ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal4d20
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|DQ270232.1| Human respiratory syncytial virus B isolate H5598... 46 0.15
2gb|AC105167.8| Mus musculus, clone RP23-286L9, complete sequence 44 0.60
3gb|DQ270233.1| Human respiratory syncytial virus B isolate H5601... 44 0.60
4ref|XM_365898.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 2.4
5emb|AL645747.11| Mouse DNA sequence from clone RP23-436D9 on chr... 42 2.4
6gb|AC115289.6| Mus musculus BAC clone RP23-57G16 from 13, comple... 42 2.4
7gb|AC154695.3| Mus musculus BAC clone RP24-341I23 from 13, compl... 42 2.4
8dbj|AP003086.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 2.4
9gb|AC173115.2| Mus musculus BAC clone RP23-26D2 from chromosome ... 42 2.4
10ref|NM_123113.2| Arabidopsis thaliana pepsin A AT5G37540 mRNA, c... 40 9.4
11gb|AY628213.1| Cricetulus griseus cell-line LEC29 CHO alpha (1,3... 40 9.4
12gb|AY628212.1| Cricetulus griseus cell-line LEC12 CHO alpha (1,3... 40 9.4
13ref|XM_639833.1| Dictyostelium discoideum hypothetical protein (... 40 9.4
14ref|XM_635448.1| Dictyostelium discoideum hypothetical protein (... 40 9.4
15ref|XM_629056.1| Dictyostelium discoideum hypothetical protein (... 40 9.4
16gb|AC005142.2| Arabidopsis thaliana BAC T5L23 from chromosome IV... 40 9.4
17gb|AY956543.1| Twisted-stalk chlorotic streak virus isolate Trun... 40 9.4
18gb|AC105968.14| Mus musculus chromosome 18, clone RP23-265P4, co... 40 9.4
19gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ... 40 9.4
20gb|AY363686.1| Yersinia rohdei urease gene locus, and Yut (yut) ... 40 9.4
21gb|AY363682.1| Yersinia frederiksenii urease gene locus, and Yut... 40 9.4
22gb|AC122407.4| Mus musculus BAC clone RP24-129G24 from chromosom... 40 9.4
23gb|AC113998.5| Mus musculus BAC clone RP23-137C20 from 13, compl... 40 9.4
24emb|AL161932.15| Human DNA sequence from clone RP11-241I20 on ch... 40 9.4
25gb|AC100797.4| Homo sapiens chromosome 8, clone RP11-43A14, comp... 40 9.4
26emb|AL049773.1|HS10618A Human DNA sequence from clone RP5-1061O1... 40 9.4
27gb|BT000082.1| Arabidopsis thaliana unknown protein (At5g37540) ... 40 9.4
28emb|AL161497.2|ATCHRIV9 Arabidopsis thaliana DNA chromosome 4, c... 40 9.4
29gb|AC164168.3| Mus musculus 6 BAC RP23-343D21 (Roswell Park Canc... 40 9.4
30emb|AL606470.15| Mouse DNA sequence from clone RP23-293J11 on ch... 40 9.4
31emb|BX649426.8| Zebrafish DNA sequence from clone DKEYP-82D11, c... 40 9.4
32gb|AY092990.1| Arabidopsis thaliana unknown protein (At5g37540) ... 40 9.4
33gb|AC097478.2| Homo sapiens BAC clone RP11-115D19 from 4, comple... 40 9.4
34gb|AY054192.1| Arabidopsis thaliana AT5g37540/mpa22_p_70 mRNA, c... 40 9.4
35dbj|AK029970.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 9.4
36dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
37dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
38gb|AC155659.6| Mus musculus 6 BAC RP24-68F17 (Roswell Park Cance... 40 9.4
39gb|AC016724.11| Homo sapiens BAC clone RP11-339F22 from 2, compl... 40 9.4
40gb|AC102738.9| Mus musculus chromosome 3, clone RP24-303G10, com... 40 9.4
41ref|NM_177812.2| Mus musculus RIKEN cDNA 4932411K12 gene (493241... 40 9.4
42gb|AF230460.1|AF230460 Cricetulus griseus alpha(1,3)fucosyltrans... 40 9.4
43dbj|AP002485.2| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
44gb|AY968311.1| Homo sapiens interleukin 1 family, member 9 (IL1F... 40 9.4
45dbj|AB025630.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 9.4
46gb|AC006101.3|AC006101 citb_338_f_24, complete sequence 40 9.4
47emb|BX248326.14| Zebrafish DNA sequence from clone DKEY-260N20 i... 40 9.4
48emb|CR293524.10| Zebrafish DNA sequence from clone DKEY-57M7 in ... 40 9.4
49emb|BX469892.6| Zebrafish DNA sequence from clone CH211-194I18 i... 40 9.4
50tpe|BN000002.1|HSA000002 TPA: TPA_exp: Homo sapiens complete int... 40 9.4
51gb|DQ270229.1| Human respiratory syncytial virus B isolate H375 ... 40 9.4
52gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 9.4
53emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112... 40 9.4
54emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 40 9.4
55gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, comple... 40 9.4
56gb|AF071527.1| Arabidopsis thaliana BAC F9H3, from chromosome IV... 40 9.4
57gb|AC168881.3| Mus musculus BAC clone RP23-170A19 from chromosom... 40 9.4 
>gb|DQ270232.1| Human respiratory syncytial virus B isolate H5598 glycoprotein (G)
           gene, complete cds
          Length = 909

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 71  ctccacatcaaactcaacccaaa 93
           |||||||||||||||||||||||
Sbjct: 861 ctccacatcaaactcaacccaaa 883
to top
>gb|AC105167.8| Mus musculus, clone RP23-286L9, complete sequence
          Length = 215113

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 491    tgttgttgttgtaattcttgct 512
              ||||||||||||||||||||||
Sbjct: 139291 tgttgttgttgtaattcttgct 139312
to top
>gb|DQ270233.1| Human respiratory syncytial virus B isolate H5601 glycoprotein (G)
           gene, complete cds
          Length = 909

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 71  ctccacatcaaactcaacccaa 92
           ||||||||||||||||||||||
Sbjct: 861 ctccacatcaaactcaacccaa 882
to top
>ref|XM_365898.1| Magnaporthe grisea 70-15 hypothetical protein (MG10118.4) partial
            mRNA
          Length = 4038

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 195  ggaggcaaaggcagtggctgtagaa 219
            ||||||||| |||||||||||||||
Sbjct: 1959 ggaggcaaacgcagtggctgtagaa 1983
to top
>emb|AL645747.11| Mouse DNA sequence from clone RP23-436D9 on chromosome 11 Contains a
             novel gene and a signal transducing adaptor molecule (SH3
             domain and ITAM motif) 1 (Stam) pseudogene, complete
             sequence
          Length = 172052

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 78    tcaaactcaacccaaacaata 98
             |||||||||||||||||||||
Sbjct: 19193 tcaaactcaacccaaacaata 19213
to top
>gb|AC115289.6| Mus musculus BAC clone RP23-57G16 from 13, complete sequence
          Length = 210109

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 640   ttcccattcttagaactggga 660
             |||||||||||||||||||||
Sbjct: 62953 ttcccattcttagaactggga 62933
to top
>gb|AC154695.3| Mus musculus BAC clone RP24-341I23 from 13, complete sequence
          Length = 149545

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 640    ttcccattcttagaactggga 660
              |||||||||||||||||||||
Sbjct: 126917 ttcccattcttagaactggga 126897
to top
>dbj|AP003086.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-452H21, complete
              sequence
          Length = 145423

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 296    tttctttttctccactgagaa 316
              |||||||||||||||||||||
Sbjct: 139104 tttctttttctccactgagaa 139084
to top
>gb|AC173115.2| Mus musculus BAC clone RP23-26D2 from chromosome 13, complete sequence
          Length = 221491

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 214    gtagaaggcagggatagcgagacca 238
              ||||||||||||||||| |||||||
Sbjct: 114535 gtagaaggcagggatagagagacca 114559
to top
>ref|NM_123113.2| Arabidopsis thaliana pepsin A AT5G37540 mRNA, complete cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 74   cacatcaaactcaacccaaa 93
            ||||||||||||||||||||
Sbjct: 1305 cacatcaaactcaacccaaa 1286
to top
>gb|AY628213.1| Cricetulus griseus cell-line LEC29 CHO alpha (1,3)
           fucosyltransferase type IX (Fut9) mRNA, complete cds
          Length = 2250

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 87  acccaaacaataatagtggttttcttaaaata 118
           |||||||||| |||||||||||  ||||||||
Sbjct: 410 acccaaacaagaatagtggtttcattaaaata 379
to top
>gb|AY628212.1| Cricetulus griseus cell-line LEC12 CHO alpha (1,3)
           fucosyltransferase type IX (Fut9) mRNA, complete cds
          Length = 2251

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 87  acccaaacaataatagtggttttcttaaaata 118
           |||||||||| |||||||||||  ||||||||
Sbjct: 411 acccaaacaagaatagtggtttcattaaaata 380
to top
>ref|XM_639833.1| Dictyostelium discoideum hypothetical protein (DDB0217077), partial
            mRNA
          Length = 3639

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 491  tgttgttgttgtaattcttg 510
            ||||||||||||||||||||
Sbjct: 2036 tgttgttgttgtaattcttg 2017
to top
>ref|XM_635448.1| Dictyostelium discoideum hypothetical protein (DDB0204566), partial
            mRNA
          Length = 4188

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 491  tgttgttgttgtaattcttg 510
            ||||||||||||||||||||
Sbjct: 3611 tgttgttgttgtaattcttg 3592
to top
>ref|XM_629056.1| Dictyostelium discoideum hypothetical protein (DDB0192054), partial
           mRNA
          Length = 1830

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 491 tgttgttgttgtaattcttg 510
           ||||||||||||||||||||
Sbjct: 134 tgttgttgttgtaattcttg 115
to top
>gb|AC005142.2| Arabidopsis thaliana BAC T5L23 from chromosome IV, near 19 cM, complete
             sequence
          Length = 116448

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   tttcttaaaatacatcgagc 126
             ||||||||||||||||||||
Sbjct: 10385 tttcttaaaatacatcgagc 10366
to top
>gb|AY956543.1| Twisted-stalk chlorotic streak virus isolate Trunk Rd.-2
           polyprotein gene, partial cds
          Length = 727

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 121 tcgagctcctctgatgttgc 140
           ||||||||||||||||||||
Sbjct: 130 tcgagctcctctgatgttgc 111
to top
>gb|AC105968.14| Mus musculus chromosome 18, clone RP23-265P4, complete sequence
          Length = 210819

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 301   ttttctccactgagaatgta 320
             ||||||||||||||||||||
Sbjct: 94321 ttttctccactgagaatgta 94340
to top
>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 560    cctgggggtcatagcctcat 579
              ||||||||||||||||||||
Sbjct: 238200 cctgggggtcatagcctcat 238181
to top
>gb|AY363686.1| Yersinia rohdei urease gene locus, and Yut (yut) genes, complete cds;
            and UreH (ureH) gene, partial cds
          Length = 7358

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 150  tccttcacgcgttcgtgctcacgc 173
            ||||||||| ||||||||||||||
Sbjct: 4884 tccttcacgggttcgtgctcacgc 4907
to top
>gb|AY363682.1| Yersinia frederiksenii urease gene locus, and Yut (yut) genes,
            complete cds
          Length = 7372

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 150  tccttcacgcgttcgtgctcacgc 173
            ||||||||| ||||||||||||||
Sbjct: 5028 tccttcacgggttcgtgctcacgc 5051
to top
>gb|AC122407.4| Mus musculus BAC clone RP24-129G24 from chromosome 12, complete sequence
          Length = 137860

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 560    cctgggggtcatagcctcat 579
              ||||||||||||||||||||
Sbjct: 130104 cctgggggtcatagcctcat 130123
to top
>gb|AC113998.5| Mus musculus BAC clone RP23-137C20 from 13, complete sequence
          Length = 194221

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 356   cagcagcacagcactccagg 375
             ||||||||||||||||||||
Sbjct: 67792 cagcagcacagcactccagg 67811
to top
>emb|AL161932.15| Human DNA sequence from clone RP11-241I20 on chromosome 10 Contains a
             ribosomal protein L34 (RPL34) pseudogene, the KIF5B gene
             for kinesin family member 5B (kinesin 1 (110-120kD)), a
             ribosomal protein S4 pseudogene, part of a novel
             pseudogene, a pseudogene similar to part of RAB18 (RAB18,
             member RAS oncogene family) and a CpG island, complete
             sequence
          Length = 143423

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    tctccacatcaaactcaacc 89
             ||||||||||||||||||||
Sbjct: 93763 tctccacatcaaactcaacc 93744
to top
>gb|AC100797.4| Homo sapiens chromosome 8, clone RP11-43A14, complete sequence
          Length = 200340

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 80     aaactcaacccaaacaataatagt 103
              |||||| |||||||||||||||||
Sbjct: 143865 aaactctacccaaacaataatagt 143842
to top
>emb|AL049773.1|HS10618A Human DNA sequence from clone RP5-1061O18 on chromosome 22q13.32-13.33
             Contains a GSS, complete sequence
          Length = 45333

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 195   ggaggcaaaggcagtggctg 214
             ||||||||||||||||||||
Sbjct: 33787 ggaggcaaaggcagtggctg 33806
to top
>gb|BT000082.1| Arabidopsis thaliana unknown protein (At5g37540) mRNA, complete cds
          Length = 1438

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 74   cacatcaaactcaacccaaa 93
            ||||||||||||||||||||
Sbjct: 1278 cacatcaaactcaacccaaa 1259
to top
>emb|AL161497.2|ATCHRIV9 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 9
          Length = 159629

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   tttcttaaaatacatcgagc 126
             ||||||||||||||||||||
Sbjct: 31662 tttcttaaaatacatcgagc 31643
to top
>gb|AC164168.3| Mus musculus 6 BAC RP23-343D21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 236103

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 319   tatgcccaagcattttctcc 338
             ||||||||||||||||||||
Sbjct: 34429 tatgcccaagcattttctcc 34448
to top
>emb|AL606470.15| Mouse DNA sequence from clone RP23-293J11 on chromosome 11 Contains a
             Friedreich ataxia protein (Frda) pseudogene, complete
             sequence
          Length = 203970

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 491   tgttgttgttgtaattcttgctct 514
             |||||||||||||||| |||||||
Sbjct: 35471 tgttgttgttgtaattgttgctct 35494
to top
>emb|BX649426.8| Zebrafish DNA sequence from clone DKEYP-82D11, complete sequence
          Length = 209340

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 383    agcccaaacacaaaatatgt 402
              ||||||||||||||||||||
Sbjct: 137592 agcccaaacacaaaatatgt 137573
to top
>gb|AY092990.1| Arabidopsis thaliana unknown protein (At5g37540) mRNA, complete cds
          Length = 1593

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 74   cacatcaaactcaacccaaa 93
            ||||||||||||||||||||
Sbjct: 1302 cacatcaaactcaacccaaa 1283
to top
>gb|AC097478.2| Homo sapiens BAC clone RP11-115D19 from 4, complete sequence
          Length = 169484

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 388   aaacacaaaatatgtgcaat 407
             ||||||||||||||||||||
Sbjct: 20840 aaacacaaaatatgtgcaat 20859
to top
>gb|AY054192.1| Arabidopsis thaliana AT5g37540/mpa22_p_70 mRNA, complete cds
          Length = 1594

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 74   cacatcaaactcaacccaaa 93
            ||||||||||||||||||||
Sbjct: 1305 cacatcaaactcaacccaaa 1286
to top
>dbj|AK029970.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4932411K12 product:hypothetical protein,
           full insert sequence
          Length = 3156

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 356 cagcagcacagcactccagg 375
           ||||||||||||||||||||
Sbjct: 183 cagcagcacagcactccagg 202
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 564      ggggtcatagcctcatagga 583
                ||||||||||||||||||||
Sbjct: 14480105 ggggtcatagcctcatagga 14480086
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 563      gggggtcatagcctcatagg 582
                ||||||||||||||||||||
Sbjct: 26392029 gggggtcatagcctcatagg 26392010
to top
>gb|AC155659.6| Mus musculus 6 BAC RP24-68F17 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 195440

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 319    tatgcccaagcattttctcc 338
              ||||||||||||||||||||
Sbjct: 147312 tatgcccaagcattttctcc 147331
to top
>gb|AC016724.11| Homo sapiens BAC clone RP11-339F22 from 2, complete sequence
          Length = 197308

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    atcaaactcaacccaaacaa 96
             ||||||||||||||||||||
Sbjct: 41581 atcaaactcaacccaaacaa 41562
to top
>gb|AC102738.9| Mus musculus chromosome 3, clone RP24-303G10, complete sequence
          Length = 166697

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 371   ccaggaactgcgagcccaaacaca 394
             |||| |||||||||||||||||||
Sbjct: 78663 ccagcaactgcgagcccaaacaca 78686
to top
>ref|NM_177812.2| Mus musculus RIKEN cDNA 4932411K12 gene (4932411K12Rik), mRNA
          Length = 3156

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 356 cagcagcacagcactccagg 375
           ||||||||||||||||||||
Sbjct: 183 cagcagcacagcactccagg 202
to top
>gb|AF230460.1|AF230460 Cricetulus griseus alpha(1,3)fucosyltransferase type IX (Fut9)
           mRNA, complete cds
          Length = 1705

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 87  acccaaacaataatagtggttttcttaaaata 118
           |||||||||| |||||||||||  ||||||||
Sbjct: 270 acccaaacaagaatagtggtttcattaaaata 239
to top
>dbj|AP002485.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:P0491E01
          Length = 136150

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 563    gggggtcatagcctcatagg 582
              ||||||||||||||||||||
Sbjct: 124381 gggggtcatagcctcatagg 124362
to top
>gb|AY968311.1| Homo sapiens interleukin 1 family, member 9 (IL1F9) gene, complete cds
          Length = 20007

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    atcaaactcaacccaaacaa 96
             ||||||||||||||||||||
Sbjct: 16268 atcaaactcaacccaaacaa 16249
to top
>dbj|AB025630.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPA22
          Length = 51436

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    cacatcaaactcaacccaaa 93
             ||||||||||||||||||||
Sbjct: 46278 cacatcaaactcaacccaaa 46259
to top
>gb|AC006101.3|AC006101 citb_338_f_24, complete sequence
          Length = 148278

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    tctccacatcaaactcaacc 89
             ||||||||||||||||||||
Sbjct: 84128 tctccacatcaaactcaacc 84109
to top
>emb|BX248326.14| Zebrafish DNA sequence from clone DKEY-260N20 in linkage group 20,
              complete sequence
          Length = 182841

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 485    agcaaatgttgttgttgtaattct 508
              |||||||||||||||||| |||||
Sbjct: 106159 agcaaatgttgttgttgtcattct 106136
to top
>emb|CR293524.10| Zebrafish DNA sequence from clone DKEY-57M7 in linkage group 18, complete
              sequence
          Length = 190196

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 91     aaacaataatagtggttttcttaa 114
              |||||||||||||| |||||||||
Sbjct: 115433 aaacaataatagtgattttcttaa 115456
to top
>emb|BX469892.6| Zebrafish DNA sequence from clone CH211-194I18 in linkage group 18,
             complete sequence
          Length = 48565

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 91    aaacaataatagtggttttcttaa 114
             |||||||||||||| |||||||||
Sbjct: 13187 aaacaataatagtgattttcttaa 13164
to top
>tpe|BN000002.1|HSA000002 TPA: TPA_exp: Homo sapiens complete interleukin-1 gene cluster (Draft
              Contig) including IL1A (IL1F1), IL1B (IL1F2), IL1RN
              (IL1F3), IL1F5, IL1F6, IL1F7, IL1F8, IL1F9, IL1F10
          Length = 495475

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 77     atcaaactcaacccaaacaa 96
              ||||||||||||||||||||
Sbjct: 284035 atcaaactcaacccaaacaa 284016
to top
>gb|DQ270229.1| Human respiratory syncytial virus B isolate H375 nonfunctional
           glycoprotein (G) gene, complete sequence
          Length = 916

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 74  cacatcaaactcaacccaaa 93
           ||||||||||||||||||||
Sbjct: 871 cacatcaaactcaacccaaa 890
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 564      ggggtcatagcctcatagga 583
                ||||||||||||||||||||
Sbjct: 14434389 ggggtcatagcctcatagga 14434370
to top
>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118101

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 564   ggggtcatagcctcatagga 583
             ||||||||||||||||||||
Sbjct: 37187 ggggtcatagcctcatagga 37206
to top
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 563    gggggtcatagcctcatagg 582
              ||||||||||||||||||||
Sbjct: 114257 gggggtcatagcctcatagg 114238
to top
>gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, complete sequence
          Length = 113482

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 560    cctgggggtcatagcctcat 579
              ||||||||||||||||||||
Sbjct: 110349 cctgggggtcatagcctcat 110330
to top
>gb|AF071527.1| Arabidopsis thaliana BAC F9H3, from chromosome IV near 18.8 cM,
             complete sequence
          Length = 95519

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 107   tttcttaaaatacatcgagc 126
             ||||||||||||||||||||
Sbjct: 21399 tttcttaaaatacatcgagc 21418
to top
>gb|AC168881.3| Mus musculus BAC clone RP23-170A19 from chromosome 13, complete
             sequence
          Length = 212206

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 356   cagcagcacagcactccagg 375
             ||||||||||||||||||||
Sbjct: 71343 cagcagcacagcactccagg 71324


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,561,747
Number of Sequences: 3902068
Number of extensions: 7561747
Number of successful extensions: 145180
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 144929
Number of HSP's gapped (non-prelim): 251
length of query: 687
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 664
effective length of database: 17,143,297,704
effective search space: 11383149675456
effective search space used: 11383149675456
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top