ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal3m21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate c... 129 9e-28
2emb|X00235.1|TARUB2 Wheat mRNA fragment for small subunit precur... 129 9e-28
3emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical pr... 129 9e-28
4emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosp... 121 2e-25
5gb|AF192777.1|AF192777 Avena clauda clone Cl9 ribulose-1,5-bisph... 111 2e-22
6gb|AF192780.1|AF192780 Avena maroccana clone Ma7 ribulose-1,5-bi... 105 1e-20
7gb|AF192775.1|AF192775 Avena strigosa clone Str5 ribulose-1,5-bi... 105 1e-20
8gb|AF192774.1|AF192774 Avena strigosa clone Str3 ribulose-1,5-bi... 105 1e-20
9gb|AF097361.1|AF097361 Avena clauda ribulose-1,5-bisphosphate ca... 105 1e-20
10gb|AF097360.1|AF097360 Avena strigosa ribulose-1,5-bisphosphate ... 105 1e-20
11emb|AJ635206.1| Triticum durum ssp. durum partial mRNA for putat... 105 1e-20
12gb|AF104250.1|AF104250 Avena maroccana ribulose-1,5-bisphosphate... 105 1e-20
13emb|AJ131737.1|SCE131737 Secale cereale mRNA for hypothetical pr... 98 3e-18
14gb|AF192779.1|AF192779 Avena maroccana clone Ma4 ribulose-1,5-bi... 98 3e-18
15gb|AF192776.1|AF192776 Avena clauda clone Cl5 ribulose-1,5-bisph... 98 3e-18
16gb|AF192773.1|AF192773 Avena agadiriana ribulose-1,5-bisphosphat... 98 3e-18
17gb|AF097359.1|AF097359 Avena agadiriana ribulose-1,5-bisphosphat... 98 3e-18
18gb|AF104249.1|AF104249 Avena vaviloviana ribulose-1,5-bisphospha... 98 3e-18
19gb|AF096617.1|AF096617 Avena sterilis subsp. ludoviciana ribulos... 98 3e-18
20gb|AF192778.1|AF192778 Avena sterilis subsp. ludoviciana ribulos... 90 8e-16
21gb|M37477.1|WHTRUBIAB T.aestivum ribulose-1,5-bisphosphate carbo... 90 8e-16
22gb|AY445627.1| Oryza sativa (japonica cultivar-group) ribulose-1... 88 3e-15
23dbj|AK121444.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-15
24dbj|AK119219.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-15
25dbj|AK070556.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-15
26dbj|AK068555.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-15
27dbj|AK061611.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-15
28gb|AF052305.1|AF052305 Oryza sativa ribulose 1,5-bisphosphate ca... 88 3e-15
29gb|AF017364.1|AF017364 Oryza sativa ribulose 1,5-bisphosphate ca... 88 3e-15
30gb|AF017363.1|AF017363 Oryza sativa ribulose 1,5-bisphosphate ca... 88 3e-15
31gb|L22155.1|RICCPRBCLA Oryza sativum mitochondrial ribulose bisp... 88 3e-15
32dbj|D00643.1|RICRUBPC1 Oryza sativa (japonica cultivar-group) mR... 88 3e-15
33dbj|AK099574.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-13
34dbj|AK070257.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 8e-13
35dbj|AK068266.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 8e-13
36dbj|D00644.1|RICRUBPC2 Oryza sativa (japonica cultivar-group) mR... 80 8e-13
37dbj|AB042066.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 76 1e-11
38dbj|AB042064.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 68 3e-09
39emb|X06535.1|ZMRUBSSU Maize mRNA for ribulose-1,5-bisphosphate c... 64 5e-08
40gb|AY103730.1| Zea mays PCO095823 mRNA sequence 64 5e-08
41dbj|D00170.1|MZEPCSSU Zea mays mRNA for ribulose 1,5-bisphosphat... 64 5e-08
42dbj|AB020939.1| Triticum timopheevii subsp. armeniacum DNA for r... 64 5e-08
43gb|AF202648.1|AF202648 Avena maroccana ribulose-1,5-bisphosphate... 60 7e-07
44gb|AF202647.1|AF202647 Avena agadiriana ribulose-1,5-bisphosphat... 60 7e-07
45gb|AF202646.1|AF202646 Avena clauda clone ClG4 ribulose-1,5-bisp... 60 7e-07
46gb|AF202645.1|AF202645 Avena clauda clone ClG2 ribulose-1,5-bisp... 60 7e-07
47gb|AF200303.1|AF200303 Avena clauda ribulose-1,5-bisphosphate ca... 60 7e-07
48gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carbo... 60 7e-07
49dbj|AB042068.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 60 7e-07
50dbj|AB020945.1| Avena sativa DNA for ribulose-1,5-bisphosphate c... 58 3e-06
51dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-05
52gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 56 1e-05
53emb|BX119951.3|CNS09S4U Oryza sativa chromosome 12, . BAC OJ1523... 56 1e-05
54dbj|AB020959.1| Secale cereale DNA for ribulose-1,5-bisphosphate... 56 1e-05
55dbj|AB020958.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 56 1e-05
56dbj|AB020955.1| Triticum timopheevii subsp. armeniacum DNA for r... 56 1e-05
57dbj|AB020954.1| Triticum urartu DNA for ribulose-1,5-bisphosphat... 56 1e-05
58dbj|AB020953.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosp... 56 1e-05
59dbj|AB020952.1| Aegilops searsii DNA for ribulose-1,5-bisphospha... 56 1e-05
60dbj|AB020951.1| Aegilops bicornis DNA for ribulose-1,5-bisphosph... 56 1e-05
61dbj|AB020950.1| Aegilops sharonensis DNA for ribulose-1,5-bispho... 56 1e-05
62dbj|AB020949.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 56 1e-05
63dbj|AB020947.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 56 1e-05
64dbj|AB020946.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 56 1e-05
65dbj|AB020944.1| Agropyron intermedium DNA for ribulose-1,5-bisph... 56 1e-05
66dbj|AB020942.1| Secale cereale DNA for ribulose-1,5-bisphosphate... 56 1e-05
67dbj|AB020938.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosp... 56 1e-05
68dbj|AB020937.1| Aegilops searsii DNA for ribulose-1,5-bisphospha... 56 1e-05
69dbj|AB020931.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 56 1e-05
70dbj|AB020930.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 56 1e-05
71dbj|AB020929.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 56 1e-05
72dbj|AB020928.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 56 1e-05
73dbj|AB020927.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 56 1e-05
74dbj|AB020926.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 56 1e-05
75dbj|AB020960.1| Bromus catharticus DNA for ribulose-1,5-bisphosp... 56 1e-05
76dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 56 1e-05
77dbj|AB042065.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 56 1e-05
78gb|AY023648.1| Oryza sativa microsatellite MRG5973 containing (T... 54 4e-05
79gb|BT012936.1| Lycopersicon esculentum clone 114099R, mRNA sequence 54 4e-05
80gb|DQ418485.1| Zingiber officinale ribulose-1,5-bisphosphate car... 54 4e-05
81emb|X07515.1|OSRBCS Rice rbcS gene for ribulose 1,5-bisphosphate... 54 4e-05
82emb|AL731739.4|CNS08C7O Oryza sativa chromosome 12, . BAC OSJNBa... 54 4e-05
83dbj|AB020957.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 54 4e-05
84dbj|AB020956.1| Triticum turgidum subsp. dicoccoides DNA for rib... 54 4e-05
85dbj|AB020948.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 54 4e-05
86dbj|AB020943.1| Hordeum vulgare DNA for ribulose-1,5-bisphosphat... 52 2e-04
87dbj|AB020941.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 52 2e-04
88dbj|AB020940.1| Triticum turgidum subsp. dicoccoides DNA for rib... 52 2e-04
89dbj|AB020936.1| Aegilops bicornis DNA for ribulose-1,5-bisphosph... 52 2e-04
90dbj|AB020935.1| Aegilops sharonensis DNA for ribulose-1,5-bispho... 52 2e-04
91dbj|AB020934.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 52 2e-04
92dbj|AB020933.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 52 2e-04
93dbj|AB020932.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 52 2e-04
94emb|Y00322.1|ZMRBCS Maize rbcS gene for ribulose-1,5-bisphosphat... 50 7e-04
95emb|Y09214.1|ZMRUBSMSU Z.mays rubisco small subunit gene 50 7e-04
96gb|M86717.1|SCFBCS1A Saccharum hybrid cultivar H32-8560 ribulose... 48 0.003
97dbj|AB042067.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 48 0.003
98emb|X17231.1|LGRBCS5B Lemna gibba rbcS gene SSU5B for small subu... 44 0.043
99emb|X17230.1|LGRBCS5A Lemna gibba rbcS gene SSU5A for small subu... 44 0.043
100emb|AJ419826.1|CAR419826 Coffea arabica mRNA for rubisco small s... 42 0.17
101emb|X05986.1|LERBCS3C Tomato rbcS3C gene for ribulose 1,5-biphos... 42 0.17
102emb|X05985.1|LERBCS3B Tomato rbcS3B gene for ribulose 1,5-bispho... 42 0.17
103emb|X05984.1|LERBCS3A Tomato rbcS3A gene for ribulose 1,5-bispho... 42 0.17
104gb|M13544.1|TOMRBCSC Tomato (L.esculentum) ribulose-1,5-bisphosp... 42 0.17
105gb|M31640.1|CIPRBC Ice plant ribulose-1-5-bisphosphate carboxyla... 42 0.17
106dbj|D11112.1|TOMRBCO Tomato ribulose 1,5-bisphosphate carboxylas... 42 0.17
107dbj|AB067656.1| Oryza sativa (japonica cultivar-group) OsrbcS ge... 42 0.17
108gb|AF034479.1| Zantedeschia aethiopica ribulose-1,5-bisphosphate... 40 0.67
109gb|BT013023.1| Lycopersicon esculentum clone 114270R, mRNA sequence 38 2.6
110emb|AL121958.6|HSDJ71H19 Human DNA sequence from clone RP1-71H19... 38 2.6
111gb|AC183417.2| Pan troglodytes BAC clone CH251-173K9 from chromo... 38 2.6
112gb|AC182461.3| Pan troglodytes BAC clone CH251-673H10 from chrom... 38 2.6
113ref|NM_167358.1| Drosophila melanogaster Inositol 1,4,5-triphosp... 38 2.6
114ref|NM_132647.1| Drosophila melanogaster Inositol 1,4,5-triphosp... 38 2.6
115gb|AY084158.1| Drosophila melanogaster RE35745 full insert cDNA 38 2.6
116gb|AC001228.1|HSAC001228 244Kb Contig from Human Chromosome 11p1... 38 2.6
117gb|M25613.1|PEARUBP2 Pisum sativum ribulose 1,5 bisphosphate car... 38 2.6
118gb|AC131971.9| Homo sapiens chromosome 11, clone CTC-343N3, comp... 38 2.6
119dbj|AK109003.1| Oryza sativa (japonica cultivar-group) cDNA clon... 38 2.6
120gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome 38 2.6
121gb|AF039014.1|AF039014 Fritillaria agrestis clone TA8 ribulose 1... 38 2.6
122gb|AF039011.1|AF039011 Fritillaria agrestis clone TA22 ribulose ... 38 2.6
123gb|AF039008.1|AF039008 Fritillaria agrestis clone TA15 ribulose ... 38 2.6
124gb|U51281.1|HSU51281 Human chromosome 11 cosmid cSRL-87f11 38 2.6
125gb|L26605.1|SLARBCS Stellaria longipes ribulose-1,5-bisphosphate... 38 2.6
126gb|M15236.1|TOMRBCSE Tomato RuBP carboxylase small subunit LESS5... 38 2.6
127gb|M13543.1|TOMRBCSB Tomato (L.esculentum) ribulose-1,5-bisphosp... 38 2.6
128gb|J03613.1|POTRBCS Potato (S.tuberosum) ribulose bisphosphate c... 38 2.6
129gb|J01257.1|PEARUBPA Pea (P.sativum) ribulose 1,5-bisphosphate c... 38 2.6

>gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 816

 Score =  129 bits (65), Expect = 9e-28
 Identities = 67/68 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 200 ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatccttccaccgtt 141

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 140 gctgacgc 133



to top

>emb|X00235.1|TARUB2 Wheat mRNA fragment for small subunit precursor of RuBPCase (EC
           4.1.1.39 ribulosebisphosphate carboxylase) clones 234
           and 406
          Length = 743

 Score =  129 bits (65), Expect = 9e-28
 Identities = 67/68 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 145 ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatccttccaccgtt 86

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 85  gctgacgc 78



to top

>emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical protein, clone 9
          Length = 875

 Score =  129 bits (65), Expect = 9e-28
 Identities = 67/68 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 266 ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatccttccaccgtt 207

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 206 gctgacgc 199



to top

>emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase, small subunit
          Length = 837

 Score =  121 bits (61), Expect = 2e-25
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 226 ctcgaacttcttgataccctcgatgggccacacctgcatgcacctgatccttccaccgtt 167

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 166 gctgacgc 159



to top

>gb|AF192777.1|AF192777 Avena clauda clone Cl9 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score =  111 bits (56), Expect = 2e-22
 Identities = 64/67 (95%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||
Sbjct: 165 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatccttccaccgtt 106

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 105 gctgacg 99



to top

>gb|AF192780.1|AF192780 Avena maroccana clone Ma7 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score =  105 bits (53), Expect = 1e-20
 Identities = 64/68 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| ||||| |||||
Sbjct: 165 ctcgaacttcttgatgccctcaattggccacacctgcatgcacctgatccttccgccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|AF192775.1|AF192775 Avena strigosa clone Str5 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score =  105 bits (53), Expect = 1e-20
 Identities = 64/68 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| ||||| |||||
Sbjct: 165 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatccttccgccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|AF192774.1|AF192774 Avena strigosa clone Str3 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score =  105 bits (53), Expect = 1e-20
 Identities = 64/68 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| ||||| |||||
Sbjct: 165 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatccttccgccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|AF097361.1|AF097361 Avena clauda ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score =  105 bits (53), Expect = 1e-20
 Identities = 64/68 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||| ||||| |||||||||||
Sbjct: 165 ctcgaacttcttgatgccctcaatcggccacacctgcatgcatctgattcttccaccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|AF097360.1|AF097360 Avena strigosa ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score =  105 bits (53), Expect = 1e-20
 Identities = 64/68 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| ||||| |||||
Sbjct: 165 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatccttccgccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>emb|AJ635206.1| Triticum durum ssp. durum partial mRNA for putative rubisco small
           subunit (rbcS gene)
          Length = 518

 Score =  105 bits (53), Expect = 1e-20
 Identities = 64/68 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| ||||| |||||
Sbjct: 170 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatccttccgccgtt 111

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 110 gctgacgc 103



to top

>gb|AF104250.1|AF104250 Avena maroccana ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score =  105 bits (53), Expect = 1e-20
 Identities = 64/68 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| ||||| |||||
Sbjct: 165 ctcgaacttcttgatgccctcaattggccacacctgcatgcacctgatccttccgccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>emb|AJ131737.1|SCE131737 Secale cereale mRNA for hypothetical protein, clone 5
          Length = 845

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||| ||||| ||||| |||||
Sbjct: 247 ctcgaacttcttgatgccctcaattggccacacctgcatgcatctgatccttccgccgtt 188

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 187 gctgacgc 180



to top

>gb|AF192779.1|AF192779 Avena maroccana clone Ma4 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||| | ||| |||||||||||
Sbjct: 165 ctcgaacttcttgatgccctcaatcggccacacctgcatgcatcggattcttccaccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|AF192776.1|AF192776 Avena clauda clone Cl5 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||| | ||| |||||||||||
Sbjct: 165 ctcgaacttcttgatgccctcaatcggccacacctgcatgcatcggattcttccaccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|AF192773.1|AF192773 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||| | ||| |||||||||||
Sbjct: 165 ctcgaacttcttgatgccctcaatcggccacacctgcatgcatcggattcttccaccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|AF097359.1|AF097359 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||| | ||| |||||||||||
Sbjct: 165 ctcgaacttcttgatgccctcaatcggccacacctgcatgcatcggattcttccaccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|AF104249.1|AF104249 Avena vaviloviana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||| | ||| |||||||||||
Sbjct: 165 ctcgaacttcttgatgccctcaataggccacacctgcatgcatcggattcttccaccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|AF096617.1|AF096617 Avena sterilis subsp. ludoviciana ribulose-1,5-bisphosphate
           carboxylase small subunit (rbcS) mRNA, partial cds
          Length = 504

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||| | ||| |||||||||||
Sbjct: 165 ctcgaacttcttgatgccctcaataggccacacctgcatgcatcggattcttccaccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|AF192778.1|AF192778 Avena sterilis subsp. ludoviciana ribulose-1,5-bisphosphate
           carboxylase small subunit (rbcS) mRNA, nuclear gene
           encoding chloroplast protein, partial cds
          Length = 504

 Score = 89.7 bits (45), Expect = 8e-16
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           |||||| |||||||||||||| || ||||||||||||||||| | ||| |||||||||||
Sbjct: 165 ctcgaatttcttgatgccctcaataggccacacctgcatgcatcggattcttccaccgtt 106

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 105 gctgacgc 98



to top

>gb|M37477.1|WHTRUBIAB T.aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase
           (RUBISCO) gene, complete cds
          Length = 779

 Score = 89.7 bits (45), Expect = 8e-16
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||| ||||| ||||| || ||
Sbjct: 237 ctcgaacttcttgatgccctcaattggccacacctgcatgcatctgatccttccgccatt 178

                   
Query: 61  gctgacgc 68
           ||||||||
Sbjct: 177 gctgacgc 170



to top

>gb|AY445627.1| Oryza sativa (japonica cultivar-group) ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit mRNA, complete cds;
           chloroplast
          Length = 860

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || |||||||||||||||||| |||| ||||| || ||
Sbjct: 231 ctcgaacttcttgatgccctcaattggccacacctgcatgcacttgatccttccgccatt 172

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 171 gctgacg 165



to top

>dbj|AK121444.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023141B14, full
           insert sequence
          Length = 984

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| || || || ||
Sbjct: 390 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatcctgccgccatt 331

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 330 gctgacg 324



to top

>dbj|AK119219.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-F11, full
           insert sequence
          Length = 828

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| || || || ||
Sbjct: 236 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatcctgccgccatt 177

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 176 gctgacg 170



to top

>dbj|AK070556.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023062J10, full
           insert sequence
          Length = 2409

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| || || || ||
Sbjct: 237 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatcctgccgccatt 178

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 177 gctgacg 171



to top

>dbj|AK068555.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013156H12, full
           insert sequence
          Length = 899

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || |||||||||||||||||| |||| ||||| || ||
Sbjct: 248 ctcgaacttcttgatgccctcaattggccacacctgcatgcacttgatccttccgccatt 189

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 188 gctgacg 182



to top

>dbj|AK061611.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F07, full
           insert sequence
          Length = 830

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| || || || ||
Sbjct: 239 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatcctgccgccatt 180

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 179 gctgacg 173



to top

>gb|AF052305.1|AF052305 Oryza sativa ribulose 1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 835

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| || || || ||
Sbjct: 225 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatcctgccgccatt 166

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 165 gctgacg 159



to top

>gb|AF017364.1|AF017364 Oryza sativa ribulose 1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 854

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| || || || ||
Sbjct: 262 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatcctgccgccatt 203

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 202 gctgacg 196



to top

>gb|AF017363.1|AF017363 Oryza sativa ribulose 1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 918

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || |||||||||||||||||| |||| ||||| || ||
Sbjct: 232 ctcgaacttcttgatgccctcaattggccacacctgcatgcacttgatccttccgccatt 173

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 172 gctgacg 166



to top

>gb|L22155.1|RICCPRBCLA Oryza sativum mitochondrial ribulose bisphosphate
           carboxylase/oxygenase (rbcS) mRNA, complete cds
          Length = 808

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| || || || ||
Sbjct: 214 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatcctgccgccatt 155

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 154 gctgacg 148



to top

>dbj|D00643.1|RICRUBPC1 Oryza sativa (japonica cultivar-group) mRNA for the small subunit
           of ribulose-1,5-bisphosphate carboxylase, complete cds,
           clone pOSSS1139
          Length = 830

 Score = 87.7 bits (44), Expect = 3e-15
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||||||||||| || || || ||
Sbjct: 234 ctcgaacttcttgatgccctcaatcggccacacctgcatgcacctgatcctgccgccatt 175

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 174 gctgacg 168



to top

>dbj|AK099574.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013036G21, full
           insert sequence
          Length = 947

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                       
Query: 5   aacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgttgctg 64
           |||||||||||||| || || |||||||||||||| || ||||| |||||||||||||||
Sbjct: 244 aacttcttgatgccttcaatcggccacacctgcatacagctgatccttccaccgttgctg 185

               
Query: 65  acgc 68
           ||||
Sbjct: 184 acgc 181



to top

>dbj|AK070257.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N11, full
           insert sequence
          Length = 845

 Score = 79.8 bits (40), Expect = 8e-13
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           |||||||||||| |||||||| || ||||||||||||||||| ||||| ||||| || ||
Sbjct: 244 ctcgaacttcttaatgccctcaatcggccacacctgcatgcatctgatccttccgccatt 185

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 184 gctgacg 178



to top

>dbj|AK068266.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013149A10, full
           insert sequence
          Length = 1999

 Score = 79.8 bits (40), Expect = 8e-13
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           |||||||||||| |||||||| || ||||||||||||||||| ||||| ||||| || ||
Sbjct: 246 ctcgaacttcttaatgccctcaatcggccacacctgcatgcatctgatccttccgccatt 187

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 186 gctgacg 180



to top

>dbj|D00644.1|RICRUBPC2 Oryza sativa (japonica cultivar-group) mRNA for the small subunit
           of ribulose-1,5-bisphosphate carboxylase, complete cds,
           clone pOSSS2106
          Length = 895

 Score = 79.8 bits (40), Expect = 8e-13
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||||||||||| || ||||||||||||||| || |||| ||||| || ||
Sbjct: 246 ctcgaacttcttgatgccctcaattggccacacctgcatgaacttgatccttccgccatt 187

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 186 gctgacg 180



to top

>dbj|AB042066.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p9-1
          Length = 739

 Score = 75.8 bits (38), Expect = 1e-11
 Identities = 38/38 (100%)
 Strand = Plus / Minus

                                                 
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgca 38
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 391 ctcgaacttcttgatgccctcgatgggccacacctgca 354



 Score = 67.9 bits (34), Expect = 3e-09
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| |||||||||||||||||||
Sbjct: 149 acctgcatgcacctgatccttccaccgttgctgacgc 113



to top

>dbj|AB042064.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p2-1
          Length = 653

 Score = 67.9 bits (34), Expect = 3e-09
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgca 38
           |||||||||||| |||||||||||||||||||||||||
Sbjct: 305 ctcgaacttcttaatgccctcgatgggccacacctgca 268



 Score = 60.0 bits (30), Expect = 7e-07
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           |||||||||| |||||| |||||||||||||||||||
Sbjct: 149 acctgcatgcgcctgatccttccaccgttgctgacgc 113



to top

>emb|X06535.1|ZMRUBSSU Maize mRNA for ribulose-1,5-bisphosphate carboxylase small subunit
           (RuBPC; EC 4.1.1.39)
          Length = 830

 Score = 63.9 bits (32), Expect = 5e-08
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||| |||| | |   ||||||||||||||||||| ||| ||||| |||||
Sbjct: 245 ctcgaacttcttgttgccgtaggccggccacacctgcatgcaccggatccttccgccgtt 186

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 185 gctgacg 179



to top

>gb|AY103730.1| Zea mays PCO095823 mRNA sequence
          Length = 1172

 Score = 63.9 bits (32), Expect = 5e-08
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||| |||| | |   ||||||||||||||||||| ||| ||||| |||||
Sbjct: 365 ctcgaacttcttgttgccgtaggccggccacacctgcatgcaccggatccttccgccgtt 306

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 305 gctgacg 299



to top

>dbj|D00170.1|MZEPCSSU Zea mays mRNA for ribulose 1,5-bisphosphate carboxylase small
           subunit, complete cds
          Length = 830

 Score = 63.9 bits (32), Expect = 5e-08
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatncttccaccgtt 60
           ||||||||||||| |||| | |   ||||||||||||||||||| ||| ||||| |||||
Sbjct: 245 ctcgaacttcttgttgccgtaggccggccacacctgcatgcaccggatccttccgccgtt 186

                  
Query: 61  gctgacg 67
           |||||||
Sbjct: 185 gctgacg 179



to top

>dbj|AB020939.1| Triticum timopheevii subsp. armeniacum DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Ara-A
          Length = 604

 Score = 63.9 bits (32), Expect = 5e-08
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                   
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatg 40
           ||||||||||||||||||||| || |||||||||||||||
Sbjct: 272 ctcgaacttcttgatgccctcaatcggccacacctgcatg 233



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>gb|AF202648.1|AF202648 Avena maroccana ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) gene, partial cds
          Length = 620

 Score = 60.0 bits (30), Expect = 7e-07
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| |||||||||||||
Sbjct: 134 acctgcatgcacctgatccttccgccgttgctgacgc 98



 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 281 ctcgaacttcttgatgccctcaattggccacacctg 246



to top

>gb|AF202647.1|AF202647 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 593

 Score = 60.0 bits (30), Expect = 7e-07
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||| ||||| |||||||||||||||||||
Sbjct: 134 acctgcatgcatctgattcttccaccgttgctgacgc 98



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || ||||| |||||
Sbjct: 254 ctcgaacttcttgatgccctcaatcggccatacctg 219



to top

>gb|AF202646.1|AF202646 Avena clauda clone ClG4 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 586

 Score = 60.0 bits (30), Expect = 7e-07
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||| ||||| |||||||||||||||||||
Sbjct: 134 acctgcatgcatctgatccttccaccgttgctgacgc 98



 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 1   ctcgaacttcttgatgccctcgatgggccacacct 35
           ||||||||||||||||||||| || ||||||||||
Sbjct: 247 ctcgaacttcttgatgccctcaatcggccacacct 213



to top

>gb|AF202645.1|AF202645 Avena clauda clone ClG2 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 600

 Score = 60.0 bits (30), Expect = 7e-07
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||| ||||| |||||||||||||||||||
Sbjct: 134 acctgcatgcatctgattcttccaccgttgctgacgc 98



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           |||||||||||||||||||||  | |||||||||||
Sbjct: 261 ctcgaacttcttgatgccctcagtcggccacacctg 226



to top

>gb|AF200303.1|AF200303 Avena clauda ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) gene, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 594

 Score = 60.0 bits (30), Expect = 7e-07
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| |||||||||||||
Sbjct: 134 acctgcatgcacctgatccttccgccgttgctgacgc 98



 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 255 ctcgaacttcttgatgccctcaattggccacacctg 220



to top

>gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase
           (RUBISCO) gene, exons 1 and 2
          Length = 2205

 Score = 60.0 bits (30), Expect = 7e-07
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| |||||||||||||
Sbjct: 841 acctgcatgcacctgatccttccgccgttgctgacgc 805



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 5    aacttcttgatgccctcgatgggccacacctg 36
            ||||||||||||||||| || |||||||||||
Sbjct: 1157 aacttcttgatgccctcaattggccacacctg 1126



to top

>dbj|AB042068.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p13-1
          Length = 985

 Score = 60.0 bits (30), Expect = 7e-07
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| |||||||||||||
Sbjct: 149 acctgcatgcacctgatccttccgccgttgctgacgc 113



 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 637 ctcgaacttcttgatgccctcaatcggccacacctg 602



to top

>dbj|AB020945.1| Avena sativa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Ave-A
          Length = 590

 Score = 58.0 bits (29), Expect = 3e-06
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 32  acctgcatgcacctgatncttccaccgttgctgacg 67
           ||||||||||| ||||| ||||||||||||||||||
Sbjct: 135 acctgcatgcatctgatccttccaccgttgctgacg 100



 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 258 ctcgaacttcttgatgccctcaatcggccacacctg 223



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                    
Query: 1        ctcgaacttcttgatgccctcgatgggccacacctg 36
                ||||||||||||||||||||| || |||||||||||
Sbjct: 11261963 ctcgaacttcttgatgccctcaattggccacacctg 11261928



 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                   
Query: 1        ctcgaacttcttgatgccctcgatgggccacacct 35
                ||||||||||||||||||||| || ||||||||||
Sbjct: 10080118 ctcgaacttcttgatgccctcaatcggccacacct 10080152



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                     
Query: 32       acctgcatgcacctgatncttccaccgttgctgacgc 68
                |||||||| || ||||| |||||||||||||||||||
Sbjct: 11276478 acctgcatacagctgatccttccaccgttgctgacgc 11276442



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                    
Query: 1        ctcgaacttcttgatgccctcgatgggccacacctg 36
                |||||||||||| |||||||| || |||||||||||
Sbjct: 11319773 ctcgaacttcttaatgccctcaatcggccacacctg 11319738



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                    
Query: 32       acctgcatgcacctgatncttccaccgttgctgacg 67
                ||||||||||| ||||| ||||| || |||||||||
Sbjct: 11319639 acctgcatgcatctgatccttccgccattgctgacg 11319604



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 5        aacttcttgatgccctcgatgggccacacctgc 37
                |||||||||||||| || || ||||||||||||
Sbjct: 11276622 aacttcttgatgccttcaatcggccacacctgc 11276590



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                    
Query: 32       acctgcatgcacctgatncttccaccgttgctgacg 67
                |||||||||||| |||| ||||| || |||||||||
Sbjct: 11261821 acctgcatgcacttgatccttccgccattgctgacg 11261786



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                    
Query: 32       acctgcatgcacctgatncttccaccgttgctgacg 67
                ||||||||||||||||| || || || |||||||||
Sbjct: 10080252 acctgcatgcacctgatcctgccgccattgctgacg 10080287



 Score = 38.2 bits (19), Expect = 2.6
 Identities = 27/30 (90%)
 Strand = Plus / Minus

                                              
Query: 32       acctgcatgcacctgatncttccaccgttg 61
                |||||||||||| |||| ||||| ||||||
Sbjct: 11264859 acctgcatgcacttgatccttccgccgttg 11264830



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                    
Query: 1        ctcgaacttcttgatgccctcgatgggccacacctg 36
                ||||||||||||||||||||| || |||||||||||
Sbjct: 11261634 ctcgaacttcttgatgccctcaattggccacacctg 11261599



 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                   
Query: 1        ctcgaacttcttgatgccctcgatgggccacacct 35
                ||||||||||||||||||||| || ||||||||||
Sbjct: 10080003 ctcgaacttcttgatgccctcaatcggccacacct 10080037



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                     
Query: 32       acctgcatgcacctgatncttccaccgttgctgacgc 68
                |||||||| || ||||| |||||||||||||||||||
Sbjct: 11276149 acctgcatacagctgatccttccaccgttgctgacgc 11276113



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                    
Query: 1        ctcgaacttcttgatgccctcgatgggccacacctg 36
                |||||||||||| |||||||| || |||||||||||
Sbjct: 11319444 ctcgaacttcttaatgccctcaatcggccacacctg 11319409



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                    
Query: 32       acctgcatgcacctgatncttccaccgttgctgacg 67
                ||||||||||| ||||| ||||| || |||||||||
Sbjct: 11319310 acctgcatgcatctgatccttccgccattgctgacg 11319275



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 5        aacttcttgatgccctcgatgggccacacctgc 37
                |||||||||||||| || || ||||||||||||
Sbjct: 11276293 aacttcttgatgccttcaatcggccacacctgc 11276261



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                    
Query: 32       acctgcatgcacctgatncttccaccgttgctgacg 67
                |||||||||||| |||| ||||| || |||||||||
Sbjct: 11261492 acctgcatgcacttgatccttccgccattgctgacg 11261457



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                    
Query: 32       acctgcatgcacctgatncttccaccgttgctgacg 67
                ||||||||||||||||| || || || |||||||||
Sbjct: 10080137 acctgcatgcacctgatcctgccgccattgctgacg 10080172



 Score = 38.2 bits (19), Expect = 2.6
 Identities = 27/30 (90%)
 Strand = Plus / Minus

                                              
Query: 32       acctgcatgcacctgatncttccaccgttg 61
                |||||||||||| |||| ||||| ||||||
Sbjct: 11264530 acctgcatgcacttgatccttccgccgttg 11264501



to top

>emb|BX119951.3|CNS09S4U Oryza sativa chromosome 12, . BAC OJ1523_A01 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 127267

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                  
Query: 1      ctcgaacttcttgatgccctcgatgggccacacctg 36
              ||||||||||||||||||||| || |||||||||||
Sbjct: 110091 ctcgaacttcttgatgccctcaattggccacacctg 110126



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                  
Query: 32    acctgcatgcacctgatncttccaccgttgctgacgc 68
             |||||||| || ||||| |||||||||||||||||||
Sbjct: 95576 acctgcatacagctgatccttccaccgttgctgacgc 95612



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 1     ctcgaacttcttgatgccctcgatgggccacacctg 36
             |||||||||||| |||||||| || |||||||||||
Sbjct: 52281 ctcgaacttcttaatgccctcaatcggccacacctg 52316



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 32     acctgcatgcacctgatncttccaccgttgctgacg 67
              |||||||||||| |||| ||||| || |||||||||
Sbjct: 110233 acctgcatgcacttgatccttccgccattgctgacg 110268



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 5     aacttcttgatgccctcgatgggccacacctgc 37
             |||||||||||||| || || ||||||||||||
Sbjct: 95432 aacttcttgatgccttcaatcggccacacctgc 95464



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 32    acctgcatgcacctgatncttccaccgttgctgacg 67
             ||||||||||| ||||| ||||| || |||||||||
Sbjct: 52415 acctgcatgcatctgatccttccgccattgctgacg 52450



 Score = 38.2 bits (19), Expect = 2.6
 Identities = 27/30 (90%)
 Strand = Plus / Plus

                                            
Query: 32     acctgcatgcacctgatncttccaccgttg 61
              |||||||||||| |||| ||||| ||||||
Sbjct: 107195 acctgcatgcacttgatccttccgccgttg 107224



to top

>dbj|AB020959.1| Secale cereale DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sec-B
          Length = 789

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 457 ctcgaacttcttgatgccctcaattggccacacctg 422



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020958.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-B2
          Length = 781

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 449 ctcgaacttcttgatgccctcaattggccacacctg 414



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttcccccattgctgacgc 99



to top

>dbj|AB020955.1| Triticum timopheevii subsp. armeniacum DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Ara-B
          Length = 787

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 455 ctcgaacttcttgatgccctcaattggccacacctg 420



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020954.1| Triticum urartu DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Ura-B
          Length = 787

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 455 ctcgaacttcttgatgccctcaattggccacacctg 420



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020953.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Squ-B
          Length = 781

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 449 ctcgaacttcttgatgccctcaattggccacacctg 414



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020952.1| Aegilops searsii DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sea-B
          Length = 728

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 396 ctcgaacttcttgatgccctcaattggccacacctg 361



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020951.1| Aegilops bicornis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bic-B
          Length = 783

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 456 ctcgaacttcttgatgccctcaattggccacacctg 421



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020950.1| Aegilops sharonensis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sha-B
          Length = 792

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 460 ctcgaacttcttgatgccctcaattggccacacctg 425



to top

>dbj|AB020949.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-B
          Length = 792

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 460 ctcgaacttcttgatgccctcaattggccacacctg 425



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020947.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe2-B
          Length = 738

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 440 ctcgaacttcttgatgccctcaatcggccacacctg 405



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020946.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe1-B
          Length = 787

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 455 ctcgaacttcttgatgccctcaatcggccacacctg 420



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020944.1| Agropyron intermedium DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Agr-A
          Length = 604

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 272 ctcgaacttcttgatgccctcaatcggccacacctg 237



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020942.1| Secale cereale DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sec-A
          Length = 591

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 259 ctcgaacttcttgatgccctcaatcggccacacctg 224



 Score = 50.1 bits (25), Expect = 7e-04
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 32  acctgcatgcacctgatncttccaccgttgctgacg 67
           ||||||||||||||||| ||||| || |||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacg 100



to top

>dbj|AB020938.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Squ-A
          Length = 607

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 275 ctcgaacttcttgatgccctcaatcggccacacctg 240



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020937.1| Aegilops searsii DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sea-A
          Length = 611

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 279 ctcgaacttcttgatgccctcaatcggccacacctg 244



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020931.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A3
          Length = 604

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 272 ctcgaacttcttgatgccctcaatcggccacacctg 237



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020930.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A2
          Length = 604

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 272 ctcgaacttcttgatgccctcaatcggccacacctg 237



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020929.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A1
          Length = 604

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 272 ctcgaacttcttgatgccctcaatcggccacacctg 237



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020928.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe2-A
          Length = 604

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 272 ctcgaacttcttgatgccctcaatcggccacacctg 237



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020927.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe1-A1
          Length = 604

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 272 ctcgaacttcttgatgccctcaatcggccacacctg 237



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020926.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds
          Length = 604

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 272 ctcgaacttcttgatgccctcaatcggccacacctg 237



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020960.1| Bromus catharticus DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bro-B
          Length = 784

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 452 ctcgaacttcttgatgccctcaattggccacacctg 417



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| ||| |||||||||
Sbjct: 132 acctgcatgcacctgatccttccgccgctgctgacgc 96



to top

>dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
            carboxylase/oxygenase small subunit, complete cds,
            clone:6, subclone:16
          Length = 5980

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 1    ctcgaacttcttgatgccctcgatgggccacacctg 36
            |||||||||||||||||||||||| ||||| |||||
Sbjct: 3978 ctcgaacttcttgatgccctcgatcggccaaacctg 3943



 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 915 ctcgaacttcttgatgccctcaatcggccacacctg 880



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 771 acctgcatgcacctgatccttccgccattgctgacgc 735



to top

>dbj|AB042065.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase Small subunit, complete cds,
           clone:p6-1
          Length = 638

 Score = 56.0 bits (28), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||||||||| || |||||||||||
Sbjct: 290 ctcgaacttcttgatgccctcaatcggccacacctg 255



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 146 acctgcatgcacctgatccttccgccattgctgacgc 110



to top

>gb|AY023648.1| Oryza sativa microsatellite MRG5973 containing (TTC)X13, closest to
           marker S10704, genomic sequence
          Length = 239

 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 1   ctcgaacttcttgatgccctcgatgggccacacct 35
           ||||||||||||||||||||| || ||||||||||
Sbjct: 207 ctcgaacttcttgatgccctcaatcggccacacct 173



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                              
Query: 32 acctgcatgcacctgatncttccaccgttgctgacg 67
          ||||||||||||||||| || || || |||||||||
Sbjct: 73 acctgcatgcacctgatcctgccgccattgctgacg 38



to top

>gb|BT012936.1| Lycopersicon esculentum clone 114099R, mRNA sequence
          Length = 1261

 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 26  ggccacacctgcatgcacctgatncttccaccgttgct 63
           ||||||||||||||||| ||||  ||||||||||||||
Sbjct: 771 ggccacacctgcatgcaactgactcttccaccgttgct 734



to top

>gb|DQ418485.1| Zingiber officinale ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit mRNA, partial cds; chloroplast
          Length = 367

 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 2   tcgaacttcttgatgccctcgatgggccacacctgcatgcacc 44
           |||||||||||  | |||||||| |||||||||||||||||||
Sbjct: 214 tcgaacttcttcttcccctcgatcggccacacctgcatgcacc 172



to top

>emb|X07515.1|OSRBCS Rice rbcS gene for ribulose 1,5-bisphosphate carboxylase/oxygenase
           small subunit (EC 4.1.1.39)
          Length = 1110

 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 1   ctcgaacttcttgatgccctcgatgggccacacct 35
           ||||||||||||||||||||| || ||||||||||
Sbjct: 526 ctcgaacttcttgatgccctcaatcggccacacct 492



to top

>emb|AL731739.4|CNS08C7O Oryza sativa chromosome 12, . BAC OSJNBa0056I18 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 145890

 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 1     ctcgaacttcttgatgccctcgatgggccacacct 35
             ||||||||||||||||||||| || ||||||||||
Sbjct: 82503 ctcgaacttcttgatgccctcaatcggccacacct 82469



 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 32    acctgcatgcacctgatncttccaccgttgctgacg 67
             ||||||||||||||||| || || || |||||||||
Sbjct: 82369 acctgcatgcacctgatcctgccgccattgctgacg 82334



to top

>dbj|AB020957.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-B1
          Length = 787

 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 1   ctcgaacttcttgatgccctcgatgggccacacct 35
           ||||||||||||||||||||| || ||||||||||
Sbjct: 455 ctcgaacttcttgatgccctcaattggccacacct 421



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020956.1| Triticum turgidum subsp. dicoccoides DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Dic-B
          Length = 787

 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 1   ctcgaacttcttgatgccctcgatgggccacacct 35
           ||||||||||||||||||||| || ||||||||||
Sbjct: 455 ctcgaacttcttgatgccctcaattggccacacct 421



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020948.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-B
          Length = 772

 Score = 54.0 bits (27), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 1   ctcgaacttcttgatgccctcgatgggccacacct 35
           ||||||||||||||||||||| || ||||||||||
Sbjct: 440 ctcgaacttcttgatgccctcaattggccacacct 406



 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



to top

>dbj|AB020943.1| Hordeum vulgare DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Hor-A
          Length = 605

 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||| ||||| || |||||||||||
Sbjct: 273 ctcgaacttcttgataccctcaatcggccacacctg 238



to top

>dbj|AB020941.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-A
          Length = 605

 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||| ||||| || |||||||||||
Sbjct: 273 ctcgaacttcttgataccctcaatcggccacacctg 238



to top

>dbj|AB020940.1| Triticum turgidum subsp. dicoccoides DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Dic-A
          Length = 605

 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||| ||||| || |||||||||||
Sbjct: 273 ctcgaacttcttgataccctcaatcggccacacctg 238



to top

>dbj|AB020936.1| Aegilops bicornis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bic-A
          Length = 605

 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||| ||||| || |||||||||||
Sbjct: 273 ctcgaacttcttgataccctcaatcggccacacctg 238



to top

>dbj|AB020935.1| Aegilops sharonensis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sha-A
          Length = 605

 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



 Score = 40.1 bits (20), Expect = 0.67
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           |||||| |||||||| ||||| || |||||||||||
Sbjct: 273 ctcgaatttcttgataccctcaatcggccacacctg 238



to top

>dbj|AB020934.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A3
          Length = 605

 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||| ||||| || |||||||||||
Sbjct: 273 ctcgaacttcttgataccctcaatcggccacacctg 238



to top

>dbj|AB020933.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A2
          Length = 605

 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||| ||||| || |||||||||||
Sbjct: 273 ctcgaacttcttgataccctcaatcggccacacctg 238



to top

>dbj|AB020932.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A1
          Length = 605

 Score = 52.0 bits (26), Expect = 2e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 32  acctgcatgcacctgatncttccaccgttgctgacgc 68
           ||||||||||||||||| ||||| || ||||||||||
Sbjct: 135 acctgcatgcacctgatccttccgccattgctgacgc 99



 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||| ||||| || |||||||||||
Sbjct: 273 ctcgaacttcttgataccctcaatcggccacacctg 238



to top

>emb|Y00322.1|ZMRBCS Maize rbcS gene for ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit (EC 4.1.1.39)
          Length = 1648

 Score = 50.1 bits (25), Expect = 7e-04
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 32  acctgcatgcacctgatncttccaccgttgctgacg 67
           ||||||||||||| ||| ||||| ||||||||||||
Sbjct: 639 acctgcatgcaccggatccttccgccgttgctgacg 604



to top

>emb|Y09214.1|ZMRUBSMSU Z.mays rubisco small subunit gene
          Length = 1274

 Score = 50.1 bits (25), Expect = 7e-04
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 32  acctgcatgcacctgatncttccaccgttgctgacg 67
           ||||||||||||| ||| ||||| ||||||||||||
Sbjct: 344 acctgcatgcaccggatccttccgccgttgctgacg 309



to top

>gb|M86717.1|SCFBCS1A Saccharum hybrid cultivar H32-8560 ribulose 1,5-bisphosphate
            carboxylase/oxygenase small subunit gene, complete cds
          Length = 2328

 Score = 48.1 bits (24), Expect = 0.003
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 32   acctgcatgcacctgatncttccaccgttgctgac 66
            ||||||||||||| ||| ||||| |||||||||||
Sbjct: 1317 acctgcatgcaccggatccttccgccgttgctgac 1283



to top

>dbj|AB042067.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p10-1
          Length = 629

 Score = 48.1 bits (24), Expect = 0.003
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctg 36
           ||||||||||||||| ||||| || |||||||||||
Sbjct: 281 ctcgaacttcttgataccctcaatcggccacacctg 246



 Score = 40.1 bits (20), Expect = 0.67
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 32  acctgcatgcacctgatncttcc 54
           ||||||||||||||||| |||||
Sbjct: 143 acctgcatgcacctgatccttcc 121



to top

>emb|X17231.1|LGRBCS5B Lemna gibba rbcS gene SSU5B for small subunit of ribulose
           bisphosphate carboxylase (EC 4.1.1.39)
          Length = 800

 Score = 44.1 bits (22), Expect = 0.043
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgca 42
           |||||||||||||| ||||||    |||||||||||||||||
Sbjct: 210 ctcgaacttcttgaggccctccggcggccacacctgcatgca 169



to top

>emb|X17230.1|LGRBCS5A Lemna gibba rbcS gene SSU5A for small subunit of ribulose
           bisphosphate carboxylase (EC 4.1.1.39)
          Length = 858

 Score = 44.1 bits (22), Expect = 0.043
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgca 42
           |||||||||||||| ||||||    |||||||||||||||||
Sbjct: 210 ctcgaacttcttgaggccctccggcggccacacctgcatgca 169



to top

>emb|AJ419826.1|CAR419826 Coffea arabica mRNA for rubisco small subunit (rbcs1 gene)
          Length = 934

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 26  ggccacacctgcatgcacctgatncttccaccgttg 61
           ||||||||||||||||||  ||  ||||||||||||
Sbjct: 238 ggccacacctgcatgcactggactcttccaccgttg 203



to top

>emb|X05986.1|LERBCS3C Tomato rbcS3C gene for ribulose 1,5-biphosp[hate
           carboxylase/oxygenase small subunit
          Length = 1341

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 32  acctgcatgcacctgatncttccaccgttgct 63
           ||||||||||| ||||  ||||||||||||||
Sbjct: 476 acctgcatgcaactgactcttccaccgttgct 445



to top

>emb|X05985.1|LERBCS3B Tomato rbcS3B gene for ribulose 1,5-bisphosphate
           carboxylase/oxygenase small subunit
          Length = 1054

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 32  acctgcatgcacctgatncttccaccgttgct 63
           ||||||||||| ||||  ||||||||||||||
Sbjct: 459 acctgcatgcaactgactcttccaccgttgct 428



to top

>emb|X05984.1|LERBCS3A Tomato rbcS3A gene for ribulose 1,5-bisphosphate
           carboxylae/oxygenase small subunit
          Length = 1520

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 32  acctgcatgcacctgatncttccaccgttgct 63
           ||||||||||| ||||  ||||||||||||||
Sbjct: 556 acctgcatgcaactgactcttccaccgttgct 525



to top

>gb|M13544.1|TOMRBCSC Tomato (L.esculentum) ribulose-1,5-bisphosphate
           carboxylase/oxygenase (RBCS) small subunit gene, clone
           Rbcs-3A
          Length = 1027

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 32  acctgcatgcacctgatncttccaccgttgct 63
           ||||||||||| ||||  ||||||||||||||
Sbjct: 314 acctgcatgcaactgactcttccaccgttgct 283



to top

>gb|M31640.1|CIPRBC Ice plant ribulose-1-5-bisphosphate carboxylase (rbc5) gene,
           complete cds
          Length = 776

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 26  ggccacacctgcatgcacctgatncttccaccgttg 61
           ||||||||||||||||||  ||  ||||||||||||
Sbjct: 221 ggccacacctgcatgcactggactcttccaccgttg 186



to top

>dbj|D11112.1|TOMRBCO Tomato ribulose 1,5-bisphosphate carboxylase/oxygenase small subunit
            gene, complete cds
          Length = 4124

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 32   acctgcatgcacctgatncttccaccgttgct 63
            ||||||||||| ||||  ||||||||||||||
Sbjct: 3529 acctgcatgcaactgactcttccaccgttgct 3498



to top

>dbj|AB067656.1| Oryza sativa (japonica cultivar-group) OsrbcS gene for small subunit
            of ribulose-1,5-bisphosphate carboxylase, promoter region
            and partial cds
          Length = 1815

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 32   acctgcatgcacctgatncttccaccgttgctgacg 67
            ||||||||||||||||| || || || |||||||||
Sbjct: 1699 acctgcatgcacctgatcctgccgccattgctgacg 1664



to top

>gb|AF034479.1| Zantedeschia aethiopica ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit (rbcS) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 968

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 1   ctcgaacttcttgatgccctcgatgggccacacctgcatgcacc 44
           ||||||||||||  |||||||    |||||||||||||||||||
Sbjct: 247 ctcgaacttcttcttgccctccggcggccacacctgcatgcacc 204



to top

>gb|BT013023.1| Lycopersicon esculentum clone 114270R, mRNA sequence
          Length = 1097

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 33/38 (86%)
 Strand = Plus / Minus

                                                 
Query: 26  ggccacacctgcatgcacctgatncttccaccgttgct 63
           ||||||||||||||||| || |  |||||||| |||||
Sbjct: 546 ggccacacctgcatgcagctaactcttccaccattgct 509



to top

>emb|AL121958.6|HSDJ71H19 Human DNA sequence from clone RP1-71H19 on chromosome 6 Contains part
             of the PRIM2A gene for primase polypeptide 2A (58kD) and a
             novel gene, complete sequence
          Length = 138411

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    cacacctgcatgcacctga 47
             |||||||||||||||||||
Sbjct: 78129 cacacctgcatgcacctga 78147



to top

>gb|AC183417.2| Pan troglodytes BAC clone CH251-173K9 from chromosome 6, complete
             sequence
          Length = 158234

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    cacacctgcatgcacctga 47
             |||||||||||||||||||
Sbjct: 40445 cacacctgcatgcacctga 40463



to top

>gb|AC182461.3| Pan troglodytes BAC clone CH251-673H10 from chromosome 6, complete
             sequence
          Length = 188415

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 29    cacacctgcatgcacctga 47
             |||||||||||||||||||
Sbjct: 27970 cacacctgcatgcacctga 27952



to top

>ref|NM_167358.1| Drosophila melanogaster Inositol 1,4,5-triphosphate kinase 2
            CG1630-RB, transcript variant B (IP3K2), mRNA
          Length = 2816

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 7    cttcttgatgccctcgatg 25
            |||||||||||||||||||
Sbjct: 1787 cttcttgatgccctcgatg 1769



to top

>ref|NM_132647.1| Drosophila melanogaster Inositol 1,4,5-triphosphate kinase 2
            CG1630-RA, transcript variant A (IP3K2), mRNA
          Length = 2695

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 7    cttcttgatgccctcgatg 25
            |||||||||||||||||||
Sbjct: 1666 cttcttgatgccctcgatg 1648



to top

>gb|AY084158.1| Drosophila melanogaster RE35745 full insert cDNA
          Length = 2694

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 7    cttcttgatgccctcgatg 25
            |||||||||||||||||||
Sbjct: 1666 cttcttgatgccctcgatg 1648



to top

>gb|AC001228.1|HSAC001228 244Kb Contig from Human Chromosome 11p15.5 spanning D11S1 through D11S25,
              complete sequence
          Length = 244254

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 23     atgggccacacctgcatgc 41
              |||||||||||||||||||
Sbjct: 145084 atgggccacacctgcatgc 145102



to top

>gb|M25613.1|PEARUBP2 Pisum sativum ribulose 1,5 bisphosphate carboxylase (RuBP) mRNA,
          partial cds
          Length = 674

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 33/38 (86%)
 Strand = Plus / Minus

                                                
Query: 26 ggccacacctgcatgcacctgatncttccaccgttgct 63
          |||||||||||||||||| | |  |||||||| |||||
Sbjct: 62 ggccacacctgcatgcactttactcttccaccattgct 25



to top

>gb|AC131971.9| Homo sapiens chromosome 11, clone CTC-343N3, complete sequence
          Length = 176226

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     atgggccacacctgcatgc 41
              |||||||||||||||||||
Sbjct: 130593 atgggccacacctgcatgc 130575



to top

>dbj|AK109003.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-H01, full
           insert sequence
          Length = 1188

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 5   aacttcttgatgccctcga 23
           |||||||||||||||||||
Sbjct: 250 aacttcttgatgccctcga 232



to top

>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome
          Length = 4096345

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 5       aacttcttgatgccctcga 23
               |||||||||||||||||||
Sbjct: 3271277 aacttcttgatgccctcga 3271259



to top

>gb|AF039014.1|AF039014 Fritillaria agrestis clone TA8 ribulose 1,5 bisphosphate
           carboxylase small subunit (rbcS) gene, partial cds
          Length = 592

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 1   ctcgaacttcttgatgccctcgatgggccacacct 35
           |||||||||||| |  ||| |||||||||||||||
Sbjct: 278 ctcgaacttcttcaaccccacgatgggccacacct 244



to top

>gb|AF039011.1|AF039011 Fritillaria agrestis clone TA22 ribulose 1,5 bisphosphate
           carboxylase small subunit (rbcS) gene, partial cds
          Length = 591

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 1   ctcgaacttcttgatgccctcgatgggccacacct 35
           |||||||||||| |  ||| |||||||||||||||
Sbjct: 277 ctcgaacttcttcaaccccacgatgggccacacct 243



to top

>gb|AF039008.1|AF039008 Fritillaria agrestis clone TA15 ribulose 1,5 bisphosphate
           carboxylase small subunit (rbcS) gene, partial cds
          Length = 592

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 1   ctcgaacttcttgatgccctcgatgggccacacct 35
           |||||||||||| |  ||| |||||||||||||||
Sbjct: 278 ctcgaacttcttcaaccccacgatgggccacacct 244



to top

>gb|U51281.1|HSU51281 Human chromosome 11 cosmid cSRL-87f11
          Length = 37972

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 23    atgggccacacctgcatgc 41
             |||||||||||||||||||
Sbjct: 17880 atgggccacacctgcatgc 17862



to top

>gb|L26605.1|SLARBCS Stellaria longipes ribulose-1,5-bisphosphate carboxylase/oxygenase
           (rbcS) mRNA, complete cds
          Length = 723

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 33/38 (86%)
 Strand = Plus / Minus

                                                 
Query: 26  ggccacacctgcatgcacctgatncttccaccgttgct 63
           ||||||||||||||||| ||||  | |||||| |||||
Sbjct: 217 ggccacacctgcatgcatctgactcgtccaccattgct 180



to top

>gb|M15236.1|TOMRBCSE Tomato RuBP carboxylase small subunit LESS5 mRNA
          Length = 742

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 33/38 (86%)
 Strand = Plus / Minus

                                                 
Query: 26  ggccacacctgcatgcacctgatncttccaccgttgct 63
           ||||||||||||||||| || |  |||||||| |||||
Sbjct: 212 ggccacacctgcatgcagctaactcttccaccattgct 175



to top

>gb|M13543.1|TOMRBCSB Tomato (L.esculentum) ribulose-1,5-bisphosphate
           carboxylase/oxygenase (RBCS) small subunit mRNA, clone
           Rbcs-2A
          Length = 599

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 33/38 (86%)
 Strand = Plus / Minus

                                                 
Query: 26  ggccacacctgcatgcacctgatncttccaccgttgct 63
           ||||||||||||||||| || |  |||||||| |||||
Sbjct: 199 ggccacacctgcatgcagctaactcttccaccattgct 162



to top

>gb|J03613.1|POTRBCS Potato (S.tuberosum) ribulose bisphosphate carboxylase (rbcS) mRNA,
           complete cds
          Length = 546

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 33/38 (86%)
 Strand = Plus / Minus

                                                 
Query: 26  ggccacacctgcatgcacctgatncttccaccgttgct 63
           ||||||||||||||||| || |  | ||||||||||||
Sbjct: 188 ggccacacctgcatgcatctaacacgtccaccgttgct 151



to top

>gb|J01257.1|PEARUBPA Pea (P.sativum) ribulose 1,5-bisphosphate carboxylase small subunit
           mRNA, clone pSS15
          Length = 619

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 33/38 (86%)
 Strand = Plus / Minus

                                                 
Query: 26  ggccacacctgcatgcacctgatncttccaccgttgct 63
           |||||||||||||||||| | |  |||||||| |||||
Sbjct: 113 ggccacacctgcatgcactttactcttccaccattgct 76


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 357,399
Number of Sequences: 3902068
Number of extensions: 357399
Number of successful extensions: 21836
Number of sequences better than 10.0: 129
Number of HSP's better than 10.0 without gapping: 126
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 21602
Number of HSP's gapped (non-prelim): 230
length of query: 68
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 47
effective length of database: 17,151,101,840
effective search space: 806101786480
effective search space used: 806101786480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top