ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal4m17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_467399.1| Oryza sativa (japonica cultivar-group), mRNA 369 4e-99
2gb|AY109202.1| Zea mays PCO136905 mRNA sequence 321 8e-85
3gb|BT009441.1| Triticum aestivum clone wlmk4.pk0023.c10:fis, ful... 218 9e-54
4gb|AY112578.1| Zea mays CL885_1 mRNA sequence 206 3e-50
5gb|BT017385.1| Zea mays clone EL01N0326H05.c mRNA sequence 194 1e-46
6dbj|AK066348.1| Oryza sativa (japonica cultivar-group) cDNA clon... 192 5e-46
7ref|XM_549849.1| Oryza sativa (japonica cultivar-group), mRNA 186 3e-44
8dbj|AK119792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 3e-44
9dbj|AK099287.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 3e-44
10dbj|AK059300.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 3e-44
11dbj|AK073331.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 8e-42
12gb|DQ294622.1| Arachis hypogaea RING-box protein (RBX1a) mRNA, c... 176 3e-41
13gb|DQ099098.1| Arachis stenosperma clone AS1RN18H05 microsatelli... 168 7e-39
14emb|AL031581.1|DMC115C2 Drosophila melanogaster cosmid clone 115C2 149 7e-33
15gb|AY119265.1| Drosophila melanogaster SD23839 full insert cDNA 149 7e-33
16gb|AC104602.3| Drosophila melanogaster X BAC RP98-16G6 (Roswell ... 149 7e-33
17ref|NM_130496.2| Drosophila melanogaster Roc1a CG16982-RA (Roc1a... 149 7e-33
18gb|AE003418.4| Drosophila melanogaster chromosome X, section 2 o... 149 7e-33
19ref|XM_314102.2| Anopheles gambiae str. PEST ENSANGP00000010437 ... 145 1e-31
20gb|AY302066.1| Populus tomentosa ring box protein mRNA, complete... 143 4e-31
21emb|BX037579.1|CNS0915R Single read from an extremity of a full-... 137 3e-29
22gb|AY555146.1| Fragaria x ananassa putative ring-box protein mRN... 133 4e-28
23emb|BX008706.1|CNS08EVQ Single read from an extremity of a full-... 131 2e-27
24emb|BX006952.1|CNS08DJ0 Single read from an extremity of a full-... 129 6e-27
25emb|BX006498.1|CNS08D6E Single read from an extremity of a full-... 129 6e-27
26gb|AF480496.1| Oryza sativa clone BAC 49D11, complete sequence 127 3e-26
27dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 127 3e-26
28dbj|AP005844.3| Oryza sativa (japonica cultivar-group) genomic D... 127 3e-26
29ref|NM_122064.2| Arabidopsis thaliana RBX1 AT5G20570 (RBX1) mRNA... 121 2e-24
30emb|BX020497.1|CNS08NZ9 Single read from an extremity of a full-... 121 2e-24
31emb|BX020496.1|CNS08NZ8 Single read from an extremity of a full-... 121 2e-24
32emb|BX008661.1|CNS08EUH Single read from an extremity of a full-... 121 2e-24
33gb|AY114719.1| Arabidopsis thaliana ring-box protein-like (At5g2... 121 2e-24
34gb|AY072430.1| Arabidopsis thaliana ring-box protein - like (At5... 121 2e-24
35gb|AY052401.1| Arabidopsis thaliana ring box-1-like protein mRNA... 121 2e-24
36gb|AY086913.1| Arabidopsis thaliana clone 29408 mRNA, complete s... 121 2e-24
37dbj|AK118181.1| Arabidopsis thaliana At5g20570 mRNA for putative... 121 2e-24
38gb|AY027936.1| Salmo salar hyperosmotic protein 21 mRNA, complet... 119 6e-24
39gb|DQ000158.1| Salmo salar hyperosmotic protein 21 (Shop21) gene... 119 6e-24
40gb|DQ000157.1| Salmo salar hyperosmotic protein 21 (Shop21) gene... 119 6e-24
41emb|BX012866.1|CNS08I3A Single read from an extremity of a full-... 115 1e-22
42emb|BX006499.1|CNS08D6F Single read from an extremity of a full-... 113 4e-22
43emb|BX833527.1|CNS0A0LK Arabidopsis thaliana Full-length cDNA Co... 113 4e-22
44ref|XM_677021.1| Aspergillus nidulans FGSC A4 hypothetical prote... 111 1e-21
45dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 105 9e-20
46dbj|AP002863.3| Oryza sativa (japonica cultivar-group) genomic D... 105 9e-20
47dbj|AP002845.3| Oryza sativa (japonica cultivar-group) genomic D... 105 9e-20
48gb|AY440092.1| Armigeres subalbatus ASAP ID: 42179 ubiquitin lig... 90 5e-15
49ref|NM_114151.1| Arabidopsis thaliana ubiquitin-protein ligase A... 88 2e-14
50gb|DQ446722.1| Arabidopsis thaliana clone pENTR221-At3g42830 rin... 84 3e-13
51gb|BC081497.1| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:72... 78 2e-11
52ref|XM_688824.1| PREDICTED: Danio rerio similar to RING-box prot... 78 2e-11
53gb|BC107831.1| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:72... 78 2e-11
54gb|AC010010.6| Drosophila melanogaster 3L BAC RP98-13F6 (Roswell... 70 5e-09
55ref|NM_144356.2| Drosophila melanogaster Roc1b CG16988-RA (Roc1b... 70 5e-09
56ref|NM_138189.2| Drosophila melanogaster CG6905-RA (CG6905), mRNA 70 5e-09
57gb|AY070810.1| Drosophila melanogaster AT21612 full length cDNA 70 5e-09
58gb|AY061302.1| Drosophila melanogaster LD21614 full length cDNA 70 5e-09
59gb|AF218290.1|AF218290 Drosophila melanogaster ring finger prote... 70 5e-09
60gb|AE003468.3| Drosophila melanogaster chromosome 3L, section 2 ... 70 5e-09
61gb|DQ306845.1| Hevea brasiliensis isolate SSH116 mRNA sequence 70 5e-09
62gb|DQ306836.1| Hevea brasiliensis isolate SSH107 mRNA sequence 70 5e-09
63emb|CT033337.1| Platynereis dumerilii EST IB0AAA22BD06EM1 70 5e-09
64emb|CT033336.1| Platynereis dumerilii EST IB0AAA22BD06FM1 70 5e-09
65emb|CT032976.1| Platynereis dumerilii EST IB0AAA28CF05EM1 70 5e-09
66emb|CT032975.1| Platynereis dumerilii EST IB0AAA28CF05FM1 70 5e-09
67emb|CT032443.1| Platynereis dumerilii EST IB0AAA38AF03EM1 70 5e-09
68emb|CT032442.1| Platynereis dumerilii EST IB0AAA38AF03FM1 70 5e-09
69emb|CT032439.1| Platynereis dumerilii EST IB0AAA38AH04FM1 70 5e-09
70emb|CT032267.1| Platynereis dumerilii EST IB0AAA42AB12EM1 70 5e-09
71emb|CT032266.1| Platynereis dumerilii EST IB0AAA42AB12FM1 70 5e-09
72ref|XM_756798.1| Ustilago maydis 521 hypothetical protein (UM057... 66 8e-08
73emb|CR712304.2|CNS0GCKC Tetraodon nigroviridis full-length cDNA 64 3e-07
74emb|CR711741.2|CNS0GC4P Tetraodon nigroviridis full-length cDNA 64 3e-07
75emb|CR718984.2|CNS0GHPQ Tetraodon nigroviridis full-length cDNA 64 3e-07
76emb|CR718953.2|CNS0GHOV Tetraodon nigroviridis full-length cDNA 64 3e-07
77emb|CR718828.2|CNS0GHLE Tetraodon nigroviridis full-length cDNA 64 3e-07
78emb|CR718557.2|CNS0GHDV Tetraodon nigroviridis full-length cDNA 64 3e-07
79emb|CR717778.2|CNS0GGS8 Tetraodon nigroviridis full-length cDNA 64 3e-07
80emb|CR717707.2|CNS0GGQ9 Tetraodon nigroviridis full-length cDNA 64 3e-07
81emb|CR717638.2|CNS0GGOC Tetraodon nigroviridis full-length cDNA 64 3e-07
82emb|CR717357.2|CNS0GGGJ Tetraodon nigroviridis full-length cDNA 64 3e-07
83emb|CR717269.2|CNS0GGE3 Tetraodon nigroviridis full-length cDNA 64 3e-07
84emb|CR717135.2|CNS0GGAG Tetraodon nigroviridis full-length cDNA 64 3e-07
85emb|CR716834.2|CNS0GG23 Tetraodon nigroviridis full-length cDNA 64 3e-07
86emb|CR716017.2|CNS0GFFH Tetraodon nigroviridis full-length cDNA 64 3e-07
87emb|CR715173.2|CNS0GES1 Tetraodon nigroviridis full-length cDNA 64 3e-07
88emb|CR714756.2|CNS0GEGG Tetraodon nigroviridis full-length cDNA 64 3e-07
89emb|CR715040.2|CNS0GEOC Tetraodon nigroviridis full-length cDNA 64 3e-07
90emb|CR711398.2|CNS0GBV6 Tetraodon nigroviridis full-length cDNA 64 3e-07
91emb|CR714255.2|CNS0GE2J Tetraodon nigroviridis full-length cDNA 64 3e-07
92emb|CR713764.2|CNS0GDOW Tetraodon nigroviridis full-length cDNA 64 3e-07
93emb|CR713551.2|CNS0GDIZ Tetraodon nigroviridis full-length cDNA 64 3e-07
94emb|CR713038.2|CNS0GD4Q Tetraodon nigroviridis full-length cDNA 64 3e-07
95emb|CR712711.2|CNS0GCVN Tetraodon nigroviridis full-length cDNA 64 3e-07
96emb|CR712093.2|CNS0GCEH Tetraodon nigroviridis full-length cDNA 64 3e-07
97emb|CR710993.2|CNS0GBJX Tetraodon nigroviridis full-length cDNA 64 3e-07
98emb|CR710591.2|CNS0GB8R Tetraodon nigroviridis full-length cDNA 64 3e-07
99emb|CR710156.2|CNS0GAWO Tetraodon nigroviridis full-length cDNA 64 3e-07
100emb|CR709913.2|CNS0GAPX Tetraodon nigroviridis full-length cDNA 64 3e-07
101emb|CR709418.2|CNS0GAC6 Tetraodon nigroviridis full-length cDNA 64 3e-07
102emb|CR709337.2|CNS0GA9X Tetraodon nigroviridis full-length cDNA 64 3e-07
103emb|CR708996.2|CNS0GA0G Tetraodon nigroviridis full-length cDNA 64 3e-07
104emb|CR709183.2|CNS0GA5N Tetraodon nigroviridis full-length cDNA 64 3e-07
105emb|CR709075.2|CNS0GA2N Tetraodon nigroviridis full-length cDNA 64 3e-07
106emb|CR708377.2|CNS0G9J9 Tetraodon nigroviridis full-length cDNA 64 3e-07
107emb|CR708266.2|CNS0G9G6 Tetraodon nigroviridis full-length cDNA 64 3e-07
108emb|CR708263.2|CNS0G9G3 Tetraodon nigroviridis full-length cDNA 64 3e-07
109emb|CR707631.2|CNS0G8YJ Tetraodon nigroviridis full-length cDNA 64 3e-07
110emb|CR707603.2|CNS0G8XR Tetraodon nigroviridis full-length cDNA 64 3e-07
111emb|CR705966.2|CNS0G7OA Tetraodon nigroviridis full-length cDNA 64 3e-07
112emb|CR706999.2|CNS0G8GZ Tetraodon nigroviridis full-length cDNA 64 3e-07
113emb|CR706688.2|CNS0G88C Tetraodon nigroviridis full-length cDNA 64 3e-07
114emb|CR706606.2|CNS0G862 Tetraodon nigroviridis full-length cDNA 64 3e-07
115emb|CR706092.2|CNS0G7RS Tetraodon nigroviridis full-length cDNA 64 3e-07
116emb|CR705735.2|CNS0G7HV Tetraodon nigroviridis full-length cDNA 64 3e-07
117emb|CR705000.2|CNS0G6XG Tetraodon nigroviridis full-length cDNA 64 3e-07
118emb|CR704952.2|CNS0G6W4 Tetraodon nigroviridis full-length cDNA 64 3e-07
119emb|CR704915.2|CNS0G6V3 Tetraodon nigroviridis full-length cDNA 64 3e-07
120emb|CR705166.2|CNS0G722 Tetraodon nigroviridis full-length cDNA 64 3e-07
121emb|CR704225.2|CNS0G6BX Tetraodon nigroviridis full-length cDNA 64 3e-07
122emb|CR702171.2|CNS0G4QV Tetraodon nigroviridis full-length cDNA 64 3e-07
123emb|CR696134.2|CNS0G036 Tetraodon nigroviridis full-length cDNA 64 3e-07
124emb|CR685564.2|CNS0FRXK Tetraodon nigroviridis full-length cDNA 64 3e-07
125emb|CR684241.2|CNS0FQWT Tetraodon nigroviridis full-length cDNA 64 3e-07
126emb|CR683717.2|CNS0FQI9 Tetraodon nigroviridis full-length cDNA 64 3e-07
127emb|CR659058.2|CNS0F7I0 Tetraodon nigroviridis full-length cDNA 64 3e-07
128emb|CR633484.2|CNS0ENRM Tetraodon nigroviridis full-length cDNA 64 3e-07
129emb|CR632165.2|CNS0EMQZ Tetraodon nigroviridis full-length cDNA 64 3e-07
130emb|CR631384.2|CNS0EM59 Tetraodon nigroviridis full-length cDNA 64 3e-07
131ref|NM_001034135.1| Rattus norvegicus ring-box 1 (Rbx1), mRNA 64 3e-07
132gb|BC100258.1| Rattus norvegicus ring-box 1, mRNA (cDNA clone MG... 64 3e-07
133emb|CT032440.1| Platynereis dumerilii EST IB0AAA38AH04EM1 62 1e-06
134gb|AC084553.1|CBRG33P21 Caenorhabditis briggsae cosmid G33P21, c... 60 5e-06
135ref|XM_957982.1| Neurospora crassa OR74A hypothetical protein (N... 58 2e-05
136ref|XM_326078.1| Neurospora crassa OR74A hypothetical protein (N... 58 2e-05
137gb|DQ311404.1| Bombyx mori ring box protein mRNA, complete cds 58 2e-05
138gb|BC051473.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:629... 56 8e-05
139gb|AC112970.18| Mus musculus chromosome 17, clone RP24-443D19, c... 56 8e-05
140ref|NM_019712.2| Mus musculus ring-box 1 (Rbx1), mRNA 56 8e-05
141gb|BC083057.1| Mus musculus ring-box 1, mRNA (cDNA clone IMAGE:5... 56 8e-05
142emb|Z70757.1|CEZK287 Caenorhabditis elegans Cosmid ZK287, comple... 56 8e-05
143emb|CR718972.2|CNS0GHPE Tetraodon nigroviridis full-length cDNA 56 8e-05
144emb|CR716350.2|CNS0GFON Tetraodon nigroviridis full-length cDNA 56 8e-05
145emb|CR715418.2|CNS0GEYU Tetraodon nigroviridis full-length cDNA 56 8e-05
146emb|CR708622.2|CNS0G9Q2 Tetraodon nigroviridis full-length cDNA 56 8e-05
147emb|CR707762.2|CNS0G926 Tetraodon nigroviridis full-length cDNA 56 8e-05
148emb|CR707479.2|CNS0G8UB Tetraodon nigroviridis full-length cDNA 56 8e-05
149emb|CR670549.2|CNS0FGD7 Tetraodon nigroviridis full-length cDNA 56 8e-05
150emb|CR659962.2|CNS0F874 Tetraodon nigroviridis full-length cDNA 56 8e-05
151emb|CR632856.2|CNS0ENA6 Tetraodon nigroviridis full-length cDNA 56 8e-05
152gb|BC056992.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:669... 56 8e-05
153dbj|AK152012.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 56 8e-05
154dbj|AK159571.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 56 8e-05
155dbj|AK003159.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 56 8e-05
156dbj|AK005127.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 56 8e-05
157ref|NM_073095.4| Caenorhabditis elegans yeast RBX (ring finger p... 56 8e-05
158dbj|AK004114.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 56 8e-05
159dbj|AK183716.1| Mus musculus cDNA, clone:Y0G0126N24, strand:plus... 56 8e-05
160dbj|AK182752.1| Mus musculus cDNA, clone:Y0G0123J24, strand:plus... 56 8e-05
161dbj|AB077287.1| Caenorhabditis elegans Ce-rbx-1 mRNA for RING-H2... 56 8e-05
162gb|BC027396.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:359... 56 8e-05
163gb|AF140599.1|AF140599 Mus musculus ring-box protein 1 (Rbx1) mR... 56 8e-05
164emb|CR974451.9| Mouse DNA sequence from clone RP24-180B11 on chr... 56 8e-05
165ref|XM_363999.1| Magnaporthe grisea 70-15 hypothetical protein (... 54 3e-04
166ref|XM_416239.1| PREDICTED: Gallus gallus similar to RBX1 protei... 54 3e-04
167ref|XM_881804.1| PREDICTED: Bos taurus similar to RING-box prote... 54 3e-04
168ref|XM_597082.2| PREDICTED: Bos taurus similar to RING-box prote... 54 3e-04
169ref|XM_748960.1| Aspergillus fumigatus Af293 ubiquitin ligase su... 54 3e-04
170gb|BC105329.1| Bos taurus similar to RING-box protein 1 (Rbx1), ... 54 3e-04
171emb|CR390140.1| Gallus gallus finished cDNA, clone ChEST162j5 54 3e-04
172emb|BX470254.7| Zebrafish DNA sequence from clone CH211-256M1 in... 54 3e-04
173gb|DQ213704.1| Taeniopygia guttata clone 0058P0062F10 RBX1 prote... 52 0.001
174ref|XM_382673.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 52 0.001
175emb|AL954851.5| Zebrafish DNA sequence from clone CH211-280J3, c... 52 0.001
176gb|AC109153.13| Mus musculus chromosome 15, clone RP23-51J23, co... 50 0.005
177dbj|AK116119.1| Ciona intestinalis cDNA, clone:citb010m18, full ... 50 0.005
178gb|AC160528.9| Mus musculus chromosome 15, clone RP23-310L8, com... 50 0.005
179emb|CT027911.1| Xenopus tropicalis finished cDNA, clone TEgg095b23 48 0.019
180gb|DQ103593.1| Olimarabidopsis pumila clone BAC 44L14, complete ... 48 0.019
181gb|AF296833.1|F7C8 Arabidopsis thaliana BAC F7C8 48 0.019
182emb|AL138639.1|ATT21C14 Arabidopsis thaliana DNA chromosome 3, B... 48 0.019
183gb|DQ213705.1| Taeniopygia guttata clone 0063P0003E09 RBX1 prote... 46 0.073
184gb|AF156371.1| Nicotiana tabacum clone PR29 mRNA sequence 46 0.073
185dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 46 0.073
186gb|AC124471.4| Mus musculus BAC clone RP24-79D7 from 12, complet... 42 1.1
187gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 4.5
188ref|XM_568891.1| Cryptococcus neoformans var. neoformans JEC21 u... 40 4.5
189emb|CR686693.2|CNS0FSSX Tetraodon nigroviridis full-length cDNA 40 4.5
190emb|AL844222.19| Mouse DNA sequence from clone RP23-44P13 on chr... 40 4.5
191gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 4.5
192dbj|AK125754.1| Homo sapiens cDNA FLJ43766 fis, clone TESTI2049246 40 4.5
193ref|XM_941170.1| PREDICTED: Homo sapiens hypothetical LOC401923 ... 40 4.5
194ref|XM_377538.2| PREDICTED: Homo sapiens hypothetical LOC401923 ... 40 4.5
195gb|DQ350703.1| Ajellomyces capsulatus nitrosative stress induced... 40 4.5
196dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
197dbj|AP006156.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
198gb|AC007785.1|AC007785 Homo sapiens chromosome 19, BAC 282485 (C... 40 4.5

>ref|XM_467399.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 345

 Score =  369 bits (186), Expect = 4e-99
 Identities = 195/199 (97%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 344 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 285

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 284 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 225

                                                                       
Query: 260 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 224 gtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatgcagaggtccatg 165

                              
Query: 320 atgtggttgcggcagatgg 338
           |||||||||||||||||||
Sbjct: 164 atgtggttgcggcagatgg 146



to top

>gb|AY109202.1| Zea mays PCO136905 mRNA sequence
          Length = 736

 Score =  321 bits (162), Expect = 8e-85
 Identities = 189/199 (94%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||
Sbjct: 418 tagtgaccatacttctggaactcccactcactgttgtcaagagggcacacttgacgggtc 359

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || |||||||||||||| ||| ||||| |||||||||||||||||| |||||||||||||
Sbjct: 358 tttagccaacggctgatacagtggaagtggaatgcatggttgcaaattccccaagcgacg 299

                                                                       
Query: 260 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
           ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 298 gtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatgcaaaggtccatg 239

                              
Query: 320 atgtggttgcggcagatgg 338
           |||||||||||||||||||
Sbjct: 238 atgtggttgcggcagatgg 220



to top

>gb|BT009441.1| Triticum aestivum clone wlmk4.pk0023.c10:fis, full insert mRNA
           sequence
          Length = 582

 Score =  218 bits (110), Expect = 9e-54
 Identities = 167/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 152 ttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagccaacgg 211
           |||||||||||||| |||||||||||||| ||||||||||| ||  |||||||||| | |
Sbjct: 361 ttctggaactcccattcgctgttgtctagtgggcacacttggcgagtcttgagccacctg 302

                                                                       
Query: 212 ctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcactcctcg 271
           ||||||||| ||||| |||| ||||| || || || ||||| ||||||||||| ||||||
Sbjct: 301 ctgatgcagtggaagtggaaagcatgattacagacaccccatgcgacggtgcattcctcg 242

                                                                       
Query: 272 ctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcgg 331
           |||||||||||||||||||| ||||||||||||||||| || |||||||||||||| |||
Sbjct: 241 ctggtggcgctggcctggttggcctggcactcgatgcatagatccatgatgtggttacgg 182

                  
Query: 332 cagatgg 338
           |||||||
Sbjct: 181 cagatgg 175



to top

>gb|AY112578.1| Zea mays CL885_1 mRNA sequence
          Length = 797

 Score =  206 bits (104), Expect = 3e-50
 Identities = 173/197 (87%)
 Strand = Plus / Plus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||| ||||||||||||||||| ||||| ||||  ||||||||||||||  ||
Sbjct: 366 tagtggccatatttctggaactcccactcactgttatctaatgggcacacttgacgagtc 425

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| | |||||||||| ||||| | || ||||| || || ||||||||||| || 
Sbjct: 426 ttaagccacctgctgatgcagtggaagtgaaaagcatgattacagactccccaagcaaca 485

                                                                       
Query: 260 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
           ||||||||||||||||| |||||||| ||||||||||||||||||||||| || ||||||
Sbjct: 486 gtgcactcctcgctggtcgcgctggcttggttcgcctggcactcgatgcatagatccatg 545

                            
Query: 320 atgtggttgcggcagat 336
           |||||||||||||||||
Sbjct: 546 atgtggttgcggcagat 562



to top

>gb|BT017385.1| Zea mays clone EL01N0326H05.c mRNA sequence
          Length = 720

 Score =  194 bits (98), Expect = 1e-46
 Identities = 173/199 (86%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||| ||||||||||||||||| ||||| ||||  ||||||||||| ||  ||
Sbjct: 434 tagtggccatatttctggaactcccactcactgttatctaatgggcacacttggcgagtc 375

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| | |||||||||| ||||| | || ||||| || || || ||||||||||| 
Sbjct: 374 ttaagccacctgctgatgcagtggaagtgaaaagcatgattacagacaccccaagcgaca 315

                                                                       
Query: 260 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| || ||||||
Sbjct: 314 gtgcactcctcgctggtcgcgctagcttggttcgcctggcactcgatgcatagatccatg 255

                              
Query: 320 atgtggttgcggcagatgg 338
           |||||||||||||||||||
Sbjct: 254 atgtggttgcggcagatgg 236



to top

>dbj|AK066348.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013059F24, full
            insert sequence
          Length = 2340

 Score =  192 bits (97), Expect = 5e-46
 Identities = 106/110 (96%)
 Strand = Plus / Minus

                                                                        
Query: 140  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 2091 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 2032

                                                              
Query: 200  ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactcc 249
            ||||||||||||||||||||| ||||| |||| |||||||||||||||||
Sbjct: 2031 ttgagccaacggctgatgcagtggaagtggaacgcatggttgcaaactcc 1982



 Score =  113 bits (57), Expect = 4e-22
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                       
Query: 248 ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 307
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 423 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 364

            
Query: 308 c 308
           |
Sbjct: 363 c 363



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 308 cagaggtccatgatgtggttgcggcagatgg 338
           |||||||||||||||||||||||||||||||
Sbjct: 233 cagaggtccatgatgtggttgcggcagatgg 203



to top

>ref|XM_549849.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 690

 Score =  186 bits (94), Expect = 3e-44
 Identities = 172/199 (86%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| ||  ||
Sbjct: 429 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 370

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| | |||||||||  ||||| | || ||||| || || || ||||||||||| 
Sbjct: 369 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 310

                                                                       
Query: 260 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 309 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 250

                              
Query: 320 atgtggttgcggcagatgg 338
           |||||||||||||||||||
Sbjct: 249 atgtggttgcggcagatgg 231



to top

>dbj|AK119792.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-175-A04, full
           insert sequence
          Length = 703

 Score =  186 bits (94), Expect = 3e-44
 Identities = 172/199 (86%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| ||  ||
Sbjct: 441 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 382

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| | |||||||||  ||||| | || ||||| || || || ||||||||||| 
Sbjct: 381 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 322

                                                                       
Query: 260 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 321 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 262

                              
Query: 320 atgtggttgcggcagatgg 338
           |||||||||||||||||||
Sbjct: 261 atgtggttgcggcagatgg 243



to top

>dbj|AK099287.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023127H11, full
            insert sequence
          Length = 1715

 Score =  186 bits (94), Expect = 3e-44
 Identities = 172/199 (86%)
 Strand = Plus / Minus

                                                                        
Query: 140  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
            ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| ||  ||
Sbjct: 1419 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 1360

                                                                        
Query: 200  ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
            |||||||| | |||||||||  ||||| | || ||||| || || || ||||||||||| 
Sbjct: 1359 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 1300

                                                                        
Query: 260  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
            ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 1299 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 1240

                               
Query: 320  atgtggttgcggcagatgg 338
            |||||||||||||||||||
Sbjct: 1239 atgtggttgcggcagatgg 1221



to top

>dbj|AK059300.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-F02, full
           insert sequence
          Length = 721

 Score =  186 bits (94), Expect = 3e-44
 Identities = 172/199 (86%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| ||  ||
Sbjct: 460 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 401

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| | |||||||||  ||||| | || ||||| || || || ||||||||||| 
Sbjct: 400 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 341

                                                                       
Query: 260 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 340 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 281

                              
Query: 320 atgtggttgcggcagatgg 338
           |||||||||||||||||||
Sbjct: 280 atgtggttgcggcagatgg 262



to top

>dbj|AK073331.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033026G05, full
           insert sequence
          Length = 690

 Score =  178 bits (90), Expect = 8e-42
 Identities = 171/199 (85%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| ||  ||
Sbjct: 429 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 370

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| | |||||||||  ||||| | ||  |||| || || || ||||||||||| 
Sbjct: 369 ttgagccacctgctgatgcaatggaagtgaaaaacatgattacagacaccccaagcgaca 310

                                                                       
Query: 260 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 309 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 250

                              
Query: 320 atgtggttgcggcagatgg 338
           |||||||||||||||||||
Sbjct: 249 atgtggttgcggcagatgg 231



to top

>gb|DQ294622.1| Arachis hypogaea RING-box protein (RBX1a) mRNA, complete cds
          Length = 355

 Score =  176 bits (89), Expect = 3e-41
 Identities = 167/194 (86%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||| ||||| |||||||||||||| || ||||||||||| ||||||||| ||
Sbjct: 350 tagtggccatatttctgaaactcccactcgctattatctagagggcaaacttgacgggtc 291

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| | ||| |||||  ||||| | || |||||||||||||||||||| || || 
Sbjct: 290 ttgagccatctgcttatgcaatggaagtgaaaagcatggttgcaaactccccacgctaca 231

                                                                       
Query: 260 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
           ||||| |||||||| |||||||| ||||| || ||||||||||| |||||||| ||||||
Sbjct: 230 gtgcattcctcgctagtggcgctagcctgattagcctggcactcaatgcagagatccatg 171

                         
Query: 320 atgtggttgcggca 333
           || ||||| |||||
Sbjct: 170 atatggttccggca 157



to top

>gb|DQ099098.1| Arachis stenosperma clone AS1RN18H05 microsatellite sequence
          Length = 692

 Score =  168 bits (85), Expect = 7e-39
 Identities = 166/194 (85%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||| ||||| |||||||| ||||| || ||||||||||| ||||||||| ||
Sbjct: 416 tagtggccatatttctgaaactcccattcgctattatctagagggcaaacttgacgggtc 357

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| | ||| |||||  ||||| | || |||||||||||||||||||| || || 
Sbjct: 356 ttgagccatctgcttatgcaatggaagtgaaaagcatggttgcaaactccccacgctaca 297

                                                                       
Query: 260 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
           ||||| |||||||| |||||||| ||||| || ||||||||||| |||||||| ||||||
Sbjct: 296 gtgcattcctcgctagtggcgctagcctgattagcctggcactcaatgcagagatccatg 237

                         
Query: 320 atgtggttgcggca 333
           || ||||| |||||
Sbjct: 236 atatggttccggca 223



to top

>emb|AL031581.1|DMC115C2 Drosophila melanogaster cosmid clone 115C2
          Length = 46630

 Score =  149 bits (75), Expect = 7e-33
 Identities = 168/200 (84%)
 Strand = Plus / Minus

                                                                         
Query: 139   ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
             |||||| || ||||||||||| |||||||||| |||||| || ||||| || || ||  |
Sbjct: 25504 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 25445

                                                                         
Query: 199   cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
             ||| ||||| ||   ||||||| ||||  |||| || |||||||| || ||||| || ||
Sbjct: 25444 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 25385

                                                                         
Query: 259   ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
             ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 25384 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 25325

                                 
Query: 319   gatgtggttgcggcagatgg 338
             ||||||||||||||||||||
Sbjct: 25324 gatgtggttgcggcagatgg 25305



to top

>gb|AY119265.1| Drosophila melanogaster SD23839 full insert cDNA
          Length = 1181

 Score =  149 bits (75), Expect = 7e-33
 Identities = 168/200 (84%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||| || ||||||||||| |||||||||| |||||| || ||||| || || ||  |
Sbjct: 488 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 429

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
           ||| ||||| ||   ||||||| ||||  |||| || |||||||| || ||||| || ||
Sbjct: 428 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 369

                                                                       
Query: 259 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
           ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 368 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 309

                               
Query: 319 gatgtggttgcggcagatgg 338
           ||||||||||||||||||||
Sbjct: 308 gatgtggttgcggcagatgg 289



to top

>gb|AC104602.3| Drosophila melanogaster X BAC RP98-16G6 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 161668

 Score =  149 bits (75), Expect = 7e-33
 Identities = 168/200 (84%)
 Strand = Plus / Minus

                                                                          
Query: 139    ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
              |||||| || ||||||||||| |||||||||| |||||| || ||||| || || ||  |
Sbjct: 133697 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 133638

                                                                          
Query: 199    cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
              ||| ||||| ||   ||||||| ||||  |||| || |||||||| || ||||| || ||
Sbjct: 133637 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 133578

                                                                          
Query: 259    ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
              ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 133577 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 133518

                                  
Query: 319    gatgtggttgcggcagatgg 338
              ||||||||||||||||||||
Sbjct: 133517 gatgtggttgcggcagatgg 133498



to top

>ref|NM_130496.2| Drosophila melanogaster Roc1a CG16982-RA (Roc1a), mRNA
          Length = 1168

 Score =  149 bits (75), Expect = 7e-33
 Identities = 168/200 (84%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||| || ||||||||||| |||||||||| |||||| || ||||| || || ||  |
Sbjct: 488 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 429

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
           ||| ||||| ||   ||||||| ||||  |||| || |||||||| || ||||| || ||
Sbjct: 428 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 369

                                                                       
Query: 259 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
           ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 368 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 309

                               
Query: 319 gatgtggttgcggcagatgg 338
           ||||||||||||||||||||
Sbjct: 308 gatgtggttgcggcagatgg 289



to top

>gb|AE003418.4| Drosophila melanogaster chromosome X, section 2 of 74 of the complete
              sequence
          Length = 315092

 Score =  149 bits (75), Expect = 7e-33
 Identities = 168/200 (84%)
 Strand = Plus / Minus

                                                                          
Query: 139    ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
              |||||| || ||||||||||| |||||||||| |||||| || ||||| || || ||  |
Sbjct: 117064 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 117005

                                                                          
Query: 199    cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
              ||| ||||| ||   ||||||| ||||  |||| || |||||||| || ||||| || ||
Sbjct: 117004 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 116945

                                                                          
Query: 259    ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
              ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 116944 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 116885

                                  
Query: 319    gatgtggttgcggcagatgg 338
              ||||||||||||||||||||
Sbjct: 116884 gatgtggttgcggcagatgg 116865



to top

>ref|XM_314102.2| Anopheles gambiae str. PEST ENSANGP00000010437
           (ENSANGG00000007948), mRNA
          Length = 612

 Score =  145 bits (73), Expect = 1e-31
 Identities = 163/194 (84%)
 Strand = Plus / Minus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           ||||| |||||||||||||||||||| |||||||| || || || || || ||| |||| 
Sbjct: 381 tgaccgtacttctggaactcccactctctgttgtcgagcggacagacctgccgggtcttc 322

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  ||||||| ||||| |||| ||||| || || || |||||||| || |||
Sbjct: 321 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 262

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           || |||||||||||||||   || ||||||||||||||||||||||| || |||||||||
Sbjct: 261 cattcctcgctggtggcggacgcttggttcgcctggcactcgatgcacagatccatgatg 202

                         
Query: 323 tggttgcggcagat 336
           || || ||||||||
Sbjct: 201 tgatttcggcagat 188



to top

>gb|AY302066.1| Populus tomentosa ring box protein mRNA, complete cds
          Length = 687

 Score =  143 bits (72), Expect = 4e-31
 Identities = 159/189 (84%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||| ||||||||||| |||||||||||||| || || |||||||||||||| ||| |
Sbjct: 417 ttagtggccatacttctgaaactcccactcgctattatcgagagggcacacttggcgggt 358

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
            |||||||| |||||||| ||| ||||| |||| ||||||||||| || ||||| || ||
Sbjct: 357 tttgagccatcggctgatacagtggaagtggaaggcatggttgcacacaccccaggcaac 298

                                                                       
Query: 259 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
            |||||||||||||| || || || || || || || |||||||| ||||| || |||||
Sbjct: 297 agtgcactcctcgcttgtagcactagcttgatttgcttggcactcaatgcaaagatccat 238

                    
Query: 319 gatgtggtt 327
           ||| |||||
Sbjct: 237 gatatggtt 229



to top

>emb|BX037579.1|CNS0915R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 468

 Score =  137 bits (69), Expect = 3e-29
 Identities = 162/194 (83%)
 Strand = Plus / Plus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           ||||| |||||||||||||||||||| |||||||| || || || || || ||| |||| 
Sbjct: 264 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 323

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  ||||||| ||||| |||| ||||| || || || |||||||| || |||
Sbjct: 324 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 383

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           || ||||||||||||||    || ||||||||||||||||||||||| || |||||||||
Sbjct: 384 cattcctcgctggtggctgacgcttggttcgcctggcactcgatgcacagatccatgatg 443

                         
Query: 323 tggttgcggcagat 336
           || || ||||||||
Sbjct: 444 tgatttcggcagat 457



to top

>gb|AY555146.1| Fragaria x ananassa putative ring-box protein mRNA, partial cds
          Length = 422

 Score =  133 bits (67), Expect = 4e-28
 Identities = 130/152 (85%)
 Strand = Plus / Minus

                                                                       
Query: 187 cacttgacggntcttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaac 246
           |||||| ||| |||||||||| | ||| |||||| ||||| |||| |||||||| |||||
Sbjct: 422 cacttggcgggtcttgagccatctgctaatgcagtggaagtggaaggcatggttacaaac 363

                                                                       
Query: 247 tccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgat 306
            |||||||| || || |||||||| || || || || |||||||||||||||||||||||
Sbjct: 362 cccccaagcaacagtacactcctcactcgtagcactcgcctggttcgcctggcactcgat 303

                                           
Query: 307 gcagaggtccatgatgtggttgcggcagatgg 338
           |||||||||||| || ||||| | ||||||||
Sbjct: 302 gcagaggtccataatatggttcctgcagatgg 271



to top

>emb|BX008706.1|CNS08EVQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score =  131 bits (66), Expect = 2e-27
 Identities = 163/195 (83%), Gaps = 1/195 (0%)
 Strand = Plus / Minus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           ||||| |||||||||||||||||||| |||||||| || || || || || ||| |||| 
Sbjct: 264 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 205

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  ||||||| ||||| |||| ||||| || || || |||||||| || |||
Sbjct: 204 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 145

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           || ||||||||||||| |   || ||||||||||||||||||||||| || |||||||||
Sbjct: 144 cattcctcgctggtggtg-acgcttggttcgcctggcactcgatgcacagatccatgatg 86

                          
Query: 323 tggttgcggcagatg 337
           || || |||||||||
Sbjct: 85  tgatttcggcagatg 71



to top

>emb|BX006952.1|CNS08DJ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score =  129 bits (65), Expect = 6e-27
 Identities = 162/194 (83%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           ||||| |||||||||||||||||||| |||||||| || || || || || ||| |||| 
Sbjct: 366 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 307

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  ||||||| ||||| |||| ||||| || || || |||||||| || |||
Sbjct: 306 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 247

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           || ||||||||||||| |   || ||||||||||||||||||||||| || |||||||||
Sbjct: 246 cattcctcgctggtggtg-acgcttggttcgcctggcactcgatgcacagatccatgatg 188

                         
Query: 323 tggttgcggcagat 336
           || || ||||||||
Sbjct: 187 tgatttcggcagat 174



to top

>emb|BX006498.1|CNS08D6E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 647

 Score =  129 bits (65), Expect = 6e-27
 Identities = 162/194 (83%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           ||||| |||||||||||||||||||| |||||||| || || || || || ||| |||| 
Sbjct: 365 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 306

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  ||||||| ||||| |||| ||||| || || || |||||||| || |||
Sbjct: 305 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 246

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           || ||||||||||||| |   || ||||||||||||||||||||||| || |||||||||
Sbjct: 245 cattcctcgctggtggtg-acgcttggttcgcctggcactcgatgcacagatccatgatg 187

                         
Query: 323 tggttgcggcagat 336
           || || ||||||||
Sbjct: 186 tgatttcggcagat 173



to top

>gb|AF480496.1| Oryza sativa clone BAC 49D11, complete sequence
          Length = 158050

 Score =  127 bits (64), Expect = 3e-26
 Identities = 70/73 (95%)
 Strand = Plus / Plus

                                                                         
Query: 177   ctagagggcacacttgacggntcttgagccaacggctgatgcagnggaagnggaatgcat 236
             |||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||
Sbjct: 56962 ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 57021

                          
Query: 237   ggttgcaaactcc 249
             |||||||||||||
Sbjct: 57022 ggttgcaaactcc 57034



 Score =  113 bits (57), Expect = 4e-22
 Identities = 60/61 (98%)
 Strand = Plus / Plus

                                                                         
Query: 248   ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 307
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 58593 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 58652

              
Query: 308   c 308
             |
Sbjct: 58653 c 58653



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 39/39 (100%)
 Strand = Plus / Plus

                                                    
Query: 140   tagtgaccatacttctggaactcccactcgctgttgtct 178
             |||||||||||||||||||||||||||||||||||||||
Sbjct: 56836 tagtgaccatacttctggaactcccactcgctgttgtct 56874



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                            
Query: 308   cagaggtccatgatgtggttgcggcagatgg 338
             |||||||||||||||||||||||||||||||
Sbjct: 58783 cagaggtccatgatgtggttgcggcagatgg 58813



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  127 bits (64), Expect = 3e-26
 Identities = 70/73 (95%)
 Strand = Plus / Minus

                                                                            
Query: 177      ctagagggcacacttgacggntcttgagccaacggctgatgcagnggaagnggaatgcat 236
                |||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||
Sbjct: 29305669 ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 29305610

                             
Query: 237      ggttgcaaactcc 249
                |||||||||||||
Sbjct: 29305609 ggttgcaaactcc 29305597



 Score =  113 bits (57), Expect = 4e-22
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                            
Query: 248      ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 307
                ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 29304038 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 29303979

                 
Query: 308      c 308
                |
Sbjct: 29303978 c 29303978



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 39/39 (100%)
 Strand = Plus / Minus

                                                       
Query: 140      tagtgaccatacttctggaactcccactcgctgttgtct 178
                |||||||||||||||||||||||||||||||||||||||
Sbjct: 29305795 tagtgaccatacttctggaactcccactcgctgttgtct 29305757



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                               
Query: 308      cagaggtccatgatgtggttgcggcagatgg 338
                |||||||||||||||||||||||||||||||
Sbjct: 29303848 cagaggtccatgatgtggttgcggcagatgg 29303818



to top

>dbj|AP005844.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBb0060O16
          Length = 164373

 Score =  127 bits (64), Expect = 3e-26
 Identities = 70/73 (95%)
 Strand = Plus / Minus

                                                                          
Query: 177    ctagagggcacacttgacggntcttgagccaacggctgatgcagnggaagnggaatgcat 236
              |||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||
Sbjct: 103014 ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 102955

                           
Query: 237    ggttgcaaactcc 249
              |||||||||||||
Sbjct: 102954 ggttgcaaactcc 102942



 Score =  113 bits (57), Expect = 4e-22
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                          
Query: 248    ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 307
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 101383 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 101324

               
Query: 308    c 308
              |
Sbjct: 101323 c 101323



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 39/39 (100%)
 Strand = Plus / Minus

                                                     
Query: 140    tagtgaccatacttctggaactcccactcgctgttgtct 178
              |||||||||||||||||||||||||||||||||||||||
Sbjct: 103140 tagtgaccatacttctggaactcccactcgctgttgtct 103102



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                             
Query: 308    cagaggtccatgatgtggttgcggcagatgg 338
              |||||||||||||||||||||||||||||||
Sbjct: 101193 cagaggtccatgatgtggttgcggcagatgg 101163



to top

>ref|NM_122064.2| Arabidopsis thaliana RBX1 AT5G20570 (RBX1) mRNA, complete cds
          Length = 692

 Score =  121 bits (61), Expect = 2e-24
 Identities = 163/198 (82%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||||||||| ||||| ||||||||||| ||||| || |  || || ||||||||  |
Sbjct: 447 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 388

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
           ||| ||||| | |||||||||| | ||| |||| || || |||||||| |||||||| ||
Sbjct: 387 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 328

                                                                       
Query: 259 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 327 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 268

                             
Query: 319 gatgtggttgcggcagat 336
           ||||||||| | ||||||
Sbjct: 267 gatgtggtttctgcagat 250



to top

>emb|BX020497.1|CNS08NZ9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 228

 Score =  121 bits (61), Expect = 2e-24
 Identities = 160/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           ||||| |||||||||||||||||||| |||||||| || || || || || ||| |||| 
Sbjct: 23  tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 82

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  || |||| ||||| |||| ||||| || || || |||||||| || | |
Sbjct: 83  agccatcgggagaagcagtggaagtggaacgcatgattacacacaccccaagccaccgcg 142

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           || ||||||||||||||    || ||||||||||||||||||||||| || |||||||||
Sbjct: 143 cattcctcgctggtggctgacgcttggttcgcctggcactcgatgcacagatccatgatg 202

                         
Query: 323 tggttgcggcagat 336
           || || ||||||||
Sbjct: 203 tgatttcggcagat 216



to top

>emb|BX020496.1|CNS08NZ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score =  121 bits (61), Expect = 2e-24
 Identities = 161/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           ||||| |||||||||||||||||||| |||||||| || || || || || ||| |||| 
Sbjct: 443 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 384

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  ||||||| ||||| |||| ||||| || || || |||||||| || | |
Sbjct: 383 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgcg 324

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           || ||||||||||||| |   || ||||||||||||||||||||||| || |||||||||
Sbjct: 323 cattcctcgctggtggtg-acgcttggttcgcctggcactcgatgcacagatccatgatg 265

                         
Query: 323 tggttgcggcagat 336
           || || ||||||||
Sbjct: 264 tgatttcggcagat 251



to top

>emb|BX008661.1|CNS08EUH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score =  121 bits (61), Expect = 2e-24
 Identities = 161/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Minus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           ||||| |||||||||||||||||||| |||||||| || || || || || ||| |||| 
Sbjct: 442 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 383

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  |||| || ||||| |||| ||||| || || || |||||||| || |||
Sbjct: 382 agccatcgggagatgaagtggaagtggaacgcatgattacacacaccccaagccaccgtg 323

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           || ||||||||||||| |   || ||||||||||||||||||||||| || |||||||||
Sbjct: 322 cattcctcgctggtggtg-acgcttggttcgcctggcactcgatgcacagatccatgatg 264

                         
Query: 323 tggttgcggcagat 336
           || || ||||||||
Sbjct: 263 tgatttcggcagat 250



to top

>gb|AY114719.1| Arabidopsis thaliana ring-box protein-like (At5g20570) mRNA,
           complete cds
          Length = 544

 Score =  121 bits (61), Expect = 2e-24
 Identities = 163/198 (82%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||||||||| ||||| ||||||||||| ||||| || |  || || ||||||||  |
Sbjct: 357 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 298

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
           ||| ||||| | |||||||||| | ||| |||| || || |||||||| |||||||| ||
Sbjct: 297 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 238

                                                                       
Query: 259 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 237 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 178

                             
Query: 319 gatgtggttgcggcagat 336
           ||||||||| | ||||||
Sbjct: 177 gatgtggtttctgcagat 160



to top

>gb|AY072430.1| Arabidopsis thaliana ring-box protein - like (At5g20570) mRNA,
           complete cds
          Length = 666

 Score =  121 bits (61), Expect = 2e-24
 Identities = 163/198 (82%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||||||||| ||||| ||||||||||| ||||| || |  || || ||||||||  |
Sbjct: 444 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 385

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
           ||| ||||| | |||||||||| | ||| |||| || || |||||||| |||||||| ||
Sbjct: 384 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 325

                                                                       
Query: 259 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 324 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 265

                             
Query: 319 gatgtggttgcggcagat 336
           ||||||||| | ||||||
Sbjct: 264 gatgtggtttctgcagat 247



to top

>gb|AY052401.1| Arabidopsis thaliana ring box-1-like protein mRNA, complete cds
          Length = 357

 Score =  121 bits (61), Expect = 2e-24
 Identities = 163/198 (82%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||||||||| ||||| ||||||||||| ||||| || |  || || ||||||||  |
Sbjct: 357 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 298

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
           ||| ||||| | |||||||||| | ||| |||| || || |||||||| |||||||| ||
Sbjct: 297 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 238

                                                                       
Query: 259 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 237 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 178

                             
Query: 319 gatgtggttgcggcagat 336
           ||||||||| | ||||||
Sbjct: 177 gatgtggtttctgcagat 160



to top

>gb|AY086913.1| Arabidopsis thaliana clone 29408 mRNA, complete sequence
          Length = 635

 Score =  121 bits (61), Expect = 2e-24
 Identities = 163/198 (82%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||||||||| ||||| ||||||||||| ||||| || |  || || ||||||||  |
Sbjct: 447 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 388

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
           ||| ||||| | |||||||||| | ||| |||| || || |||||||| |||||||| ||
Sbjct: 387 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 328

                                                                       
Query: 259 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 327 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 268

                             
Query: 319 gatgtggttgcggcagat 336
           ||||||||| | ||||||
Sbjct: 267 gatgtggtttctgcagat 250



to top

>dbj|AK118181.1| Arabidopsis thaliana At5g20570 mRNA for putative ring-box protein,
           complete cds, clone: RAFL19-50-B14
          Length = 665

 Score =  121 bits (61), Expect = 2e-24
 Identities = 163/198 (82%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||||||||| ||||| ||||||||||| ||||| || |  || || ||||||||  |
Sbjct: 438 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 379

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
           ||| ||||| | |||||||||| | ||| |||| || || |||||||| |||||||| ||
Sbjct: 378 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 319

                                                                       
Query: 259 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 318 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 259

                             
Query: 319 gatgtggttgcggcagat 336
           ||||||||| | ||||||
Sbjct: 258 gatgtggtttctgcagat 241



to top

>gb|AY027936.1| Salmo salar hyperosmotic protein 21 mRNA, complete cds
          Length = 1933

 Score =  119 bits (60), Expect = 6e-24
 Identities = 153/185 (82%)
 Strand = Plus / Minus

                                                                        
Query: 140  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
            ||||| ||||| ||||| ||||||||||| ||||||||||| |||||||| || | | ||
Sbjct: 1703 tagtgtccatatttctgaaactcccactccctgttgtctagggggcacacctgcctggtc 1644

                                                                        
Query: 200  ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
            || | |||||||  ||| ||| ||||  |||||||||| ||||| |||||||| || |||
Sbjct: 1643 ttcaaccaacgggagatacagtggaaatggaatgcatgattgcagactccccaggctacg 1584

                                                                        
Query: 260  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
            |||||||||||    |||||   ||||||||| ||||||||||| |||||||| ||||| 
Sbjct: 1583 gtgcactcctctgatgtggcagaggcctggttagcctggcactctatgcagagatccata 1524

                 
Query: 320  atgtg 324
            |||||
Sbjct: 1523 atgtg 1519



to top

>gb|DQ000158.1| Salmo salar hyperosmotic protein 21 (Shop21) gene, Shop21-2 allele,
            complete cds
          Length = 2855

 Score =  119 bits (60), Expect = 6e-24
 Identities = 153/185 (82%)
 Strand = Plus / Minus

                                                                        
Query: 140  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
            ||||| ||||| ||||| ||||||||||| ||||||||||| |||||||| || | | ||
Sbjct: 2825 tagtgtccatatttctgaaactcccactccctgttgtctagggggcacacctgcctggtc 2766

                                                                        
Query: 200  ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
            || | |||||||  ||| ||| ||||  |||||||||| ||||| |||||||| || |||
Sbjct: 2765 ttcaaccaacgggagatacagtggaaatggaatgcatgattgcagactccccaggctacg 2706

                                                                        
Query: 260  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
            |||||||||||    |||||   ||||||||| ||||||||||| |||||||| ||||| 
Sbjct: 2705 gtgcactcctctgatgtggcagaggcctggttagcctggcactctatgcagagatccata 2646

                 
Query: 320  atgtg 324
            |||||
Sbjct: 2645 atgtg 2641



to top

>gb|DQ000157.1| Salmo salar hyperosmotic protein 21 (Shop21) gene, Shop21-1 allele,
            complete cds
          Length = 3985

 Score =  119 bits (60), Expect = 6e-24
 Identities = 153/185 (82%)
 Strand = Plus / Minus

                                                                        
Query: 140  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
            ||||| ||||| ||||| ||||||||||| ||||||||||| |||||||| || | | ||
Sbjct: 3955 tagtgtccatatttctgaaactcccactccctgttgtctagggggcacacctgcctggtc 3896

                                                                        
Query: 200  ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
            || | |||||||  ||| ||| ||||  |||||||||| ||||| |||||||| || |||
Sbjct: 3895 ttcaaccaacgggagatacagtggaaatggaatgcatgattgcagactccccaggctacg 3836

                                                                        
Query: 260  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 319
            |||||||||||    |||||   ||||||||| ||||||||||| |||||||| ||||| 
Sbjct: 3835 gtgcactcctctgatgtggcagaggcctggttagcctggcactctatgcagagatccata 3776

                 
Query: 320  atgtg 324
            |||||
Sbjct: 3775 atgtg 3771



to top

>emb|BX012866.1|CNS08I3A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 537

 Score =  115 bits (58), Expect = 1e-22
 Identities = 154/187 (82%)
 Strand = Plus / Plus

                                                                       
Query: 149 tacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagccaa 208
           |||||||||||||||||||| |||||||| || || || || || ||| |||| ||||| 
Sbjct: 139 tacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttcagccat 198

                                                                       
Query: 209 cggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcactcc 268
           |||  || |||| ||||| |||| ||||| || || || |||||||| || ||||| |||
Sbjct: 199 cgggagaagcagtggaagtggaacgcatgattacacacaccccaagccaccgtgcattcc 258

                                                                       
Query: 269 tcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttg 328
           |||||||||||    || ||||||||||||||||||||||| |  ||||||||||| || 
Sbjct: 259 tcgctggtggctgacgcttggttcgcctggcactcgatgcacaaatccatgatgtgattt 318

                  
Query: 329 cggcaga 335
           |||||||
Sbjct: 319 cggcaga 325



to top

>emb|BX006499.1|CNS08D6F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 648

 Score =  113 bits (57), Expect = 4e-22
 Identities = 160/194 (82%), Gaps = 1/194 (0%)
 Strand = Plus / Plus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           ||||| |||||||||||||||||||| |||||||| || || || || || ||| |||| 
Sbjct: 226 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 285

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgc-atggttgcaaactccccaagcgacggt 261
           ||||| |||  || |||| ||||| |||| || ||| || || || |||||||| || ||
Sbjct: 286 agccatcgggagaagcagtggaagtggaacgccatgattacacacaccccaagccaccgt 345

                                                                       
Query: 262 gcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgat 321
           ||| ||||||||||||||    || ||||||||||||||||||||||| || ||||||||
Sbjct: 346 gcattcctcgctggtggctgacgcttggttcgcctggcactcgatgcacagatccatgat 405

                         
Query: 322 gtggttgcggcaga 335
           ||| || |||||||
Sbjct: 406 gtgatttcggcaga 419



to top

>emb|BX833527.1|CNS0A0LK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL60ZC05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 581

 Score =  113 bits (57), Expect = 4e-22
 Identities = 162/198 (81%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||||||||| ||||| ||||||||||| ||||| || |  || || ||||||||  |
Sbjct: 421 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 362

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
           ||| ||||| | |||||||||| | ||| |||| || || |||||||| |||||||| ||
Sbjct: 361 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 302

                                                                       
Query: 259 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 318
            |||||||| || || ||||  |||||||| || ||||| |||||||| || || |||||
Sbjct: 301 agtgcactcttcacttgtgggactggcctgattagcctgacactcgatacaaagatccat 242

                             
Query: 319 gatgtggttgcggcagat 336
           ||||||||| | ||||||
Sbjct: 241 gatgtggtttctgcagat 224



to top

>ref|XM_677021.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8844.2), mRNA
          Length = 351

 Score =  111 bits (56), Expect = 1e-21
 Identities = 152/185 (82%)
 Strand = Plus / Minus

                                                                       
Query: 149 tacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagccaa 208
           |||||||| |||||||| ||  |||| || |||||||||||||||||| | || ||||| 
Sbjct: 341 tacttctgaaactcccagtctttgttatcgagagggcacacttgacgggttttcagccag 282

                                                                       
Query: 209 cggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcactcc 268
           |||   || ||| ||||  |||||||||||||||||| ||||||||| || |||||||||
Sbjct: 281 cgggaaatacagtggaaatggaatgcatggttgcaaattccccaagcaactgtgcactcc 222

                                                                       
Query: 269 tcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttg 328
           ||| ||||||    | | ||||| || || |||||||||||||| ||||| |||||||| 
Sbjct: 221 tcggtggtggatgagccttggtttgcttgacactcgatgcagagatccataatgtggtta 162

                
Query: 329 cggca 333
           |||||
Sbjct: 161 cggca 157



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              complete sequence
          Length = 43261740

 Score =  105 bits (53), Expect = 9e-20
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                          
Query: 248    ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 307
              ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 371384 ccccaagcgacagtgcactcctcactggtggcgctggcctggttcgcctggcactcgatg 371325

               
Query: 308    c 308
              |
Sbjct: 371324 c 371324



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 314    tccatgatgtggttgcggcagatgg 338
              |||||||||||||||||||||||||
Sbjct: 371213 tccatgatgtggttgcggcagatgg 371189



to top

>dbj|AP002863.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0005A05
          Length = 190834

 Score =  105 bits (53), Expect = 9e-20
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                          
Query: 248    ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 307
              ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 123222 ccccaagcgacagtgcactcctcactggtggcgctggcctggttcgcctggcactcgatg 123163

               
Query: 308    c 308
              |
Sbjct: 123162 c 123162



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 314    tccatgatgtggttgcggcagatgg 338
              |||||||||||||||||||||||||
Sbjct: 123051 tccatgatgtggttgcggcagatgg 123027



to top

>dbj|AP002845.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0482C06
          Length = 182779

 Score =  105 bits (53), Expect = 9e-20
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                         
Query: 248   ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 307
             ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 11585 ccccaagcgacagtgcactcctcactggtggcgctggcctggttcgcctggcactcgatg 11526

              
Query: 308   c 308
             |
Sbjct: 11525 c 11525



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 314   tccatgatgtggttgcggcagatgg 338
             |||||||||||||||||||||||||
Sbjct: 11414 tccatgatgtggttgcggcagatgg 11390



to top

>gb|AY440092.1| Armigeres subalbatus ASAP ID: 42179 ubiquitin ligase mRNA sequence
          Length = 559

 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 117/142 (82%)
 Strand = Plus / Minus

                                                                       
Query: 135 catcttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgac 194
           |||| ||||| ||||| |||||||||||||| || ||||| || | ||| || ||||| |
Sbjct: 429 catcctagtgtccatatttctggaactcccattccctgttatccaaaggacagacttgtc 370

                                                                       
Query: 195 ggntcttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaag 254
           |  |||| |||||||||  ||||||| ||||  |||||||||| ||||| || ||||| |
Sbjct: 369 gtgtctttagccaacgggagatgcagtggaaatggaatgcatgattgcagacaccccagg 310

                                 
Query: 255 cgacggtgcactcctcgctggt 276
           | || |||||||||||||||||
Sbjct: 309 ccactgtgcactcctcgctggt 288



to top

>ref|NM_114151.1| Arabidopsis thaliana ubiquitin-protein ligase AT3G42830 mRNA,
           complete cds
          Length = 348

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 116/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 139 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggnt 198
           |||||||||||| |||||||| |||||||||| |   ||||| || |||||||||||  |
Sbjct: 348 ttagtgaccatatttctggaattcccactcgcagacatctagtggacacacttgacgagt 289

                                                                       
Query: 199 cttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgac 258
            |||||||| | |||||| ||| ||||| | || || ||||||||||| |||||||| ||
Sbjct: 288 tttgagccatctgctgatacagtggaagtgaaaggcgtggttgcaaaccccccaagcaac 229

                                
Query: 259 ggtgcactcctcgctggtggc 279
            ||||| ||||| || |||||
Sbjct: 228 agtgcattcctcactagtggc 208



to top

>gb|DQ446722.1| Arabidopsis thaliana clone pENTR221-At3g42830 ring-box protein
           Roc1/Rbx1/Hrt1 (At3g42830) mRNA, complete cds
          Length = 348

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 114/139 (82%)
 Strand = Plus / Minus

                                                                       
Query: 141 agtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntct 200
           |||||||||| |||||||| |||||||||| |   ||||| || |||||||||||  | |
Sbjct: 346 agtgaccatatttctggaattcccactcgcagacatctagtggacacacttgacgagttt 287

                                                                       
Query: 201 tgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacgg 260
           ||||||| | |||||| ||| ||||| | || || ||||||||||| |||||||| || |
Sbjct: 286 tgagccatctgctgatacagtggaagtgaaaggcgtggttgcaaaccccccaagcaacag 227

                              
Query: 261 tgcactcctcgctggtggc 279
           |||| ||||| || |||||
Sbjct: 226 tgcattcctcactagtggc 208



to top

>gb|BC081497.1| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:7251344), partial
           cds
          Length = 536

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 156/196 (79%)
 Strand = Plus / Minus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           |||||||||||||| ||||||||||| |||||||| || || |||||||| | | |||| 
Sbjct: 333 tgaccatacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttc 274

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  ||||||| ||||  | || || || ||||| |||||||| || || || 
Sbjct: 273 agccagcgggagatgcagtggaaatgaaaagcgtgattgcagactccccaggccaccgta 214

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           ||||||||   ||||||    ||||| || ||||| ||||| || ||||||||||| |||
Sbjct: 213 cactcctctgaggtggcagacgcctgattggcctgacactcaatacagaggtccataatg 154

                           
Query: 323 tggttgcggcagatgg 338
           || || | ||||||||
Sbjct: 153 tgatttctgcagatgg 138



to top

>ref|XM_688824.1| PREDICTED: Danio rerio similar to RING-box protein 1 (Rbx1)
           (LOC565545), mRNA
          Length = 544

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 156/196 (79%)
 Strand = Plus / Minus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           |||||||||||||| ||||||||||| |||||||| || || |||||||| | | |||| 
Sbjct: 337 tgaccatacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttc 278

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  ||||||| ||||  | || || || ||||| |||||||| || || || 
Sbjct: 277 agccagcgggagatgcagtggaaatgaaaagcgtgattgcagactccccaggccaccgta 218

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           ||||||||   ||||||    ||||| || ||||| ||||| || ||||||||||| |||
Sbjct: 217 cactcctctgaggtggcagacgcctgattggcctgacactcaatacagaggtccataatg 158

                           
Query: 323 tggttgcggcagatgg 338
           || || | ||||||||
Sbjct: 157 tgatttctgcagatgg 142



to top

>gb|BC107831.1| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:7221021), partial
           cds
          Length = 570

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 156/196 (79%)
 Strand = Plus / Minus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           |||||||||||||| ||||||||||| |||||||| || || |||||||| | | |||| 
Sbjct: 366 tgaccatacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttc 307

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           ||||| |||  ||||||| ||||  | || || || ||||| |||||||| || || || 
Sbjct: 306 agccagcgggagatgcagtggaaatgaaaagcgtgattgcagactccccaggccaccgta 247

                                                                       
Query: 263 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 322
           ||||||||   ||||||    ||||| || ||||| ||||| || ||||||||||| |||
Sbjct: 246 cactcctctgaggtggcagacgcctgattggcctgacactcaatacagaggtccataatg 187

                           
Query: 323 tggttgcggcagatgg 338
           || || | ||||||||
Sbjct: 186 tgatttctgcagatgg 171



to top

>gb|AC010010.6| Drosophila melanogaster 3L BAC RP98-13F6 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 167977

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                             
Query: 292    cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
              |||||||||||||||||| |||| |||||||||||| ||||||||||
Sbjct: 120733 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatgg 120687



to top

>ref|NM_144356.2| Drosophila melanogaster Roc1b CG16988-RA (Roc1b), mRNA
          Length = 514

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 292 cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
           |||||||||||||||||| |||| |||||||||||| ||||||||||
Sbjct: 269 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatgg 223



to top

>ref|NM_138189.2| Drosophila melanogaster CG6905-RA (CG6905), mRNA
          Length = 3359

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                           
Query: 292  cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
            |||||||||||||||||| |||| |||||||||||| ||||||||||
Sbjct: 2948 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatgg 2994



to top

>gb|AY070810.1| Drosophila melanogaster AT21612 full length cDNA
          Length = 553

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 292 cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
           |||||||||||||||||| |||| |||||||||||| ||||||||||
Sbjct: 269 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatgg 223



to top

>gb|AY061302.1| Drosophila melanogaster LD21614 full length cDNA
          Length = 3185

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                           
Query: 292  cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
            |||||||||||||||||| |||| |||||||||||| ||||||||||
Sbjct: 2768 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatgg 2814



to top

>gb|AF218290.1|AF218290 Drosophila melanogaster ring finger protein ROC1B gene, complete
           cds
          Length = 750

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 292 cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
           |||||||||||||||||| |||| |||||||||||| ||||||||||
Sbjct: 397 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatgg 351



to top

>gb|AE003468.3| Drosophila melanogaster chromosome 3L, section 2 of 83 of the complete
             sequence
          Length = 307657

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                            
Query: 292   cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
             |||||||||||||||||| |||| |||||||||||| ||||||||||
Sbjct: 38329 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatgg 38283



to top

>gb|DQ306845.1| Hevea brasiliensis isolate SSH116 mRNA sequence
          Length = 330

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| |||||||| ||||| ||||||||||| |||||  |||||||||||||||||  |
Sbjct: 265 tagtggccatacttttggaaatcccactcgctattgtcaggagggcacacttgacggggc 324

                 
Query: 200 ttgagc 205
           ||||||
Sbjct: 325 ttgagc 330



to top

>gb|DQ306836.1| Hevea brasiliensis isolate SSH107 mRNA sequence
          Length = 330

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| |||||||| ||||| ||||||||||| |||||  |||||||||||||||||  |
Sbjct: 265 tagtggccatacttttggaaatcccactcgctattgtcaggagggcacacttgacggggc 324

                 
Query: 200 ttgagc 205
           ||||||
Sbjct: 325 ttgagc 330



to top

>emb|CT033337.1| Platynereis dumerilii EST IB0AAA22BD06EM1
          Length = 561

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 113/140 (80%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |   ||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| |     |||||| | ||| |||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                               
Query: 260 gtgcactcctcgctggtggc 279
           ||||| ||||| ||||||||
Sbjct: 228 gtgcattcctcactggtggc 209



to top

>emb|CT033336.1| Platynereis dumerilii EST IB0AAA22BD06FM1
          Length = 561

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |   ||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| |     |||||| | ||| |||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                               
Query: 260 gtgcactcctcgctggtggc 279
           ||||| ||||| ||||||||
Sbjct: 334 gtgcattcctcactggtggc 353



to top

>emb|CT032976.1| Platynereis dumerilii EST IB0AAA28CF05EM1
          Length = 561

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 113/140 (80%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |   ||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| |     |||||| | ||| |||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                               
Query: 260 gtgcactcctcgctggtggc 279
           ||||| ||||| ||||||||
Sbjct: 228 gtgcattcctcactggtggc 209



to top

>emb|CT032975.1| Platynereis dumerilii EST IB0AAA28CF05FM1
          Length = 561

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |   ||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| |     |||||| | ||| |||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                               
Query: 260 gtgcactcctcgctggtggc 279
           ||||| ||||| ||||||||
Sbjct: 334 gtgcattcctcactggtggc 353



to top

>emb|CT032443.1| Platynereis dumerilii EST IB0AAA38AF03EM1
          Length = 561

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 113/140 (80%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |   ||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| |     |||||| | ||| |||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                               
Query: 260 gtgcactcctcgctggtggc 279
           ||||| ||||| ||||||||
Sbjct: 228 gtgcattcctcactggtggc 209



to top

>emb|CT032442.1| Platynereis dumerilii EST IB0AAA38AF03FM1
          Length = 561

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |   ||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| |     |||||| | ||| |||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                               
Query: 260 gtgcactcctcgctggtggc 279
           ||||| ||||| ||||||||
Sbjct: 334 gtgcattcctcactggtggc 353



to top

>emb|CT032439.1| Platynereis dumerilii EST IB0AAA38AH04FM1
          Length = 561

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |   ||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| |     |||||| | ||| |||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                               
Query: 260 gtgcactcctcgctggtggc 279
           ||||| ||||| ||||||||
Sbjct: 334 gtgcattcctcactggtggc 353



to top

>emb|CT032267.1| Platynereis dumerilii EST IB0AAA42AB12EM1
          Length = 561

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 113/140 (80%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |   ||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| |     |||||| | ||| |||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                               
Query: 260 gtgcactcctcgctggtggc 279
           ||||| ||||| ||||||||
Sbjct: 228 gtgcattcctcactggtggc 209



to top

>emb|CT032266.1| Platynereis dumerilii EST IB0AAA42AB12FM1
          Length = 561

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |   ||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           || ||||| |     |||||| | ||| |||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                               
Query: 260 gtgcactcctcgctggtggc 279
           ||||| ||||| ||||||||
Sbjct: 334 gtgcattcctcactggtggc 353



to top

>ref|XM_756798.1| Ustilago maydis 521 hypothetical protein (UM05744.1) partial mRNA
          Length = 483

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 141/178 (79%)
 Strand = Plus / Minus

                                                                       
Query: 161 tcccactcgctgttgtctagagggcacacttgacggntcttgagccaacggctgatgcag 220
           ||||| || |||||||| || ||||| || |||||  |||||||||| ||    ||||||
Sbjct: 389 tcccaatctctgttgtcgagcgggcatacctgacgtgtcttgagccatcgtgaaatgcag 330

                                                                       
Query: 221 nggaagnggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctggtggcg 280
            ||||| |||| |||||||||||    ||||||||||||||||| || ||  | || || 
Sbjct: 329 tggaagtggaaagcatggttgcattgaccccaagcgacggtgcattcttccgtagtagca 270

                                                                     
Query: 281 ctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
             | ||||||| |||||||| |||||||| || ||||| |||||||| | ||||||||
Sbjct: 269 gagccctggttggcctggcattcgatgcaaagatccataatgtggtttctgcagatgg 212



to top

>emb|CR712304.2|CNS0GCKC Tetraodon nigroviridis full-length cDNA
          Length = 468

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR711741.2|CNS0GC4P Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR718984.2|CNS0GHPQ Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 147 ttcctgcagatgg 135



to top

>emb|CR718953.2|CNS0GHOV Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR718828.2|CNS0GHLE Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR718557.2|CNS0GHDV Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 153 ttcctgcagatgg 141



to top

>emb|CR717778.2|CNS0GGS8 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR717707.2|CNS0GGQ9 Tetraodon nigroviridis full-length cDNA
          Length = 450

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 320 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 261

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 260 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 201

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 200 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 141

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 140 ttcctgcagatgg 128



to top

>emb|CR717638.2|CNS0GGOC Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 164 ttcctgcagatgg 152



to top

>emb|CR717357.2|CNS0GGGJ Tetraodon nigroviridis full-length cDNA
          Length = 461

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 154 ttcctgcagatgg 142



to top

>emb|CR717269.2|CNS0GGE3 Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 159 ttcctgcagatgg 147



to top

>emb|CR717135.2|CNS0GGAG Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 159 ttcctgcagatgg 147



to top

>emb|CR716834.2|CNS0GG23 Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 147 ttcctgcagatgg 135



to top

>emb|CR716017.2|CNS0GFFH Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR715173.2|CNS0GES1 Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR714756.2|CNS0GEGG Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 147 ttcctgcagatgg 135



to top

>emb|CR715040.2|CNS0GEOC Tetraodon nigroviridis full-length cDNA
          Length = 514

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 384 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 325

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 324 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 265

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           ||||||   |||||    |||||||| |||||||| || || || || |||||||| |||
Sbjct: 264 tcctcggatgtggcagaagcctggttggcctggcattctatacacagatccatgatatgg 205

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 204 ttcctgcagatgg 192



to top

>emb|CR711398.2|CNS0GBV6 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR714255.2|CNS0GE2J Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 153 ttcctgcagatgg 141



to top

>emb|CR713764.2|CNS0GDOW Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR713551.2|CNS0GDIZ Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 153 ttcctgcagatgg 141



to top

>emb|CR713038.2|CNS0GD4Q Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 323 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 264

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 263 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 204

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 203 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 144

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 143 ttcctgcagatgg 131



to top

>emb|CR712711.2|CNS0GCVN Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 150 ttcctgcagatgg 138



to top

>emb|CR712093.2|CNS0GCEH Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR710993.2|CNS0GBJX Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR710591.2|CNS0GB8R Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 153 ttcctgcagatgg 141



to top

>emb|CR710156.2|CNS0GAWO Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 356 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 297

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 296 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 237

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 236 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 177

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 176 ttcctgcagatgg 164



to top

>emb|CR709913.2|CNS0GAPX Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 164 ttcctgcagatgg 152



to top

>emb|CR709418.2|CNS0GAC6 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR709337.2|CNS0GA9X Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 323 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 264

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 263 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 204

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 203 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 144

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 143 ttcctgcagatgg 131



to top

>emb|CR708996.2|CNS0GA0G Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR709183.2|CNS0GA5N Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 164 ttcctgcagatgg 152



to top

>emb|CR709075.2|CNS0GA2N Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 154 ttcctgcagatgg 142



to top

>emb|CR708377.2|CNS0G9J9 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR708266.2|CNS0G9G6 Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR708263.2|CNS0G9G3 Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 150 ttcctgcagatgg 138



to top

>emb|CR707631.2|CNS0G8YJ Tetraodon nigroviridis full-length cDNA
          Length = 459

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 150 ttcctgcagatgg 138



to top

>emb|CR707603.2|CNS0G8XR Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR705966.2|CNS0G7OA Tetraodon nigroviridis full-length cDNA
          Length = 472

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 342 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 283

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 282 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 223

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 222 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 163

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 162 ttcctgcagatgg 150



to top

>emb|CR706999.2|CNS0G8GZ Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR706688.2|CNS0G88C Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 159 ttcctgcagatgg 147



to top

>emb|CR706606.2|CNS0G862 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR706092.2|CNS0G7RS Tetraodon nigroviridis full-length cDNA
          Length = 707

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 577 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 518

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 517 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 458

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 457 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 398

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 397 ttcctgcagatgg 385



to top

>emb|CR705735.2|CNS0G7HV Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR705000.2|CNS0G6XG Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcaaaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 150 ttcctgcagatgg 138



to top

>emb|CR704952.2|CNS0G6W4 Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 153 ttcctgcagatgg 141



to top

>emb|CR704915.2|CNS0G6V3 Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 164 ttcctgcagatgg 152



to top

>emb|CR705166.2|CNS0G722 Tetraodon nigroviridis full-length cDNA
          Length = 454

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 150 ttcctgcagatgg 138



to top

>emb|CR704225.2|CNS0G6BX Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 159 ttcctgcagatgg 147



to top

>emb|CR702171.2|CNS0G4QV Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR696134.2|CNS0G036 Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 150 ttcctgcagatgg 138



to top

>emb|CR685564.2|CNS0FRXK Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 154 ttcctgcagatgg 142



to top

>emb|CR684241.2|CNS0FQWT Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 150 ttcctgcagatgg 138



to top

>emb|CR683717.2|CNS0FQI9 Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR659058.2|CNS0F7I0 Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 147 ttcctgcagatgg 135



to top

>emb|CR633484.2|CNS0ENRM Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR632165.2|CNS0EMQZ Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR631384.2|CNS0EM59 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>ref|NM_001034135.1| Rattus norvegicus ring-box 1 (Rbx1), mRNA
          Length = 1549

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           |||||||| |||||||||||||| |||||||| |  |||||||| || | | | ||||||
Sbjct: 325 ccatacttttggaactcccactctctgttgtccaaggggcacacctgcctggttttgagc 266

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || ||   ||||||| ||||  | || || ||||| || ||||||||||| || ||||||
Sbjct: 265 caccgagagatgcagtggaaatgaaaagcgtggttacagactccccaagcaaccgtgcac 206

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           || ||    || ||   ||||||||| ||||| |||||||| || || ||||| ||||||
Sbjct: 205 tcttccgaagtagctgaggcctggttggcctgacactcgatacaaagatccataatgtgg 146

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 145 ttcctgcagatgg 133



to top

>gb|BC100258.1| Rattus norvegicus ring-box 1, mRNA (cDNA clone MGC:116275
           IMAGE:7444286), complete cds
          Length = 1549

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 152/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           |||||||| |||||||||||||| |||||||| |  |||||||| || | | | ||||||
Sbjct: 325 ccatacttttggaactcccactctctgttgtccaaggggcacacctgcctggttttgagc 266

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || ||   ||||||| ||||  | || || ||||| || ||||||||||| || ||||||
Sbjct: 265 caccgagagatgcagtggaaatgaaaagcgtggttacagactccccaagcaaccgtgcac 206

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           || ||    || ||   ||||||||| ||||| |||||||| || || ||||| ||||||
Sbjct: 205 tcttccgaagtagctgaggcctggttggcctgacactcgatacaaagatccataatgtgg 146

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 145 ttcctgcagatgg 133



to top

>emb|CT032440.1| Platynereis dumerilii EST IB0AAA38AH04EM1
          Length = 561

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 215 atgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctg 274
           |||||| | ||| |||| ||||| |||||||||||||||||||| ||||| |||||  ||
Sbjct: 273 atgcagtgaaagtggaaagcatgattgcaaactccccaagcgactgtgcattcctcattg 214

                
Query: 275 gtggc 279
           |||||
Sbjct: 213 gtggc 209



to top

>gb|AC084553.1|CBRG33P21 Caenorhabditis briggsae cosmid G33P21, complete sequence
          Length = 40197

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 293  gcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
            ||||||||||||||||| || ||||||||||| |||||||| ||||
Sbjct: 5345 gcctggcactcgatgcacagatccatgatgtgattgcggcaaatgg 5300



to top

>ref|XM_957982.1| Neurospora crassa OR74A hypothetical protein (NCU06224.1) partial
           mRNA
          Length = 351

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 152 ttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagcca 207
           |||||||||||||| || |||||||| |||||||| ||||||||   |||||||||
Sbjct: 338 ttctggaactcccaatctctgttgtcgagagggcatacttgacgcgccttgagcca 283



to top

>ref|XM_326078.1| Neurospora crassa OR74A hypothetical protein (NCU06224.1) partial
           mRNA
          Length = 351

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 152 ttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagcca 207
           |||||||||||||| || |||||||| |||||||| ||||||||   |||||||||
Sbjct: 338 ttctggaactcccaatctctgttgtcgagagggcatacttgacgcgccttgagcca 283



to top

>gb|DQ311404.1| Bombyx mori ring box protein mRNA, complete cds
          Length = 1058

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 143 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttg 202
           ||||||||||| ||||||||||| || || |||||||| || || ||||| ||  |||| 
Sbjct: 721 tgaccatacttttggaactcccattctctattgtctagtggacaaacttgtcgagtcttc 662

                                                                       
Query: 203 agccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtg 262
           | |||||||   || ||| ||||  |||||||||| || ||||| |||||||| || |||
Sbjct: 661 aaccaacgggaaatacagtggaaatggaatgcatgattacaaacaccccaagcaactgtg 602

             
Query: 263 ca 264
           ||
Sbjct: 601 ca 600



to top

>gb|BC051473.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:62905 IMAGE:1430400),
           complete cds
          Length = 531

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 332 ccatacttctggaactcccactctctgttgtc 301



to top

>gb|AC112970.18| Mus musculus chromosome 17, clone RP24-443D19, complete sequence
          Length = 172747

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                              
Query: 146    ccatacttctggaactcccactcgctgttgtc 177
              ||||||||||||||||||||||| ||||||||
Sbjct: 114187 ccatacttctggaactcccactctctgttgtc 114156



to top

>ref|NM_019712.2| Mus musculus ring-box 1 (Rbx1), mRNA
          Length = 1612

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 320 ccatacttctggaactcccactctctgttgtc 289



to top

>gb|BC083057.1| Mus musculus ring-box 1, mRNA (cDNA clone IMAGE:5329240), ****
           WARNING: chimeric clone ****
          Length = 2818

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 325 ccatacttctggaactcccactctctgttgtc 294



to top

>emb|Z70757.1|CEZK287 Caenorhabditis elegans Cosmid ZK287, complete sequence
          Length = 39874

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 290   ttcgcctggcactcgatgcagaggtccatgatgtggttgcggca 333
             ||||| |||||||||||||| || ||||||||||| ||||||||
Sbjct: 27216 ttcgcttggcactcgatgcacagatccatgatgtgattgcggca 27259



to top

>emb|CR718972.2|CNS0GHPE Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 151/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  |||  || ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatatagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 164 ttcctgcagatgg 152



to top

>emb|CR716350.2|CNS0GFON Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 151/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| | | ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagataccgtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR715418.2|CNS0GEYU Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 151/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||| ||| | |||||| || |||||||| || | | | || | |
Sbjct: 334 ccatatttctgaaactcccgctcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 154 ttcctgcagatgg 142



to top

>emb|CR708622.2|CNS0G9Q2 Tetraodon nigroviridis full-length cDNA
          Length = 461

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 151/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| |||||||| || || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttacacacaccccaggccaccgtgcac 215

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 154 ttcctgcagatgg 142



to top

>emb|CR707762.2|CNS0G926 Tetraodon nigroviridis full-length cDNA
          Length = 475

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                
Query: 266 tcctc 270
           |||||
Sbjct: 224 tcctc 220



to top

>emb|CR707479.2|CNS0G8UB Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                
Query: 266 tcctc 270
           |||||
Sbjct: 215 tcctc 211



to top

>emb|CR670549.2|CNS0FGD7 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 151/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| ||   | | || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtttggttttcaac 276

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 155 ttcctgcagatgg 143



to top

>emb|CR659962.2|CNS0F874 Tetraodon nigroviridis full-length cDNA
          Length = 472

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 151/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||||||||| | |||||| || |||||||| ||   | | || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtttggttttcaac 285

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 164 ttcctgcagatgg 152



to top

>emb|CR632856.2|CNS0ENA6 Tetraodon nigroviridis full-length cDNA
          Length = 455

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 151/193 (78%)
 Strand = Plus / Minus

                                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagc 205
           ||||| ||||| ||||| ||||| | |||||| || |||||||| || | | | || | |
Sbjct: 329 ccatatttctgaaactctcactcccggttgtccagtgggcacacctgtctggttttcaac 270

                                                                       
Query: 206 caacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcac 265
           || |||  ||| ||| ||||| |||| ||||||||||| || ||||| || || ||||||
Sbjct: 269 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 210

                                                                       
Query: 266 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 325
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 209 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 150

                        
Query: 326 ttgcggcagatgg 338
           || | ||||||||
Sbjct: 149 ttcctgcagatgg 137



to top

>gb|BC056992.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:66938 IMAGE:6818827),
           complete cds
          Length = 1612

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 320 ccatacttctggaactcccactctctgttgtc 289



to top

>dbj|AK152012.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830045D16 product:ring-box 1,
           full insert sequence
          Length = 503

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 334 ccatacttctggaactcccactctctgttgtc 303



to top

>dbj|AK159571.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420024J09 product:ring-box 1, full
           insert sequence
          Length = 503

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 334 ccatacttctggaactcccactctctgttgtc 303



to top

>dbj|AK003159.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1100001E18 product:ring-box 1,
           full insert sequence
          Length = 507

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 339 ccatacttctggaactcccactctctgttgtc 308



to top

>dbj|AK005127.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1500002P15 product:ring-box 1, full
           insert sequence
          Length = 1623

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 341 ccatacttctggaactcccactctctgttgtc 310



to top

>ref|NM_073095.4| Caenorhabditis elegans yeast RBX (ring finger protein) homolog
           family member (rbx-1) (rbx-1) mRNA, complete cds
          Length = 664

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 290 ttcgcctggcactcgatgcagaggtccatgatgtggttgcggca 333
           ||||| |||||||||||||| || ||||||||||| ||||||||
Sbjct: 277 ttcgcttggcactcgatgcacagatccatgatgtgattgcggca 234



to top

>dbj|AK004114.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110035J03 product:ring-box 1,
           full insert sequence
          Length = 969

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 341 ccatacttctggaactcccactctctgttgtc 310



to top

>dbj|AK183716.1| Mus musculus cDNA, clone:Y0G0126N24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023036, based on BLAT search
          Length = 416

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 271 ccatacttctggaactcccactctctgttgtc 240



to top

>dbj|AK182752.1| Mus musculus cDNA, clone:Y0G0123J24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023036, based on BLAT search
          Length = 398

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 271 ccatacttctggaactcccactctctgttgtc 240



to top

>dbj|AB077287.1| Caenorhabditis elegans Ce-rbx-1 mRNA for RING-H2 finger protein
           Rbx1, complete cds
          Length = 361

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 290 ttcgcctggcactcgatgcagaggtccatgatgtggttgcggca 333
           ||||| |||||||||||||| || ||||||||||| ||||||||
Sbjct: 181 ttcgcttggcactcgatgcacagatccatgatgtgattgcggca 138



to top

>gb|BC027396.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:35907 IMAGE:4952242),
           complete cds
          Length = 1616

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 326 ccatacttctggaactcccactctctgttgtc 295



to top

>gb|AF140599.1|AF140599 Mus musculus ring-box protein 1 (Rbx1) mRNA, complete cds
          Length = 504

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 146 ccatacttctggaactcccactcgctgttgtc 177
           ||||||||||||||||||||||| ||||||||
Sbjct: 337 ccatacttctggaactcccactctctgttgtc 306



to top

>emb|CR974451.9| Mouse DNA sequence from clone RP24-180B11 on chromosome 17, complete
              sequence
          Length = 188873

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                              
Query: 146    ccatacttctggaactcccactcgctgttgtc 177
              ||||||||||||||||||||||| ||||||||
Sbjct: 160026 ccatacttctggaactcccactctctgttgtc 160057



to top

>ref|XM_363999.1| Magnaporthe grisea 70-15 hypothetical protein (MG08844.4) partial
           cds
          Length = 702

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 100/125 (80%)
 Strand = Plus / Minus

                                                                       
Query: 214 gatgcagnggaagnggaatgcatggttgcaaactccccaagcgacggtgcactcctcgct 273
           ||||||| ||||| |||| || || ||||| |  ||||| || || ||||||||||||||
Sbjct: 285 gatgcagtggaagtggaaagcgtgattgcagataccccaggcaacagtgcactcctcgct 226

                                                                       
Query: 274 ggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggca 333
            ||||||   || ||||| |||||||| || || || || ||||||||||| || | |||
Sbjct: 225 cgtggcggatgcttggtttgcctggcattcaatacaaagatccatgatgtgattcctgca 166

                
Query: 334 gatgg 338
           |||||
Sbjct: 165 gatgg 161



to top

>ref|XM_416239.1| PREDICTED: Gallus gallus similar to RBX1 protein (LOC418001), mRNA
          Length = 1242

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                        
Query: 140  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
            ||||| || ||||| ||||||||||| || |||||||| || ||||| ||||| ||  | 
Sbjct: 1079 tagtgtccgtacttttggaactcccattccctgttgtccagtgggcatacttggcgagtt 1020

                                                                        
Query: 200  ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
            |||||||| ||   ||||||| ||||| |||| || || ||||| || ||||| || || 
Sbjct: 1019 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacaccccatgcaacc 960

                    
Query: 260  gtgcactc 267
            ||||||||
Sbjct: 959  gtgcactc 952



to top

>ref|XM_881804.1| PREDICTED: Bos taurus similar to RING-box protein 1 (Rbx1),
           transcript variant 2 (LOC518880), mRNA
          Length = 862

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || ||  | 
Sbjct: 472 tagtgcccatacttttggaattcccactctctgttgtccaacggacacacctgccgtgtt 413

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| ||   ||||||| ||||| | || |||||||| || || ||||| || |||
Sbjct: 412 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagacgccccacgccacg 353

                   
Query: 260 gtgcactc 267
           ||||||||
Sbjct: 352 gtgcactc 345



to top

>ref|XM_597082.2| PREDICTED: Bos taurus similar to RING-box protein 1 (Rbx1),
           transcript variant 1 (LOC518880), mRNA
          Length = 832

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || ||  | 
Sbjct: 356 tagtgcccatacttttggaattcccactctctgttgtccaacggacacacctgccgtgtt 297

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| ||   ||||||| ||||| | || |||||||| || || ||||| || |||
Sbjct: 296 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagacgccccacgccacg 237

                   
Query: 260 gtgcactc 267
           ||||||||
Sbjct: 236 gtgcactc 229



to top

>ref|XM_748960.1| Aspergillus fumigatus Af293 ubiquitin ligase subunit HrtA
           (Afu5g05790) partial mRNA
          Length = 363

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 228 ggaatgcatggttgcaaactccccaagcgacggtgcactcctc 270
           |||||||||||||||||| |||||| || || |||||||||||
Sbjct: 274 ggaatgcatggttgcaaattccccaggctactgtgcactcctc 232



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 290 ttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagat 336
           |||||||||||||| || || |  |||||||||||||||||||||||
Sbjct: 212 ttcgcctggcactcaatacacaaatccatgatgtggttgcggcagat 166



to top

>gb|BC105329.1| Bos taurus similar to RING-box protein 1 (Rbx1), transcript variant
           1, mRNA (cDNA clone MGC:127542 IMAGE:7949130), complete
           cds
          Length = 1504

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || ||  | 
Sbjct: 348 tagtgcccatacttttggaattcccactctctgttgtccaacggacacacctgccgtgtt 289

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| ||   ||||||| ||||| | || |||||||| || || ||||| || |||
Sbjct: 288 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagacgccccacgccacg 229

                   
Query: 260 gtgcactc 267
           ||||||||
Sbjct: 228 gtgcactc 221



to top

>emb|CR390140.1| Gallus gallus finished cDNA, clone ChEST162j5
          Length = 484

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| || ||||| ||||||||||| || |||||||| || ||||| ||||| ||  | 
Sbjct: 321 tagtgtccgtacttttggaactcccattccctgttgtccagtgggcatacttggcgagtt 262

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| ||   ||||||| ||||| |||| || || ||||| || ||||| || || 
Sbjct: 261 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacaccccatgcaacc 202

                   
Query: 260 gtgcactc 267
           ||||||||
Sbjct: 201 gtgcactc 194



to top

>emb|BX470254.7| Zebrafish DNA sequence from clone CH211-256M1 in linkage group 3,
             complete sequence
          Length = 146746

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                         
Query: 149   tacttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagccaa 208
             |||||||| ||||||||||| |||||||| || || |||||||| | | |||| ||||| 
Sbjct: 98511 tacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttcagccag 98452

                              
Query: 209   cggctgatgcagnggaa 225
             |||  ||||||| ||||
Sbjct: 98451 cgggagatgcagtggaa 98435



to top

>gb|DQ213704.1| Taeniopygia guttata clone 0058P0062F10 RBX1 protein-like mRNA,
           complete sequence
          Length = 519

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 104/131 (79%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| |||||||| ||||||||||| || |||||||| || || || ||||| ||  | 
Sbjct: 338 tagtgtccatacttttggaactcccattccctgttgtccagtggacatacttggcgtgtt 279

                                                                       
Query: 200 ttgagccaacggctgatgcagnggaagnggaatgcatggttgcaaactccccaagcgacg 259
           |||||||| ||   ||||||| ||||| |||| || || ||||| || ||||| || || 
Sbjct: 278 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacgccccatgcaact 219

                      
Query: 260 gtgcactcctc 270
           ||||| |||||
Sbjct: 218 gtgcattcctc 208



to top

>ref|XM_382673.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG02497.1)
           partial mRNA
          Length = 333

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 94/117 (80%)
 Strand = Plus / Minus

                                                                       
Query: 222 ggaagnggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctggtggcgc 281
           ||||| |||||||||||||||| |  ||||| || || ||||| || |||||||| ||  
Sbjct: 250 ggaagtggaatgcatggttgcagataccccaggccacagtgcattcttcgctggtagcag 191

                                                                    
Query: 282 tggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
             || ||||||||||| || || ||||| || ||||| ||||| || ||||||||||
Sbjct: 190 atgcttggttcgcctgacattctatgcacagatccataatgtgattacggcagatgg 134



to top

>emb|AL954851.5| Zebrafish DNA sequence from clone CH211-280J3, complete sequence
          Length = 177221

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                          
Query: 150    acttctggaactcccactcgctgttgtctagagggcacacttgacggntcttgagccaac 209
              ||||||| ||||||||||| |||||||| || || |||||||| | | |||| ||||| |
Sbjct: 108354 acttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttcagccagc 108413

                              
Query: 210    ggctgatgcagnggaa 225
              ||  ||||||| ||||
Sbjct: 108414 gggagatgcagtggaa 108429



to top

>gb|AC109153.13| Mus musculus chromosome 15, clone RP23-51J23, complete sequence
          Length = 222164

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 149   tacttctggaactcccactcgctgttgtc 177
             |||||||||||||||||||| ||||||||
Sbjct: 57939 tacttctggaactcccactctctgttgtc 57967



to top

>dbj|AK116119.1| Ciona intestinalis cDNA, clone:citb010m18, full insert sequence
          Length = 830

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 144 gaccatacttctggaactcccactc 168
           |||||||||||||||||||||||||
Sbjct: 364 gaccatacttctggaactcccactc 340



to top

>gb|AC160528.9| Mus musculus chromosome 15, clone RP23-310L8, complete sequence
          Length = 174502

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 149   tacttctggaactcccactcgctgttgtc 177
             |||||||||||||||||||| ||||||||
Sbjct: 24555 tacttctggaactcccactctctgttgtc 24527



to top

>emb|CT027911.1| Xenopus tropicalis finished cDNA, clone TEgg095b23
          Length = 561

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 287 tggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatgg 338
           ||||| || |||||||| ||||| | ||||||||||||||| | ||||||||
Sbjct: 190 tggtttgcttggcactctatgcacaagtccatgatgtggttcctgcagatgg 139



to top

>gb|DQ103593.1| Olimarabidopsis pumila clone BAC 44L14, complete sequence
          Length = 118342

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 143   tgaccatacttctggaactcccactcgctgtt 174
             |||||||| |||||||| ||||||||||||||
Sbjct: 92982 tgaccatatttctggaattcccactcgctgtt 93013



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 51/62 (82%)
 Strand = Plus / Plus

                                                                         
Query: 185   cacacttgacggntcttgagccaacggctgatgcagnggaagnggaatgcatggttgcaa 244
             |||||||||||  |||||||||| | |||||||||  | ||| | || || |||||||||
Sbjct: 93115 cacacttgacgagtcttgagccatctgctgatgcaatgaaagtgaaaggcgtggttgcaa 93174

               
Query: 245   ac 246
             ||
Sbjct: 93175 ac 93176



to top

>gb|AF296833.1|F7C8 Arabidopsis thaliana BAC F7C8
          Length = 70169

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 139   ttagtgaccatacttctggaactcccactcgctgtt 174
             |||||||||||| ||||| ||||||||||| |||||
Sbjct: 59856 ttagtgaccatatttctgaaactcccactcactgtt 59891



to top

>emb|AL138639.1|ATT21C14 Arabidopsis thaliana DNA chromosome 3, BAC clone T21C14
          Length = 79677

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 139   ttagtgaccatacttctggaactcccactcgc 170
             |||||||||||| |||||||| ||||||||||
Sbjct: 61191 ttagtgaccatatttctggaattcccactcgc 61222



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 51/62 (82%)
 Strand = Plus / Plus

                                                                         
Query: 185   cacacttgacggntcttgagccaacggctgatgcagnggaagnggaatgcatggttgcaa 244
             |||||||||||  | |||||||| | |||||| ||| ||||| | || || |||||||||
Sbjct: 61327 cacacttgacgagttttgagccatctgctgatacagtggaagtgaaaggcgtggttgcaa 61386

               
Query: 245   ac 246
             ||
Sbjct: 61387 ac 61388



to top

>gb|DQ213705.1| Taeniopygia guttata clone 0063P0003E09 RBX1 protein-like mRNA,
           complete sequence
          Length = 527

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 74/92 (80%)
 Strand = Plus / Minus

                                                                       
Query: 140 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacggntc 199
           ||||| |||||||| ||||||||||| || |||||||| || || || ||||| ||  | 
Sbjct: 346 tagtgtccatacttttggaactcccattccctgttgtccagtggacatacttggcgtgtt 287

                                           
Query: 200 ttgagccaacggctgatgcagnggaagnggaa 231
           |||||||| ||   ||||||| ||||| ||||
Sbjct: 286 ttgagccagcgagagatgcagtggaagtggaa 255



to top

>gb|AF156371.1| Nicotiana tabacum clone PR29 mRNA sequence
          Length = 472

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 142 gtgaccatacttctggaactcccactcgctg 172
           ||||||||| ||||| |||||||||||||||
Sbjct: 323 gtgaccatatttctgaaactcccactcgctg 353



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 267     cctcgctggtggcgctggcctgg 289
               |||||||||||||||||||||||
Sbjct: 4254043 cctcgctggtggcgctggcctgg 4254065



to top

>gb|AC124471.4| Mus musculus BAC clone RP24-79D7 from 12, complete sequence
          Length = 179503

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 303   cgatgcagaggtccatgatgt 323
             |||||||||||||||||||||
Sbjct: 62540 cgatgcagaggtccatgatgt 62560



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 267     cctcgctggtggcgctggcc 286
               ||||||||||||||||||||
Sbjct: 1172430 cctcgctggtggcgctggcc 1172449



to top

>ref|XM_568891.1| Cryptococcus neoformans var. neoformans JEC21 ubiquitin-protein
           ligase (CNB03140) partial mRNA
          Length = 429

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 293 gcctggcactcgatgcagaggtccatgatgtg 324
           |||||||| || |||||||| |||||||||||
Sbjct: 173 gcctggcaatccatgcagagatccatgatgtg 142



to top

>emb|CR686693.2|CNS0FSSX Tetraodon nigroviridis full-length cDNA
          Length = 365

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 146 ccatacttctggaactcccactcgctgttgtctagagggcacac 189
           ||||| ||||| ||||||||||| | |||||| || ||||||||
Sbjct: 237 ccatatttctgaaactcccactcccggttgtccagtgggcacac 194



to top

>emb|AL844222.19| Mouse DNA sequence from clone RP23-44P13 on chromosome 4, complete
              sequence
          Length = 238429

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 20     caaaaatccaagctccagaa 39
              ||||||||||||||||||||
Sbjct: 180168 caaaaatccaagctccagaa 180187



to top

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
              sequence
          Length = 1632307

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 293    gcctggcactcgatgcagaggtccatgatgtg 324
              |||||||| || |||||||| |||||||||||
Sbjct: 946899 gcctggcaatccatgcagagatccatgatgtg 946930



to top

>dbj|AK125754.1| Homo sapiens cDNA FLJ43766 fis, clone TESTI2049246
          Length = 1742

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 116 ctttgcccctggccatgatc 135
           ||||||||||||||||||||
Sbjct: 570 ctttgcccctggccatgatc 589



to top

>ref|XM_941170.1| PREDICTED: Homo sapiens hypothetical LOC401923 (LOC401923), mRNA
          Length = 363

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 116 ctttgcccctggccatgatc 135
           ||||||||||||||||||||
Sbjct: 275 ctttgcccctggccatgatc 294



to top

>ref|XM_377538.2| PREDICTED: Homo sapiens hypothetical LOC401923 (LOC401923), mRNA
          Length = 363

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 116 ctttgcccctggccatgatc 135
           ||||||||||||||||||||
Sbjct: 275 ctttgcccctggccatgatc 294



to top

>gb|DQ350703.1| Ajellomyces capsulatus nitrosative stress induced transcription 51
            (NIT51) gene, partial sequence
          Length = 1583

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 265  ctcctcgctggtggcgctgg 284
            ||||||||||||||||||||
Sbjct: 1197 ctcctcgctggtggcgctgg 1178



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 90      gctaaagttcgacaaccatg 109
               ||||||||||||||||||||
Sbjct: 6862919 gctaaagttcgacaaccatg 6862938



to top

>dbj|AP006156.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:B1043F11
          Length = 167137

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 90    gctaaagttcgacaaccatg 109
             ||||||||||||||||||||
Sbjct: 90814 gctaaagttcgacaaccatg 90833



to top

>gb|AC007785.1|AC007785 Homo sapiens chromosome 19, BAC 282485 (CIT-B-344H19), complete
             sequence
          Length = 166500

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 116   ctttgcccctggccatgatc 135
             ||||||||||||||||||||
Sbjct: 77268 ctttgcccctggccatgatc 77287


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,325,491
Number of Sequences: 3902068
Number of extensions: 2325491
Number of successful extensions: 38752
Number of sequences better than 10.0: 198
Number of HSP's better than 10.0 without gapping: 197
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 38228
Number of HSP's gapped (non-prelim): 449
length of query: 342
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 320
effective length of database: 17,147,199,772
effective search space: 5487103927040
effective search space used: 5487103927040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top