctcctcct 48529



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                            
Query: 68    tactaattactgtcaattgctcaaacagaac 98
             |||||||||||||| ||||||||||||||||
Sbjct: 49950 tactaattactgtcgattgctcaaacagaac 49920



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  206 bits (104), Expect = 5e-50
 Identities = 146/160 (91%)
 Strand = Plus / Minus

                                                                           
Query: 140     acttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccc 199
               ||||| |||||||| ||||||||||||||||| ||||| |||||||| |||||||| |||
Sbjct: 3172161 acttagaccttgaatccacggctgttcctcctgccacgggccttctcgaacttccttccc 3172102

                                                                           
Query: 200     ttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgc 259
               |||||||||||||| ||||| ||||||||||||||||||||||||||||| || ||||||
Sbjct: 3172101 ttggagcgcacatatggcttcgtgtggctgtgcggcacaccaggagccttaccaaagtgc 3172042

                                                       
Query: 260     ctcaccgcctcacgggcattcttgggtcccctcaacagga 299
               || || |||||||||||||||||||| |||||||| ||||
Sbjct: 3172041 ctgacggcctcacgggcattcttgggacccctcaagagga 3172002



 Score =  190 bits (96), Expect = 3e-45
 Identities = 165/188 (87%)
 Strand = Plus / Minus

                                                                           
Query: 301     cgtgttctccccagttggagcacggagagcaagctggtcaaaagtgaggcactccccacc 360
               |||||||||||||   ||||||||||||||||||||||| || ||||||||||| || ||
Sbjct: 3170999 cgtgttctccccaagcggagcacggagagcaagctggtcgaaggtgaggcactcgccgcc 3170940

                                                                           
Query: 361     agcattgacaatccttgccctcgctgtctctgtgaacctcagagcggtaaccttcattgc 420
               ||||||||||||||||||||| || ||||| ||||||||||| || ||||||||||||  
Sbjct: 3170939 agcattgacaatccttgccctagccgtctccgtgaacctcagggcagtaaccttcatttt 3170880

                                                                           
Query: 421     tgggatctcttggatccgcatgtcatctgtgattgtgccaacaaccacagcaatgttctt 480
                || ||||||||||||| | ||||||| |||| ||| ||||||| |||||||||||| ||
Sbjct: 3170879 cggaatctcttggatcctcttgtcatcagtgactgtaccaacaatcacagcaatgttgtt 3170820

                       
Query: 481     ctcctcct 488
               ||||||||
Sbjct: 3170819 ctcctcct 3170812



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                              
Query: 68      tactaattactgtcaattgctcaaacagaac 98
               |||||||||||||| ||||||||||||||||
Sbjct: 3172233 tactaattactgtcgattgctcaaacagaac 3172203



to top

>gb|AY106208.1| Zea mays PCO085865 mRNA sequence
          Length = 1008

 Score =  159 bits (80), Expect = 1e-35
 Identities = 215/260 (82%)
 Strand = Plus / Minus

                                                                       
Query: 140 acttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccc 199
           ||||| ||||||||||| | |||||||||||| || |  |||||||||||||||||||||
Sbjct: 614 acttagaccttgaagcccctgctgttcctccttcctctcgccttctcaaacttcctaccc 555

                                                                       
Query: 200 ttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgc 259
           || ||||| ||||| ||||||||||||||||| ||||| || || ||    |||||||||
Sbjct: 554 ttcgagcgaacataaggcttggtgtggctgtgaggcactcctggtgcaggcccgaagtgc 495

                                                                       
Query: 260 ctcaccgcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttgga 319
           || || || || |  || ||||| || ||||||| ||| | |||||| | ||||  ||| 
Sbjct: 494 ctgacagcttccctagcgttcttaggacccctcagcagaaccgtgttttgcccaagtggg 435

                                                                       
Query: 320 gcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgcc 379
           |||||||| || |||||||| || ||||||||||| || ||||||||||  ||||| |||
Sbjct: 434 gcacggagcgcgagctggtcgaaggtgaggcactctccgccagcattgatgatcctggcc 375

                               
Query: 380 ctcgctgtctctgtgaacct 399
           ||||||||||| ||||||||
Sbjct: 374 ctcgctgtctcagtgaacct 355



to top

>gb|BT019314.1| Zea mays clone Contig987.F mRNA sequence
          Length = 786

 Score =  151 bits (76), Expect = 3e-33
 Identities = 214/260 (82%)
 Strand = Plus / Plus

                                                                       
Query: 140 acttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccc 199
           ||||| ||||||||||| | |||||||||||| || |  |||||||||||||||||||||
Sbjct: 184 acttagaccttgaagcccctgctgttcctccttcctctcgccttctcaaacttcctaccc 243

                                                                       
Query: 200 ttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgc 259
           || ||||| ||||| ||||||||||||||||| ||||| || || ||    |||||||||
Sbjct: 244 ttcgagcgaacataaggcttggtgtggctgtgaggcactcctggtgcaggcccgaagtgc 303

                                                                       
Query: 260 ctcaccgcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttgga 319
           || || || || |  || ||||| || ||||||| ||| | |||||| | ||||   || 
Sbjct: 304 ctgacagcttccctagcgttcttaggacccctcagcagaaccgtgttttgcccaagcggg 363

                                                                       
Query: 320 gcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgcc 379
           |||||||| || |||||||| || ||||||||||| || ||||||||||  ||||| |||
Sbjct: 364 gcacggagcgcgagctggtcgaaggtgaggcactctccgccagcattgatgatcctggcc 423

                               
Query: 380 ctcgctgtctctgtgaacct 399
           ||||||||||| ||||||||
Sbjct: 424 ctcgctgtctcagtgaacct 443



to top

>dbj|AK121580.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037B18, full
           insert sequence
          Length = 769

 Score =  103 bits (52), Expect = 5e-19
 Identities = 225/280 (80%), Gaps = 2/280 (0%)
 Strand = Plus / Minus

                                                                       
Query: 139 aacttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctacc 198
           |||||| |||||||||||   |||||||||||| || |  ||||||||||||||||| ||
Sbjct: 610 aacttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttcc 551

                                                                       
Query: 199 cttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtg 258
           ||| |||||||| || |||||||||| |||||| ||||| ||||||||    || |||||
Sbjct: 550 ctttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagcaggaccaaagtg 491

                                                                       
Query: 259 cctcaccgcctcacgggcattcttgggtcccctcaacaggatcgtgttct-ccccagttg 317
           | |||| || || | ||| ||||| || |||||||  || | ||||||||  |||||  |
Sbjct: 490 cttcactgcttccctggcgttcttaggacccctcaggagaaccgtgttctggcccag-ag 432

                                                                       
Query: 318 gagcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttg 377
           |||| ||||| || ||||| || || || |||||||| ||||||| ||| ||||| |  |
Sbjct: 431 gagcgcggagcgccagctgatcgaaggtaaggcactctccaccagtattcacaatgcgag 372

                                                   
Query: 378 ccctcgctgtctctgtgaacctcagagcggtaaccttcat 417
           ||||||| ||||| |||||||| || ||||  ||||||||
Sbjct: 371 ccctcgcggtctcggtgaacctgagcgcggccaccttcat 332



to top

>ref|XM_479492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 850

 Score =  101 bits (51), Expect = 2e-18
 Identities = 249/315 (79%)
 Strand = Plus / Minus

                                                                       
Query: 138 caacttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctac 197
           ||||||| |||||||||||   ||||||||| || || |  ||||||||||| ||||| |
Sbjct: 623 caacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttccttc 564

                                                                       
Query: 198 ccttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagt 257
           |||| ||||| ||||| ||||| |||| |||||| || || || |||||   ||| ||||
Sbjct: 563 cctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaaagt 504

                                                                       
Query: 258 gcctcaccgcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttg 317
           || | || || || |  || |||||||| |||||||  |||| ||||||||  |||   |
Sbjct: 503 gcttaacagcttccctagcgttcttgggacccctcaggaggaccgtgttctggccaagcg 444

                                                                       
Query: 318 gagcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttg 377
           | || |||||||| |||||||| || ||||||||||| ||||| |||||||  |||| ||
Sbjct: 443 gggcgcggagagcgagctggtcgaacgtgaggcactcgccaccggcattgatgatccgtg 384

                                                                       
Query: 378 ccctcgctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatcc 437
           | ||||| ||||| |||||||| ||||| |  |||||||| || || | ||| | |||||
Sbjct: 383 ctctcgcggtctcggtgaacctgagagcagccaccttcatcgccggcacctcatagatcc 324

                          
Query: 438 gcatgtcatctgtga 452
            | ||||||||||||
Sbjct: 323 tcttgtcatctgtga 309



to top

>dbj|AK066329.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013060D13, full
           insert sequence
          Length = 850

 Score =  101 bits (51), Expect = 2e-18
 Identities = 249/315 (79%)
 Strand = Plus / Minus

                                                                       
Query: 138 caacttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctac 197
           ||||||| |||||||||||   ||||||||| || || |  ||||||||||| ||||| |
Sbjct: 623 caacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttccttc 564

                                                                       
Query: 198 ccttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagt 257
           |||| ||||| ||||| ||||| |||| |||||| || || || |||||   ||| ||||
Sbjct: 563 cctttgagcgaacatatggcttagtgttgctgtggggaactcctggagcagggccaaagt 504

                                                                       
Query: 258 gcctcaccgcctcacgggcattcttgggtcccctcaacaggatcgtgttctccccagttg 317
           || | || || || |  || |||||||| |||||||  |||| ||||||||  |||   |
Sbjct: 503 gcttaacagcttccctagcgttcttgggacccctcaggaggaccgtgttctggccaagcg 444

                                                                       
Query: 318 gagcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttg 377
           | || |||||||| |||||||| || ||||||||||| ||||| |||||||  |||| ||
Sbjct: 443 gggcgcggagagcgagctggtcgaacgtgaggcactcgccaccggcattgatgatccgtg 384

                                                                       
Query: 378 ccctcgctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatcc 437
           | ||||| ||||| |||||||| ||||| |  |||||||| || || | ||| | |||||
Sbjct: 383 ctctcgcggtctcggtgaacctgagagcagccaccttcatcgccggcacctcatagatcc 324

                          
Query: 438 gcatgtcatctgtga 452
            | ||||||||||||
Sbjct: 323 tcttgtcatctgtga 309



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                            
Query: 139      aacttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctacc 198
                |||||| |||||||||||   |||||||||||| || |  ||||||||||||||||| ||
Sbjct: 12690607 aacttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttcc 12690666

                                                                
Query: 199      cttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
                ||| |||||||| || |||||||||| |||||| ||||| ||||||||
Sbjct: 12690667 ctttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagc 12690714



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                            
Query: 139      aacttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctacc 198
                |||||| |||||||||||   |||||||||||| || |  ||||||||||||||||| ||
Sbjct: 12687370 aacttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttcc 12687429

                                                                
Query: 199      cttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
                ||| |||||||| || |||||||||| |||||| ||||| ||||||||
Sbjct: 12687430 ctttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagc 12687477



to top

>gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0050D18, complete sequence
          Length = 126350

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                         
Query: 139   aacttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctacc 198
             |||||| |||||||||||   |||||||||||| || |  ||||||||||||||||| ||
Sbjct: 45060 aacttagaccttgaagcctttgctgttcctccttcctctcgccttctcaaacttccttcc 45119

                                                             
Query: 199   cttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
             ||| |||||||| || |||||||||| |||||| ||||| ||||||||
Sbjct: 45120 ctttgagcgcacgtaaggcttggtgttgctgtgtggcactccaggagc 45167



to top

>emb|CR734840.2|CNS0GTS7 Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 441 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 382



to top

>emb|CR734324.2|CNS0GTDV Tetraodon nigroviridis full-length cDNA
          Length = 614

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 533 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 474



to top

>emb|CR712214.2|CNS0GCHU Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR727240.2|CNS0GO32 Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR722346.2|CNS0GKB4 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR722203.2|CNS0GK75 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR720412.2|CNS0GITE Tetraodon nigroviridis full-length cDNA
          Length = 604

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 522 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 463



to top

>emb|CR718786.2|CNS0GHK8 Tetraodon nigroviridis full-length cDNA
          Length = 654

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR718640.2|CNS0GHG6 Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 564 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 505



to top

>emb|CR718477.2|CNS0GHBN Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 557 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 498



to top

>emb|CR718216.2|CNS0GH4E Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR716822.2|CNS0GG1R Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 556 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 497



to top

>emb|CR716557.2|CNS0GFUE Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 564 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 505



to top

>emb|CR716126.2|CNS0GFII Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR715708.2|CNS0GF6W Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR713867.2|CNS0GDRR Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 535 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 476



to top

>emb|CR713475.2|CNS0GDGV Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 556 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 497



to top

>emb|CR713262.2|CNS0GDAY Tetraodon nigroviridis full-length cDNA
          Length = 649

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 567 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 508



to top

>emb|CR710888.2|CNS0GBH0 Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 556 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 497



to top

>emb|CR710045.2|CNS0GATL Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 557 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 498



to top

>emb|CR709916.2|CNS0GAQ0 Tetraodon nigroviridis full-length cDNA
          Length = 649

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 567 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 508



to top

>emb|CR707932.2|CNS0G96W Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR707373.2|CNS0G8RD Tetraodon nigroviridis full-length cDNA
          Length = 616

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 534 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 475



to top

>emb|CR707090.2|CNS0G8JI Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 535 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 476



to top

>emb|CR706834.2|CNS0G8CE Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR706311.2|CNS0G7XV Tetraodon nigroviridis full-length cDNA
          Length = 649

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 567 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 508



to top

>emb|CR705355.2|CNS0G77B Tetraodon nigroviridis full-length cDNA
          Length = 644

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 562 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 503



to top

>emb|CR705285.2|CNS0G75D Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 557 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 498



to top

>emb|CR705192.2|CNS0G72S Tetraodon nigroviridis full-length cDNA
          Length = 642

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 560 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 501



to top

>emb|CR704641.2|CNS0G6NH Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 557 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 498



to top

>emb|CR701253.2|CNS0G41D Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR700146.2|CNS0G36M Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 563 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 504



to top

>emb|CR696223.2|CNS0G05N Tetraodon nigroviridis full-length cDNA
          Length = 644

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 562 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 503



to top

>emb|CR695482.2|CNS0FZL2 Tetraodon nigroviridis full-length cDNA
          Length = 477

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 395 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 336



to top

>emb|CR694940.2|CNS0FZ60 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR694036.2|CNS0FYGW Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR692628.2|CNS0FXDS Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 535 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 476



to top

>emb|CR690516.2|CNS0FVR4 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR688214.2|CNS0FTZ6 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR687256.2|CNS0FT8K Tetraodon nigroviridis full-length cDNA
          Length = 642

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 560 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 501



to top

>emb|CR686542.2|CNS0FSOQ Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR679416.2|CNS0FN6S Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 557 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 498



to top

>emb|CR677668.2|CNS0FLUL Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 535 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 476



to top

>emb|CR676604.2|CNS0FL14 Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR674481.2|CNS0FJEF Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR672842.2|CNS0FI4W Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 535 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 476



to top

>emb|CR672907.2|CNS0FI6P Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR668215.2|CNS0FEKD Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 535 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 476



to top

>emb|CR667583.2|CNS0FE2T Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 564 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 505



to top

>emb|CR666251.2|CNS0FD1T Tetraodon nigroviridis full-length cDNA
          Length = 659

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 577 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 518



to top

>emb|CR665491.2|CNS0FCGP Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 564 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 505



to top

>emb|CR663494.2|CNS0FAX8 Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 564 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 505



to top

>emb|CR662279.2|CNS0F9ZH Tetraodon nigroviridis full-length cDNA
          Length = 618

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 536 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 477



to top

>emb|CR661654.2|CNS0F9I4 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR660863.2|CNS0F8W5 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR660093.2|CNS0F8AR Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 557 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 498



to top

>emb|CR650864.2|CNS0F16E Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 563 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 504



to top

>emb|CR650032.2|CNS0F0JA Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 564 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 505



to top

>emb|CR650013.2|CNS0F0IR Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 557 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 498



to top

>emb|CR647600.2|CNS0EYNQ Tetraodon nigroviridis full-length cDNA
          Length = 638

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 556 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 497



to top

>emb|CR646130.2|CNS0EXIW Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 557 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 498



to top

>emb|CR642444.2|CNS0EUOI Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 563 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 504



to top

>emb|CR642257.2|CNS0EUJB Tetraodon nigroviridis full-length cDNA
          Length = 645

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 563 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 504



to top

>emb|CR640900.2|CNS0ETHM Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 499



to top

>emb|CR635790.2|CNS0EPJO Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 559 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR722630.2|CNS0GKJ0 Tetraodon nigroviridis full-length cDNA
          Length = 622

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                         
Query: 186 caaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 521 caaacttcctgcccttggagcgcacatagggcttggtgtggctgtg 476



to top

>emb|CR734138.2|CNS0GT8P Tetraodon nigroviridis full-length cDNA
          Length = 641

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Minus

                                                            
Query: 183 tctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           ||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 548 tctcaaacttcctgcccttggagcggacatagggcttggtgtggctgtg 500



to top

>emb|CR710189.2|CNS0GAXL Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||| ||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttgatgtggctgtg 499



to top

>emb|CR707928.2|CNS0G96S Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||||| ||||||||||||
Sbjct: 535 accacgggccctctcaaacttcctgcccttggagcggacatagggctcggtgtggctgtg 476



to top

>emb|CR704690.2|CNS0G6OU Tetraodon nigroviridis full-length cDNA
          Length = 617

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggc 227
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 535 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggc 480



to top

>emb|CR659514.2|CNS0F7UO Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||||||||||| |||||||| ||||||||||||||
Sbjct: 564 accacgggccctctcaaacttcctgcccttggagcggacatagggtttggtgtggctgtg 505



to top

>emb|CR643404.2|CNS0EVF6 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggc 227
           |||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 558 accacgggccctctcaaacttcctgcccttggagcggacatagggcttggtgtggc 503



to top

>emb|CR634249.2|CNS0EOCV Tetraodon nigroviridis full-length cDNA
          Length = 639

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| ||||||||||||| ||| ||||||| |||||||||||||||||||||||
Sbjct: 557 accacgggccctctcaaacttcctgcccctggagcggacatagggcttggtgtggctgtg 498



to top

>ref|NM_111432.2| Arabidopsis thaliana RPL18 (RIBOSOMAL PROTEIN L18); structural
           constituent of ribosome AT3G05590 (RPL18) mRNA, complete
           cds
          Length = 834

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 141 cttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccct 200
           ||||||||||||| ||||| || |||||| | || |  |||||||| |||||||| ||||
Sbjct: 596 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 537

                                                         
Query: 201 tggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
           |||  || ||||| ||||||| ||| ||||| ||||||||||||||
Sbjct: 536 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 491



to top

>gb|AC011620.8|ATAC011620 Arabidopsis thaliana chromosome III BAC F18C1 genomic sequence,
             complete sequence
          Length = 100887

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                         
Query: 141   cttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccct 200
             ||||||||||||| ||||| || |||||| | || |  |||||||| |||||||| ||||
Sbjct: 84357 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 84416

                                                           
Query: 201   tggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
             |||  || ||||| ||||||| ||| ||||| ||||||||||||||
Sbjct: 84417 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 84462



to top

>gb|AY037224.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, complete cds
          Length = 794

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 141 cttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccct 200
           ||||||||||||| ||||| || |||||| | || |  |||||||| |||||||| ||||
Sbjct: 596 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 537

                                                         
Query: 201 tggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
           |||  || ||||| ||||||| ||| ||||| ||||||||||||||
Sbjct: 536 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 491



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                            
Query: 323      cggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgccctc 382
                |||||||| |||||||| || ||||||||||| ||||| |||||||  |||| ||| |||
Sbjct: 28484735 cggagagcgagctggtcgaacgtgaggcactcgccaccggcattgatgatccgtgctctc 28484676

                                                                            
Query: 383      gctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatccgcatg 442
                || ||||| |||||||| ||||| |  |||||||| || || | ||| | ||||| | ||
Sbjct: 28484675 gcggtctcggtgaacctgagagcagccaccttcatcgccggcacctcatagatcctcttg 28484616

                          
Query: 443      tcatctgtga 452
                ||||||||||
Sbjct: 28484615 tcatctgtga 28484606



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                            
Query: 138      caacttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctac 197
                ||||||| |||||||||||   ||||||||| || || |  ||||||||||| ||||| |
Sbjct: 28486299 caacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttccttc 28486240

                                                  
Query: 198      ccttggagcgcacatagggcttggtgtggctgtg 231
                |||| ||||| ||||| ||||| |||| ||||||
Sbjct: 28486239 cctttgagcgaacatatggcttagtgttgctgtg 28486206



to top

>emb|BX823193.1|CNS0A5VT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB9ZC10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 575

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 141 cttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccct 200
           ||||||||||||| ||||| || |||||| | || |  |||||||| |||||||| ||||
Sbjct: 345 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 286

                                                         
Query: 201 tggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
           |||  || ||||| ||||||| ||| ||||| ||||||||||||||
Sbjct: 285 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 240



to top

>emb|BX822829.1|CNS0A4S7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB67ZC09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 714

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 141 cttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccct 200
           ||||||||||||| ||||| || |||||| | || |  |||||||| |||||||| ||||
Sbjct: 587 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 528

                                                         
Query: 201 tggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
           |||  || ||||| ||||||| ||| ||||| ||||||||||||||
Sbjct: 527 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 482



to top

>dbj|AP006268.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0037D09
          Length = 140470

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                         
Query: 323   cggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgccctc 382
             |||||||| |||||||| || ||||||||||| ||||| |||||||  |||| ||| |||
Sbjct: 50487 cggagagcgagctggtcgaacgtgaggcactcgccaccggcattgatgatccgtgctctc 50428

                                                                         
Query: 383   gctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatccgcatg 442
             || ||||| |||||||| ||||| |  |||||||| || || | ||| | ||||| | ||
Sbjct: 50427 gcggtctcggtgaacctgagagcagccaccttcatcgccggcacctcatagatcctcttg 50368

                       
Query: 443   tcatctgtga 452
             ||||||||||
Sbjct: 50367 tcatctgtga 50358



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                         
Query: 138   caacttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctac 197
             ||||||| |||||||||||   ||||||||| || || |  ||||||||||| ||||| |
Sbjct: 52051 caacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttccttc 51992

                                               
Query: 198   ccttggagcgcacatagggcttggtgtggctgtg 231
             |||| ||||| ||||| ||||| |||| ||||||
Sbjct: 51991 cctttgagcgaacatatggcttagtgttgctgtg 51958



to top

>dbj|AP004343.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0618H09
          Length = 142306

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                         
Query: 323   cggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgccctc 382
             |||||||| |||||||| || ||||||||||| ||||| |||||||  |||| ||| |||
Sbjct: 42276 cggagagcgagctggtcgaacgtgaggcactcgccaccggcattgatgatccgtgctctc 42217

                                                                         
Query: 383   gctgtctctgtgaacctcagagcggtaaccttcattgctgggatctcttggatccgcatg 442
             || ||||| |||||||| ||||| |  |||||||| || || | ||| | ||||| | ||
Sbjct: 42216 gcggtctcggtgaacctgagagcagccaccttcatcgccggcacctcatagatcctcttg 42157

                       
Query: 443   tcatctgtga 452
             ||||||||||
Sbjct: 42156 tcatctgtga 42147



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                         
Query: 138   caacttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctac 197
             ||||||| |||||||||||   ||||||||| || || |  ||||||||||| ||||| |
Sbjct: 43840 caacttataccttgaagcccttgctgttccttcttcctcttgccttctcaaatttccttc 43781

                                               
Query: 198   ccttggagcgcacatagggcttggtgtggctgtg 231
             |||| ||||| ||||| ||||| |||| ||||||
Sbjct: 43780 cctttgagcgaacatatggcttagtgttgctgtg 43747



to top

>gb|U15741.1|ATU15741 Arabidopsis thaliana cytoplasmic ribosomal protein L18 mRNA,
           complete cds
          Length = 778

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                       
Query: 141 cttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccct 200
           ||||||||||||| ||||| || |||||| | || |  |||||||| |||||||| ||||
Sbjct: 591 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 532

                                                         
Query: 201 tggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
           |||  || ||||| ||||||| ||| ||||| ||||||||||||||
Sbjct: 531 tggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 486



to top

>gb|AY060533.1| Arabidopsis thaliana AT3g05590/F18C1_14 mRNA, complete cds
          Length = 564

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 88/105 (83%)
 Strand = Plus / Minus

                                                                       
Query: 142 ttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccctt 201
           |||||||||||| ||||| || |||||| | || |  |||||||| |||||||| |||||
Sbjct: 564 ttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccctt 505

                                                        
Query: 202 ggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
           ||  || ||||| ||||||| ||| ||||| ||||||||||||||
Sbjct: 504 ggcccgaacatatggcttggagtgactgtgtggcacaccaggagc 460



to top

>gb|AY190744.1| Pagrus major ribosomal protein L18 mRNA, partial cds
          Length = 674

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||| |||| |||||||| ||||||||||| |  ||||||||||||||||||||
Sbjct: 538 accacgagccctctcgaacttcctgcccttggagcggatgtagggcttggtgtggctgtg 479



to top

>gb|BC076332.1| Danio rerio zgc:92872, mRNA (cDNA clone MGC:92872 IMAGE:7117835),
           complete cds
          Length = 655

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 552 aacttcctgcctttggagcgcacatagggcttggtgtggctgtg 509



to top

>gb|AY389931.1| Latimeria chalumnae ribosomal protein L18-like mRNA, partial
           sequence
          Length = 497

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||||||||||||||||||||| ||||||||
Sbjct: 493 ctcaaacttccgtcccttggagcgcacatagggcttggtatggctgtg 446



to top

>ref|NM_001003432.1| Danio rerio zgc:92872 (zgc:92872), mRNA
          Length = 655

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 552 aacttcctgcctttggagcgcacatagggcttggtgtggctgtg 509



to top

>emb|AJ306691.1|SSA306691 Salmo salar partial mRNA for L18 ribosomal protein (l18 gene)
          Length = 541

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||| ||||||||||| || ||||||||||||||||||||
Sbjct: 504 ctcaaacttcctgcccttggagcgaacgtagggcttggtgtggctgtg 457



to top

>gb|AF240375.1|AF240375 Oreochromis niloticus clone tiL18b ribosomal protein L18 mRNA,
           complete cds
          Length = 649

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 183 tctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccag 242
           |||| |||||||| ||||||||||| || |||||||||||||||||||| ||    ||||
Sbjct: 549 tctcgaacttcctgcccttggagcggacgtagggcttggtgtggctgtgaggggttccag 490

                              
Query: 243 gagccttgccgaagtgcct 261
           ||||||| || ||||||||
Sbjct: 489 gagcctttccaaagtgcct 471



to top

>gb|AF240374.1|AF240374 Oreochromis niloticus clone tiL18a ribosomal protein L18 mRNA,
           complete cds
          Length = 649

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 183 tctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccag 242
           |||| |||||||| ||||||||||| || |||||||||||||||||||| ||    ||||
Sbjct: 549 tctcgaacttcctgcccttggagcggacgtagggcttggtgtggctgtgaggggttccag 490

                              
Query: 243 gagccttgccgaagtgcct 261
           ||||||| || ||||||||
Sbjct: 489 gagcctttccaaagtgcct 471



to top

>gb|AY389963.1| Gallus gallus ribosomal protein L18 mRNA, partial cds
          Length = 499

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagcc 247
           |||||||  |||||||||||||| |||||||||||||||||||| |||   || || |||
Sbjct: 483 aacttccggcccttggagcgcacgtagggcttggtgtggctgtggggcgttccgggcgcc 424

                        
Query: 248 ttgccgaagtgcc 260
           || ||||||||||
Sbjct: 423 ttcccgaagtgcc 411



to top

>emb|BX933065.2| Gallus gallus finished cDNA, clone ChEST914g7
          Length = 665

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagcc 247
           |||||||  |||||||||||||| |||||||||||||||||||| |||   || || |||
Sbjct: 528 aacttccggcccttggagcgcacgtagggcttggtgtggctgtggggcgttccgggcgcc 469

                        
Query: 248 ttgccgaagtgcc 260
           || ||||||||||
Sbjct: 468 ttcccgaagtgcc 456



to top

>emb|BX932992.2| Gallus gallus finished cDNA, clone ChEST1005i18
          Length = 755

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagcc 247
           |||||||  |||||||||||||| |||||||||||||||||||| |||   || || |||
Sbjct: 617 aacttccggcccttggagcgcacgtagggcttggtgtggctgtggggcgttccgggcgcc 558

                        
Query: 248 ttgccgaagtgcc 260
           || ||||||||||
Sbjct: 557 ttcccgaagtgcc 545



to top

>emb|AJ004961.1|CAA004961 Cicer arietinum mRNA for cytoplasmic ribosomal protein L18
          Length = 714

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 178 agccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcac 237
           |||||||||||| ||||| ||||| || |  ||||| |||||||| |||||||| |||||
Sbjct: 517 agccttctcaaatttccttccctttgacctaacataaggcttggtatggctgtgtggcac 458

                    
Query: 238 accaggagc 246
           |||||||||
Sbjct: 457 accaggagc 449



to top

>ref|XM_512797.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18; 60S
           ribosomal protein L18 (LOC456183), mRNA
          Length = 665

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| |||||||| |||||||||||||||||
Sbjct: 558 aacttccggcccttggagcggacatagggtttggtgtggctgtgcgg 512



to top

>gb|DQ213610.1| Taeniopygia guttata clone 0058P0027B10 ribosomal protein L18-like
           mRNA, complete sequence
          Length = 804

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 197 cccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||||| ||||||||||||||||||||
Sbjct: 677 cccttggagcgcacgtagggcttggtgtggctgtg 643



to top

>dbj|AK110540.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-168-B02, full
           insert sequence
          Length = 1006

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 332 agctggtcaaaagtgaggcactccccaccagcattgacaatccttgccctcgctgtctct 391
           ||||||||||| ||||||||||| |||||||| |||||||| | ||| |  || ||||| 
Sbjct: 419 agctggtcaaaggtgaggcactcaccaccagccttgacaatgcgtgcacgggcggtctca 360

                      
Query: 392 gtgaacctcag 402
           |||||||||||
Sbjct: 359 gtgaacctcag 349



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Minus

                                                                       
Query: 147 ccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctacccttggagc 206
           ||||| |||| ||||| || || | |||||| |||||||| ||||| |  ||||| |  |
Sbjct: 604 ccttgtagccgcggctctttctgcgaccacgtgccttctcgaacttgcggccctttgcac 545

                                             
Query: 207 gcacatagggcttggtgtggctgtgcggcacacc 240
           |||||||||||||||||  |||||| ||||||||
Sbjct: 544 gcacatagggcttggtgctgctgtggggcacacc 511



to top

>gb|AY610456.1| Sus scrofa clone rmed27c_g16.y1.abd, mRNA sequence
          Length = 599

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| |||||||| |||||||||||||||||
Sbjct: 550 aacttccggcccttggagcgaacatagggtttggtgtggctgtgcgg 504



to top

>emb|BX822675.1|CNS0A7MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB57ZH02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 722

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 87/106 (82%)
 Strand = Plus / Minus

                                                                       
Query: 141 cttaaaccttgaagccacggctgttcctcctaccacgagccttctcaaacttcctaccct 200
           ||||||||||||| ||||| || |||||| | || |  |||||||| |||||||| ||||
Sbjct: 563 cttaaaccttgaatccacgactcttcctctttcctctggccttctcgaacttccttccct 504

                                                         
Query: 201 tggagcgcacatagggcttggtgtggctgtgcggcacaccaggagc 246
           |||  || ||||| ||||||| ||  ||||  ||||||||||||||
Sbjct: 503 tggcccgaacatatggcttggagttactgtatggcacaccaggagc 458



to top

>gb|BT013100.1| Lycopersicon esculentum clone 114386R, mRNA sequence
          Length = 839

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccagg 243
           |||||||||||| ||||| | ||| ||||| ||||| ||||||||||| || ||||||||
Sbjct: 579 ctcaaacttccttccctttgcgcgaacataaggctttgtgtggctgtgtgggacaccagg 520



to top

>ref|NM_130325.1| Arabidopsis thaliana structural constituent of ribosome AT2G47570
           mRNA, complete cds
          Length = 408

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 127/158 (80%), Gaps = 3/158 (1%)
 Strand = Plus / Minus

                                                                       
Query: 209 acatagggcttggtgtggctgtgcggcacaccaggagccttgccgaagtgcctcaccgcc 268
           ||||| || |||||||||||||| ||||||||||||||    || |||||| |||| || 
Sbjct: 341 acatacggtttggtgtggctgtgaggcacaccaggagctggtccaaagtgcttcactgct 282

                                                                       
Query: 269 tcacgggcattcttgggtcccctcaacaggatcgtgttctc--cccagttggagcacgg- 325
           ||||| |  ||||| || || || | ||| | |||||||||   |||  ||| |||||| 
Sbjct: 281 tcacgtgtgttcttaggacctctaagcagaaccgtgttctctgaccaagtggggcacgga 222

                                                 
Query: 326 agagcaagctggtcaaaagtgaggcactccccaccagc 363
           ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 221 agagcgagctgatcaaaagtgaggcactctccaccagc 184



to top

>ref|NM_000979.2| Homo sapiens ribosomal protein L18 (RPL18), mRNA
          Length = 648

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 554 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 508



to top

>gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 4, complete
              sequence
          Length = 1783081

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                     
Query: 311    ccagttggagcacggagagcaagctggtcaaaagtgagg 349
              ||||| || |||||||||||||||||||||| |||||||
Sbjct: 936478 ccagtaggggcacggagagcaagctggtcaagagtgagg 936516



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 167    ctcctaccacgagccttctcaaacttcctacccttg 202
              ||||||||||| ||| |||| |||||||| ||||||
Sbjct: 936346 ctcctaccacgggccatctcgaacttcctgcccttg 936381



to top

>gb|BC000374.2| Homo sapiens ribosomal protein L18, mRNA (cDNA clone MGC:8373
           IMAGE:2820119), complete cds
          Length = 648

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 528 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 482



to top

>gb|BC082960.1| Xenopus tropicalis ribosomal protein L18, mRNA (cDNA clone
           MGC:89878 IMAGE:7029272), complete cds
          Length = 789

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccagg 243
           ||||||||| |||||||||||  ||||||| ||||| ||||| ||||| ||   ||||||
Sbjct: 609 ctcaaactttctacccttggaaagcacataaggcttagtgtgactgtgtggagtaccagg 550

                          
Query: 244 agccttgccgaagtg 258
            |||||||| |||||
Sbjct: 549 tgccttgccaaagtg 535



to top

>ref|XM_570671.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CND03460) partial mRNA
          Length = 723

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 311 ccagttggagcacggagagcaagctggtcaaaagtgagg 349
           ||||| || |||||||||||||||||||||| |||||||
Sbjct: 422 ccagtaggggcacggagagcaagctggtcaagagtgagg 384



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 167 ctcctaccacgagccttctcaaacttcctacccttg 202
           ||||||||||| ||| |||| |||||||| ||||||
Sbjct: 554 ctcctaccacgggccatctcgaacttcctgcccttg 519



to top

>ref|XM_570672.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CND03460) partial mRNA
          Length = 766

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 311 ccagttggagcacggagagcaagctggtcaaaagtgagg 349
           ||||| || |||||||||||||||||||||| |||||||
Sbjct: 465 ccagtaggggcacggagagcaagctggtcaagagtgagg 427



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 167 ctcctaccacgagccttctcaaacttcctacccttg 202
           ||||||||||| ||| |||| |||||||| ||||||
Sbjct: 597 ctcctaccacgggccatctcgaacttcctgcccttg 562



to top

>gb|DQ489378.1| Homo sapiens heat shock 70kDa protein 2 (HSPA2) gene, complete cds
          Length = 11093

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 188  aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
            |||||||  ||||||||||  |||||||| |||||||||||||||||
Sbjct: 1546 aacttccagcccttggagcagacatagggtttggtgtggctgtgcgg 1592



to top

>gb|BC051359.1| Homo sapiens cDNA clone IMAGE:6646239, **** WARNING: chimeric clone
            ****
          Length = 1234

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 188  aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
            |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 1130 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 1084



to top

>ref|NM_001011030.1| Xenopus tropicalis ribosomal protein L18 (rpl18), mRNA
          Length = 789

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccagg 243
           ||||||||| |||||||||||  ||||||| ||||| ||||| ||||| ||   ||||||
Sbjct: 609 ctcaaactttctacccttggaaagcacataaggcttagtgtgactgtgtggagtaccagg 550

                          
Query: 244 agccttgccgaagtg 258
            |||||||| |||||
Sbjct: 549 tgccttgccaaagtg 535



to top

>gb|BC021743.2| Homo sapiens ribosomal protein L18, mRNA (cDNA clone MGC:33859
           IMAGE:5261251), complete cds
          Length = 665

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 554 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 508



to top

>emb|CR626510.1| full-length cDNA clone CS0DK008YC06 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 639

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 552 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 506



to top

>emb|CR623252.1| full-length cDNA clone CS0DI028YB06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 611

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 524 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 478



to top

>emb|CR622915.1| full-length cDNA clone CS0DI003YD02 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1606

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 188  aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
            |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 1555 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 1509



to top

>emb|CR614681.1| full-length cDNA clone CS0DD008YG13 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 604

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 519 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 473



to top

>emb|CR609223.1| full-length cDNA clone CS0DM004YL12 of Fetal liver of Homo sapiens
           (human)
          Length = 611

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 524 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 478



to top

>emb|CR608718.1| full-length cDNA clone CS0DM014YN06 of Fetal liver of Homo sapiens
           (human)
          Length = 606

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 524 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 478



to top

>emb|CR602585.1| full-length cDNA clone CS0DD002YH22 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 611

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 524 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 478



to top

>emb|CR601070.1| full-length cDNA clone CS0DC010YK01 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 628

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 541 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 495



to top

>emb|CR600364.1| full-length cDNA clone CS0DI084YG06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 612

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 525 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 479



to top

>emb|CR600341.1| full-length cDNA clone CS0DJ007YF01 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 628

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 541 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 495



to top

>emb|CR598496.1| full-length cDNA clone CS0DF016YB08 of Fetal brain of Homo sapiens
           (human)
          Length = 687

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 552 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 506



to top

>emb|CR597869.1| full-length cDNA clone CS0DI006YF05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 628

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 541 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 495



to top

>emb|CR591878.1| full-length cDNA clone CS0DB002YN19 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 631

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 541 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 495



to top

>emb|CR591552.1| full-length cDNA clone CS0DL006YH09 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 639

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 552 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 506



to top

>emb|CR590122.1| full-length cDNA clone CS0DI081YM04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 637

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 552 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 506



to top

>gb|AY205233.1| Medicago sativa 60S ribosomal protein mRNA, partial cds
          Length = 544

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                       
Query: 326 agagcaagctggtcaaaagtgaggcactccccaccagcattgacaatccttgccctcgct 385
           ||||| ||||| ||||| |||||||||||||||||||| ||  |||| || ||||| || 
Sbjct: 431 agagccagctgatcaaaggtgaggcactccccaccagccttctcaattctagccctggcc 372

                                              
Query: 386 gtctctgtgaacctcagagcggtaaccttcattgc 420
            | || |||||||| ||||| || ||||| |||||
Sbjct: 371 ttttcggtgaaccttagagcagttaccttaattgc 337



to top

>gb|AY130454.1| Branchiostoma lanceolatum ribosomal protein L18 mRNA, partial cds
          Length = 567

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Minus

                                                                       
Query: 172 accacgagccttctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||| ||| |||| ||||| |  |||||||| |||||| | || ||||| ||||||||
Sbjct: 537 accacgtgccctctcgaacttgcggcccttggatcgcacaaatggtttggtatggctgtg 478

                          
Query: 232 cggcacaccaggagc 246
            ||||||||||||||
Sbjct: 477 aggcacaccaggagc 463



to top

>emb|AJ563457.1|CGI563457 Crassostrea gigas partial mRNA for ribosomal protein L18 (rpl18
           gene)
          Length = 573

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 180 ccttctcaaacttcctacccttggagcgcac 210
           |||||||||||||||| ||||||||||||||
Sbjct: 535 ccttctcaaacttccttcccttggagcgcac 505



to top

>dbj|AK026558.1| Homo sapiens cDNA: FLJ22905 fis, clone KAT05654, highly similar to
           HUMRPL18A Homo sapiens ribosomal protein L18 (RPL18)
           mRNA
          Length = 656

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 554 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 508



to top

>gb|BC009708.2| Homo sapiens ribosomal protein L18, mRNA (cDNA clone MGC:9403
           IMAGE:3878799), complete cds
          Length = 648

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 542 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 496



to top

>emb|CR760488.2| Xenopus tropicalis finished cDNA, clone TNeu129c17
          Length = 649

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Minus

                                                                       
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccagg 243
           ||||||||| |||||||||||  ||||||| ||||| ||||| ||||| ||   ||||||
Sbjct: 547 ctcaaactttctacccttggaaagcacataaggcttagtgtgactgtgtggagtaccagg 488

                          
Query: 244 agccttgccgaagtg 258
            |||||||| |||||
Sbjct: 487 tgccttgccaaagtg 473



to top

>emb|AL049869.6|CNS0000P Human chromosome 14 DNA sequence BAC R-973N13 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 195840

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 188    aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
              |||||||  ||||||||||  |||||||| |||||||||||||||||
Sbjct: 144138 aacttccagcccttggagcagacatagggtttggtgtggctgtgcgg 144092



to top

>gb|L11566.1|HUMRPL18A Homo sapiens ribosomal protein L18 (RPL18) mRNA, complete cds
          Length = 630

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| |||||||||||||||||
Sbjct: 536 aacttccggcccttggagcggacgtagggtttggtgtggctgtgcgg 490



to top

>ref|NM_122667.2| Arabidopsis thaliana structural constituent of ribosome AT5G27850
           mRNA, complete cds
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 tggagcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatcct 375
           |||||| | |||||||||||||||||| || | |||||| |||||||| ||  |||| ||
Sbjct: 403 tggagctctgagagcaagctggtcaaaggttaagcactctccaccagctttctcaattct 344

                                                     
Query: 376 tgccctcgctgtctctgtgaacctcagagcggtaaccttcat 417
            ||||| ||  |||| || |||||||  || |||||||||||
Sbjct: 343 agccctagccctctcagtaaacctcaaggcagtaaccttcat 302



to top

>gb|AF481060.1| Aplysia californica 60S ribosomal protein L18 mRNA, complete cds
          Length = 363

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 317 ggagcacggagagcaagctggtcaaa 342
           ||||||||||||||||||||||||||
Sbjct: 188 ggagcacggagagcaagctggtcaaa 163



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 221 gtgtggctgtgcggcacaccaggagcc 247
           ||||||||||| |||||||||||||||
Sbjct: 284 gtgtggctgtgaggcacaccaggagcc 258



to top

>emb|CR712898.2|CNS0GD0U Tetraodon nigroviridis full-length cDNA
          Length = 1093

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 172  accacgagccttctcaaacttcctacccttggagcgcacatagggc 217
            |||||| ||| ||||||||||||| |||||||| || |||||||||
Sbjct: 1012 accacgggccctctcaaacttcctgcccttggaacggacatagggc 1057



to top

>gb|BT000711.1| Arabidopsis thaliana clone RAFL09-17-C05 (R09425) putative 60S
           ribosomal protein (At5g27850) mRNA, complete cds
          Length = 775

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 tggagcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatcct 375
           |||||| | |||||||||||||||||| || | |||||| |||||||| ||  |||| ||
Sbjct: 402 tggagctctgagagcaagctggtcaaaggttaagcactctccaccagctttctcaattct 343

                                                     
Query: 376 tgccctcgctgtctctgtgaacctcagagcggtaaccttcat 417
            ||||| ||  |||| || |||||||  || |||||||||||
Sbjct: 342 agccctagccctctcagtaaacctcaaggcagtaaccttcat 301



to top

>gb|AY122996.1| Arabidopsis thaliana putative 60S ribosomal protein (At5g27850)
           mRNA, complete cds
          Length = 595

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 tggagcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatcct 375
           |||||| | |||||||||||||||||| || | |||||| |||||||| ||  |||| ||
Sbjct: 390 tggagctctgagagcaagctggtcaaaggttaagcactctccaccagctttctcaattct 331

                                                     
Query: 376 tgccctcgctgtctctgtgaacctcagagcggtaaccttcat 417
            ||||| ||  |||| || |||||||  || |||||||||||
Sbjct: 330 agccctagccctctcagtaaacctcaaggcagtaaccttcat 289



to top

>gb|AY056141.1| Arabidopsis thaliana putative 60S ribosomal protein (At5g27850)
           mRNA, complete cds
          Length = 893

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 tggagcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatcct 375
           |||||| | |||||||||||||||||| || | |||||| |||||||| ||  |||| ||
Sbjct: 402 tggagctctgagagcaagctggtcaaaggttaagcactctccaccagctttctcaattct 343

                                                     
Query: 376 tgccctcgctgtctctgtgaacctcagagcggtaaccttcat 417
            ||||| ||  |||| || |||||||  || |||||||||||
Sbjct: 342 agccctagccctctcagtaaacctcaaggcagtaaccttcat 301



to top

>gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete
             sequence
          Length = 98937

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 209   acatagggcttggtgtggctgtgcggcacaccaggagc 246
             ||||| || |||||||||||||| ||||||||||||||
Sbjct: 32675 acatacggtttggtgtggctgtgaggcacaccaggagc 32638



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 326   agagcaagctggtcaaaagtgaggcactccccaccagc 363
             ||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 32246 agagcgagctgatcaaaagtgaggcactctccaccagc 32209



to top

>emb|BX832577.1|CNS0A1WZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH81ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 644

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                       
Query: 316 tggagcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatcct 375
           |||||| | |||||||||||||||||| || | |||||| |||||||| ||  |||| ||
Sbjct: 239 tggagctctgagagcaagctggtcaaaggttaagcactctccaccagctttctcaattct 180

                                                     
Query: 376 tgccctcgctgtctctgtgaacctcagagcggtaaccttcat 417
            ||||| ||  |||| || |||||||  || |||||||||||
Sbjct: 179 agccctagccctctcagtaaacctcaaggcagtaaccttcat 138



to top

>gb|AC007399.1|AC007399 Arabidopsis thaliana BAC F14I23 from chromosome V near 69 cM,
            complete sequence
          Length = 105223

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                        
Query: 316  tggagcacggagagcaagctggtcaaaagtgaggcactccccaccagcattgacaatcct 375
            |||||| | |||||||||||||||||| || | |||||| |||||||| ||  |||| ||
Sbjct: 3569 tggagctctgagagcaagctggtcaaaggttaagcactctccaccagctttctcaattct 3510

                                                      
Query: 376  tgccctcgctgtctctgtgaacctcagagcggtaaccttcat 417
             ||||| ||  |||| || |||||||  || |||||||||||
Sbjct: 3509 agccctagccctctcagtaaacctcaaggcagtaaccttcat 3468



to top

>gb|AC022748.10| Homo sapiens chromosome 15, clone RP11-160C18, complete sequence
          Length = 163642

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                          
Query: 188    aacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagcc 247
              |||||||  ||||||||||| || ||||  ||||||||||||||||||   || || |||
Sbjct: 155695 aacttccggcccttggagcggacgtaggctttggtgtggctgtgcggcgttcctggggcc 155636

                           
Query: 248    ttgccgaagtgcc 260
              |||||||| ||||
Sbjct: 155635 ttgccgaaatgcc 155623



to top

>gb|AC067863.19| Homo sapiens chromosome 15, clone RP11-335K5, complete sequence
          Length = 111700

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/73 (83%)
 Strand = Plus / Plus

                                                                          
Query: 188    aacttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagcc 247
              |||||||  ||||||||||| || ||||  ||||||||||||||||||   || || |||
Sbjct: 102275 aacttccggcccttggagcggacgtaggctttggtgtggctgtgcggcgttcctggggcc 102334

                           
Query: 248    ttgccgaagtgcc 260
              |||||||| ||||
Sbjct: 102335 ttgccgaaatgcc 102347



to top

>gb|BC106288.1| Xenopus laevis hypothetical protein MGC64299, mRNA (cDNA clone
           MGC:130777 IMAGE:7765587), complete cds
          Length = 664

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 184 ctcaaacttcctacccttggagcgcacatagggctt 219
           ||||||||| |||||||||||| ||||||| |||||
Sbjct: 549 ctcaaactttctacccttggagagcacataaggctt 514



to top

>ref|XM_527867.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18; 60S
           ribosomal protein L18 (LOC472492), mRNA
          Length = 789

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||  ||||||||||| || ||||| ||||||||||||||
Sbjct: 743 aacttccggcccttggagcggacgtagggtttggtgtggctgtg 700



to top

>gb|BC084727.1| Rattus norvegicus ribosomal protein L18, mRNA (cDNA clone
           MGC:105408 IMAGE:7308070), complete cds
          Length = 640

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||  |||||||| || |||||||| ||||||||||||||
Sbjct: 528 aacttccggcccttggaacggacatagggtttggtgtggctgtg 485



to top

>gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosome 6, complete sequence
          Length = 211910

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                             
Query: 184   ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
             |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 94878 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 94831



to top

>gb|BC072558.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone IMAGE:5685697),
            partial cds
          Length = 3034

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 184  ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
            |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 2900 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 2853



to top

>ref|NM_009077.2| Mus musculus ribosomal protein L18 (Rpl18), mRNA
          Length = 708

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 591 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 544



to top

>gb|BC053773.1| Xenopus laevis hypothetical protein MGC64299, mRNA (cDNA clone
           MGC:64299 IMAGE:6875152), complete cds
          Length = 682

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 184 ctcaaacttcctacccttggagcgcacatagggctt 219
           ||||||||| |||||||||||| ||||||| |||||
Sbjct: 567 ctcaaactttctacccttggagagcacataaggctt 532



to top

>ref|XM_001002512.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L18
           (LOC672898), mRNA
          Length = 945

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 861 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 814



to top

>gb|AC074085.7| Homo sapiens BAC clone RP11-3L10 from 7, complete sequence
          Length = 155260

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 188   aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
             |||||||  ||||||||||| || ||||| ||||||||||||||
Sbjct: 43631 aacttccggcccttggagcggacgtagggtttggtgtggctgtg 43674



to top

>emb|AL591143.11| Mouse DNA sequence from clone RP23-210L24 on chromosome 11 Contains the
             5' end of the Abr gene for active BCR-related protein, a
             ribosomal protein L18 (Rpl18) pseudogene, a ribosomal
             protein L36 (Rpl36) pseudogene and four CpG islands,
             complete sequence
          Length = 212940

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                             
Query: 184   ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
             |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 70368 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 70321



to top

>dbj|AK149813.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:G530019P09 product:procollagen-lysine,
            2-oxoglutarate 5-dioxygenase 1, full insert sequence
          Length = 3565

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 184  ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
            |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 3485 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 3438



to top

>dbj|AK151667.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830033B22 product:ribosomal
           protein L18, full insert sequence
          Length = 641

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 561 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 514



to top

>dbj|AK145649.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0026A12 product:ribosomal protein L18,
           full insert sequence
          Length = 675

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 592 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 545



to top

>dbj|AK166803.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0014M02 product:ribosomal protein L18,
           full insert sequence
          Length = 638

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 561 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 514



to top

>ref|XM_374646.3| PREDICTED: Homo sapiens similar to ribosomal protein L18
           (LOC392979), mRNA
          Length = 501

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||  ||||||||||| || ||||| ||||||||||||||
Sbjct: 455 aacttccggcccttggagcggacgtagggtttggtgtggctgtg 412



to top

>ref|XM_937605.1| PREDICTED: Homo sapiens similar to ribosomal protein L18
           (LOC392979), mRNA
          Length = 501

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||  ||||||||||| || ||||| ||||||||||||||
Sbjct: 455 aacttccggcccttggagcggacgtagggtttggtgtggctgtg 412



to top

>ref|XM_069734.4| PREDICTED: Homo sapiens similar to ribosomal protein L18
           (LOC136143), mRNA
          Length = 480

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||  ||||||||||| || ||||| ||||||||||||||
Sbjct: 434 aacttccggcccttggagcggacgtagggtttggtgtggctgtg 391



to top

>dbj|AK153172.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830126C06 product:ribosomal
           protein L18, full insert sequence
          Length = 636

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 559 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 512



to top

>dbj|AK169659.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430004N22
           product:ribosomal protein L18, full insert sequence
          Length = 640

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 559 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 512



to top

>dbj|AK168288.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730080N03 product:ribosomal protein L18, full
           insert sequence
          Length = 642

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 559 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 512



to top

>dbj|AB169565.1| Macaca fascicularis brain cDNA, clone: QflA-13958, similar to human
           ribosomal protein L18 (RPL18), mRNA, RefSeq: NM_000979.2
          Length = 664

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||  ||||||||||| || ||||| ||||||||||||||
Sbjct: 559 aacttccggcccttggagcggacgtagggtttggtgtggctgtg 516



to top

>dbj|AK010510.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410015P13 product:ribosomal protein L18, full
           insert sequence
          Length = 642

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 559 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 512



to top

>dbj|AK009044.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2300008F05 product:ribosomal protein L18,
           full insert sequence
          Length = 642

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 562 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 515



to top

>dbj|AK012580.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700088D17 product:ribosomal
           protein L18, full insert sequence
          Length = 636

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 559 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 512



to top

>dbj|AK007263.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700124C09 product:ribosomal protein L18,
           full insert sequence
          Length = 638

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 561 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 514



to top

>gb|BC090154.1| Xenopus laevis cDNA clone MGC:98504 IMAGE:7198701, complete cds
          Length = 750

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 546 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 499



to top

>gb|BC090155.1| Xenopus laevis cDNA clone MGC:98507 IMAGE:7198715, complete cds
          Length = 644

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 546 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 499



to top

>ref|NM_031102.1| Rattus norvegicus ribosomal protein L18 (Rpl18), mRNA
          Length = 607

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||  |||||||| || |||||||| ||||||||||||||
Sbjct: 522 aacttccggcccttggaacggacatagggtttggtgtggctgtg 479



to top

>gb|AF401572.1| Ictalurus punctatus ribosomal protein L18 mRNA, complete cds
          Length = 635

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||| || ||||| || |  ||||||||||||||||||||
Sbjct: 529 ctcaaacttcctgcctttggaacgaatgtagggcttggtgtggctgtg 482



to top

>gb|BC091732.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone MGC:102603
           IMAGE:2655484), complete cds
          Length = 638

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 537 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 490



to top

>emb|V01439.1|XLRIB2 Fragment of Xenopus laevis mRNA for ribosomal protein L14
          Length = 509

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 184 ctcaaacttcctacccttggagcgcacatagggctt 219
           ||||||||| |||||||||||| ||||||| |||||
Sbjct: 430 ctcaaactttctacccttggagagcacataaggctt 395



to top

>emb|AL732452.5| Mouse DNA sequence from clone RP23-177C20 on chromosome 2, complete
             sequence
          Length = 190165

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 184   ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
             |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 90394 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 90441



to top

>emb|X06223.1|XLRPL14B Xenopus laevis mRNA for ribosomal protein L14b
          Length = 670

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 184 ctcaaacttcctacccttggagcgcacatagggctt 219
           ||||||||| |||||||||||| ||||||| |||||
Sbjct: 584 ctcaaactttctacccttggagagcacataaggctt 549



to top

>gb|BC082290.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone MGC:102572
           IMAGE:6485569), complete cds
          Length = 643

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 545 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 498



to top

>gb|BC081468.1| Mus musculus ribosomal protein L18, mRNA (cDNA clone MGC:102181
           IMAGE:6823249), complete cds
          Length = 666

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 549 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 502



to top

>ref|NG_005371.1| Mus musculus ribosomal protein L18 pseudogene (LOC652986) on
           chromosome 6
          Length = 809

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 184 ctcaaacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||||||  |||||||| || |||||||| ||||| ||||||||
Sbjct: 646 ctcaaacttccggcccttggaacggacatagggtttggtatggctgtg 599



to top

>gb|M20156.1|RATRPL18A Rat ribosomal protein L18 mRNA, complete cds
          Length = 607

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||  |||||||| || |||||||| ||||||||||||||
Sbjct: 522 aacttccggcccttggaacggacatagggtttggtgtggctgtg 479



to top

>ref|NM_001015556.2| Bos taurus ribosomal protein L18 (RPL18), mRNA
          Length = 773

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| ||||||||||| |||||
Sbjct: 544 aacttccggcccttggagcggacgtagggtttggtgtggctatgcgg 498



to top

>gb|AC010115.6| Drosophila melanogaster 3L BAC RP98-16I16 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 180821

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 233   ggcacaccaggagccttgccgaagtgc 259
             |||||||| ||||||||||||||||||
Sbjct: 68903 ggcacaccgggagccttgccgaagtgc 68877



to top

>gb|AY113554.1| Drosophila melanogaster RH01814 full insert cDNA
          Length = 737

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 233 ggcacaccaggagccttgccgaagtgc 259
           |||||||| ||||||||||||||||||
Sbjct: 534 ggcacaccgggagccttgccgaagtgc 508



to top

>ref|NM_139834.2| Drosophila melanogaster Ribosomal protein L18 CG8615-RA (RpL18),
           mRNA
          Length = 731

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 233 ggcacaccaggagccttgccgaagtgc 259
           |||||||| ||||||||||||||||||
Sbjct: 533 ggcacaccgggagccttgccgaagtgc 507



to top

>gb|BC104507.1| Bos taurus ribosomal protein L18, mRNA (cDNA clone MGC:129138
           IMAGE:8122333), complete cds
          Length = 773

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| ||||||||||| |||||
Sbjct: 544 aacttccggcccttggagcggacgtagggtttggtgtggctatgcgg 498



to top

>gb|DQ066324.1| Ixodes scapularis isolate IS-6-12L-136 ribosomal protein L18 mRNA,
           complete cds
          Length = 567

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 197 cccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||| ||||| || |||||||||||||||||
Sbjct: 512 cccttggaccgcacgtacggcttggtgtggctgtg 478



to top

>gb|AC010528.8|AC010528 Homo sapiens chromosome 16 clone RP11-150D5, complete sequence
          Length = 168172

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 188    aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
              |||||||  ||||||||| | || ||||| |||||||||||||||||
Sbjct: 154941 aacttccggcccttggagtggacgtagggtttggtgtggctgtgcgg 154895



to top

>gb|AY130355.1| Myxine glutinosa ribosomal protein L18 mRNA, partial cds
          Length = 479

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 190 cttcctacccttggagcgcacatagggcttggtgtggctgtgcggcacacc 240
           |||||| |||||||| || ||||||||||| | ||||||||| || |||||
Sbjct: 479 cttcctccccttggatcgaacatagggctttgcgtggctgtgtggtacacc 429



to top

>gb|AC009046.4|AC009046 Homo sapiens chromosome 16 clone RP11-200H5, complete sequence
          Length = 153562

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                            
Query: 188   aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
             |||||||  ||||||||| | || ||||| |||||||||||||||||
Sbjct: 50824 aacttccggcccttggagtggacgtagggtttggtgtggctgtgcgg 50870



to top

>dbj|AK174004.1| Ciona intestinalis cDNA, clone:ciad012g12, full insert sequence
          Length = 630

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 197 cccttggagcgcacatagggcttggtgtggctgtgcggcacaccaggagccttgccgaag 256
           |||||||| | |||||| || |||||||| || || ||||| || ||||| |||||||||
Sbjct: 506 cccttggatctcacatatggtttggtgtgactatgtggcacgcctggagctttgccgaag 447

              
Query: 257 tgc 259
           |||
Sbjct: 446 tgc 444



to top

>gb|BT021047.1| Bos taurus ribosomal protein L18 (RPL18), mRNA, complete cds
          Length = 629

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtgcgg 234
           |||||||  ||||||||||| || ||||| ||||||||||| |||||
Sbjct: 543 aacttccggcccttggagcggacgtagggtttggtgtggctatgcgg 497



to top

>gb|AE003559.3| Drosophila melanogaster chromosome 3L, section 26 of 83 of the complete
             sequence
          Length = 269948

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 233   ggcacaccaggagccttgccgaagtgc 259
             |||||||| ||||||||||||||||||
Sbjct: 31079 ggcacaccgggagccttgccgaagtgc 31105



to top

>emb|CR533575.5| Zebrafish DNA sequence from clone CH211-215M13 in linkage group 16,
            complete sequence
          Length = 115032

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 188  aacttcctacccttggagcgcacatagggc 217
            |||||||| || ||||||||||||||||||
Sbjct: 5855 aacttcctgcctttggagcgcacatagggc 5826



to top

>emb|X05025.1|XLRPL14 Xenopus laevis gene for ribosomal protein L14
          Length = 9124

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 184  ctcaaacttcctacccttggagcgcacata 213
            ||||||||| |||||||||||| |||||||
Sbjct: 8304 ctcaaactttctacccttggagagcacata 8275



to top

>emb|AL808124.12| Mouse DNA sequence from clone RP23-146I4 on chromosome X, complete
             sequence
          Length = 162375

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 467   acagcaatgttcttctcctcct 488
             ||||||||||||||||||||||
Sbjct: 78768 acagcaatgttcttctcctcct 78789



to top

>gb|AC151347.2| Xenopus tropicalis clone ISB-394A6, complete sequence
          Length = 78040

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 125   taaccagaaagggcaacttaaacct 149
             |||||||||||||||| ||||||||
Sbjct: 22091 taaccagaaagggcaagttaaacct 22115



to top

>ref|XM_390042.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG09866.1) partial mRNA
          Length = 555

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 311 ccagttggagcacggagagcaagctggtc 339
           ||||| || ||||||||||||||||||||
Sbjct: 395 ccagtgggggcacggagagcaagctggtc 367



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 250 gccgaagtgcctcaccgcctcacgggcattcttggg 285
           |||||||||| | || ||||||||||| ||||||||
Sbjct: 456 gccgaagtgcttgacagcctcacgggcgttcttggg 421



to top

>gb|AC142499.9| Mus musculus strain C57BL/6J clone rp23-333m15, complete sequence
          Length = 215706

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 213  agggcttggtgtggctgtgcg 233
            |||||||||||||||||||||
Sbjct: 6453 agggcttggtgtggctgtgcg 6473



to top

>gb|AC134382.13| Mus musculus strain C57BL/6J clone rp23-167l1, complete sequence
          Length = 194086

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 213    agggcttggtgtggctgtgcg 233
              |||||||||||||||||||||
Sbjct: 190362 agggcttggtgtggctgtgcg 190382



to top

>gb|AC007961.32| Mus musculus strain 129S6/SvEvTac clone rp21-594l4 map 10, complete
             sequence
          Length = 180585

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 213   agggcttggtgtggctgtgcg 233
             |||||||||||||||||||||
Sbjct: 37287 agggcttggtgtggctgtgcg 37307



to top

>gb|AC005302.70| Mus musculus strain 129S6/SvEvTac chromosome 10 clone rp21-481n4,
            complete sequence
          Length = 204653

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 213  agggcttggtgtggctgtgcg 233
            |||||||||||||||||||||
Sbjct: 8315 agggcttggtgtggctgtgcg 8295



to top

>dbj|AB180448.1| Plutella xylostella mRNA for Ribosomal protein L18, complete cds
          Length = 564

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 197 cccttggagcgcacatagggcttggtgtg 225
           ||||||||||| || ||||||||||||||
Sbjct: 513 cccttggagcggacgtagggcttggtgtg 485



to top

>dbj|AP004411.1| Bregmaceros nectabanus mitochondrial DNA, complete genome except for
            D-loop
          Length = 16030

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 474  tgttcttctcctcctttccct 494
            |||||||||||||||||||||
Sbjct: 7545 tgttcttctcctcctttccct 7565



to top

>gb|AY443750.1| Crematogaster sp. B SPQ-2003 isolate SPQ.051 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 547

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 475 gttcttctcctcctttccct 494
           ||||||||||||||||||||
Sbjct: 352 gttcttctcctcctttccct 371



to top

>gb|AY443748.1| Crematogaster sp. B SPQ-2003 isolate SPQ.049 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 546

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 475 gttcttctcctcctttccct 494
           ||||||||||||||||||||
Sbjct: 351 gttcttctcctcctttccct 370



to top

>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome
          Length = 4222334

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 473     atgttcttctcctcctttcc 492
               ||||||||||||||||||||
Sbjct: 1031606 atgttcttctcctcctttcc 1031587



to top

>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome
          Length = 4222645

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 473     atgttcttctcctcctttcc 492
               ||||||||||||||||||||
Sbjct: 1032456 atgttcttctcctcctttcc 1032437



to top

>gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 236843

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 188   aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
             |||||||  |||||||| |  |||||||| ||||||||||||||
Sbjct: 42382 aacttccggcccttggaacagacatagggtttggtgtggctgtg 42339



to top

>ref|XM_362039.1| Magnaporthe grisea 70-15 hypothetical protein (MG04484.4) partial
           cds
          Length = 555

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 250 gccgaagtgcctcaccgcctcacgggcattcttggg 285
           |||||||||| | || ||||||||||| ||||||||
Sbjct: 456 gccgaagtgcttgacagcctcacgggcgttcttggg 421



to top

>gb|AY463528.1| Gallus gallus prolyl 3-hydroxylase 1 (P3H1) mRNA, complete cds
          Length = 2178

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  tggctgtgcggcacaccagg 243
            ||||||||||||||||||||
Sbjct: 1693 tggctgtgcggcacaccagg 1674



to top

>ref|XM_537965.2| PREDICTED: Canis familiaris similar to ribosomal protein L18
           (LOC480848), mRNA
          Length = 659

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||  |||||||| | ||| ||||| ||||||||||||||
Sbjct: 562 aacttccggcccttggatctcacgtagggtttggtgtggctgtg 519



to top

>ref|XM_849725.1| PREDICTED: Canis familiaris similar to ribosomal protein L18
           (LOC612002), mRNA
          Length = 911

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 188 aacttcctacccttggagcgcacatagggcttggtgtggctgtg 231
           |||||||  |||||||| | ||| ||||| ||||||||||||||
Sbjct: 802 aacttccggcccttggatctcacgtagggtttggtgtggctgtg 759


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,845,649
Number of Sequences: 3902068
Number of extensions: 3845649
Number of successful extensions: 76980
Number of sequences better than 10.0: 264
Number of HSP's better than 10.0 without gapping: 264
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76438
Number of HSP's gapped (non-prelim): 531
length of query: 494
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 472
effective length of database: 17,147,199,772
effective search space: 8093478292384
effective search space used: 8093478292384
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top