>emb|Z34269.1|HVBKACPS4 H.vulgare (pMaW25) mRNA for beta-ketoacyl-ACP synthase
          Length = 2380

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 35/37 (94%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                 
Query: 5    tttatttaggagggcgtttta-aaggatggcatggca 40
            |||||||||| |||||||||| |||||||||||||||
Sbjct: 2364 tttatttaggggggcgttttacaaggatggcatggca 2328

>ref|XM_799236.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053511877.20) partial mRNA
          Length = 999

 Score = 44.1 bits (22), Expect = 0.072
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 22  tttaaaggatggcatggcagac 43
           ||||||||||||||||||||||
Sbjct: 597 tttaaaggatggcatggcagac 618

>gb|AC142330.1| Pan troglodytes BAC clone RP43-25K18 from 7, complete sequence
          Length = 187596

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 1     gagatttatttaggagggcgttt 23
             |||||||||||||||||| ||||
Sbjct: 34781 gagatttatttaggagggagttt 34803

>emb|AL662946.2|OSJN00139 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ991113_30,
             complete sequence
          Length = 141128

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 78    agtggtttgacnaggtggggag 99
             ||||||||||| ||||||||||
Sbjct: 39766 agtggtttgaccaggtggggag 39745

>emb|AL589738.6| Mouse DNA sequence from clone RP23-322J11 on chromosome 13 Contains the
              Foxq1 gene for forkhead box Q1 (Hfh1l), two novel genes and
              two CpG islands, complete sequence
          Length = 187709

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      agatttatttaggagggcg 20
              |||||||||||||||||||
Sbjct: 125833 agatttatttaggagggcg 125851

>gb|DQ239738.1| Arthrospira platensis clone 2 Res and Mod genes, complete cds
          Length = 4000

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 23  ttaaaggatggcatggcag 41
           |||||||||||||||||||
Sbjct: 203 ttaaaggatggcatggcag 185

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                      
Query: 78       agtggtttgacnaggtggggag 99
                ||||||||||| ||||||||||
Sbjct: 24323355 agtggtttgaccaggtggggag 24323334


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 612,924
Number of Sequences: 3902068
Number of extensions: 612924
Number of successful extensions: 34473
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 34454
Number of HSP's gapped (non-prelim): 20
length of query: 100
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 79
effective length of database: 17,151,101,840
effective search space: 1354937045360
effective search space used: 1354937045360
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)