>emb|BX571728.14| Zebrafish DNA sequence from clone DKEY-210O7 in linkage group 6,
            complete sequence
          Length = 229059

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 31   aaacattancatgcatgtcctt 52
            |||||||| |||||||||||||
Sbjct: 8523 aaacattatcatgcatgtcctt 8502

>gb|AC153881.4| Mus musculus 10 BAC RP23-257B9 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 208992

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 61    atgacacgatgatgatgat 79
             |||||||||||||||||||
Sbjct: 20010 atgacacgatgatgatgat 19992

>gb|AC158598.7| Mus musculus 10 BAC RP24-286B23 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 162273

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 61    atgacacgatgatgatgat 79
             |||||||||||||||||||
Sbjct: 18835 atgacacgatgatgatgat 18853

>emb|BX005286.6| Zebrafish DNA sequence from clone DKEY-237I9, complete sequence
          Length = 178225

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 31     aaacattancatgcatgtcctt 52
              |||||||| |||||||||||||
Sbjct: 106580 aaacattatcatgcatgtcctt 106559


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 715,031
Number of Sequences: 3902068
Number of extensions: 715031
Number of successful extensions: 44138
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44133
Number of HSP's gapped (non-prelim): 5
length of query: 81
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 60
effective length of database: 17,151,101,840
effective search space: 1029066110400
effective search space used: 1029066110400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)