>ref|XM_480927.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2202

 Score =  206 bits (104), Expect = 6e-50
 Identities = 293/356 (82%)
 Strand = Plus / Minus

                                                                        
Query: 233  ctccgcttcagcttgtccaaggcccggttctggagctgccggatccgctccttggacaag 292
            |||| ||| ||||| ||||  ||||||||||| ||||||| ||||| |||||||||||  
Sbjct: 1800 ctcctcttgagcttctccagcgcccggttctgcagctgcctgatcctctccttggacagc 1741

                                                                        
Query: 293  ccgtacatgtcgccgatcacatggagcgtcttgggctcgccgtcgtagatcccgaaccgg 352
            ||  ||||||| ||||| ||||| |||||||| |||||||| |||| |||||||||||||
Sbjct: 1740 ccaaacatgtccccgatgacatgtagcgtcttcggctcgccatcgtggatcccgaaccgg 1681

                                                                        
Query: 353  tgctcgacgatctccttctccctcgtgctcaggatgcccaggaactcccgcacctgctgc 412
            ||||||| ||||||||||||||| | ||||||||| |||||||| |||| ||||||||||
Sbjct: 1680 tgctcgatgatctccttctccctggggctcaggatccccaggaagtccctcacctgctgc 1621

                                                                        
Query: 413  ctcatcatgatcctgtccacgacgaggtccggcgaatcgatgttcgggtcctccgtgatc 472
            |||||||| |||||||||||    ||||| || |  || |  || ||||| || ||||||
Sbjct: 1620 ctcatcatcatcctgtccacactcaggtcaggtggctccacatttgggtcttctgtgatc 1561

                                                                        
Query: 473  tcctggaaggtgactgcgtcgttggaccaaacttgatcctgcattgatcgtggctttctg 532
            ||||||||||||||  | || |  ||||| || ||||||||||| || || || || | |
Sbjct: 1560 tcctggaaggtgacaccctcatctgaccagacatgatcctgcatcgaccggggtttccgg 1501

                                                                    
Query: 533  gtcttcgctttgagtttcgccagcttctcgatcgagatgcccgcacgcctagctac 588
            || ||||||  ||| ||||| ||||||||||| | |||||| || ||||| |||||
Sbjct: 1500 gttttcgctcggagcttcgcaagcttctcgatggtgatgccggcgcgcctcgctac 1445

>ref|XM_507175.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBa0087F21.45
            mRNA
          Length = 2257

 Score =  206 bits (104), Expect = 6e-50
 Identities = 293/356 (82%)
 Strand = Plus / Minus

                                                                        
Query: 233  ctccgcttcagcttgtccaaggcccggttctggagctgccggatccgctccttggacaag 292
            |||| ||| ||||| ||||  ||||||||||| ||||||| ||||| |||||||||||  
Sbjct: 1848 ctcctcttgagcttctccagcgcccggttctgcagctgcctgatcctctccttggacagc 1789

                                                                        
Query: 293  ccgtacatgtcgccgatcacatggagcgtcttgggctcgccgtcgtagatcccgaaccgg 352
            ||  ||||||| ||||| ||||| |||||||| |||||||| |||| |||||||||||||
Sbjct: 1788 ccaaacatgtccccgatgacatgtagcgtcttcggctcgccatcgtggatcccgaaccgg 1729

                                                                        
Query: 353  tgctcgacgatctccttctccctcgtgctcaggatgcccaggaactcccgcacctgctgc 412
            ||||||| ||||||||||||||| | ||||||||| |||||||| |||| ||||||||||
Sbjct: 1728 tgctcgatgatctccttctccctggggctcaggatccccaggaagtccctcacctgctgc 1669

                                                                        
Query: 413  ctcatcatgatcctgtccacgacgaggtccggcgaatcgatgttcgggtcctccgtgatc 472
            |||||||| |||||||||||    ||||| || |  || |  || ||||| || ||||||
Sbjct: 1668 ctcatcatcatcctgtccacactcaggtcaggtggctccacatttgggtcttctgtgatc 1609

                                                                        
Query: 473  tcctggaaggtgactgcgtcgttggaccaaacttgatcctgcattgatcgtggctttctg 532
            ||||||||||||||  | || |  ||||| || ||||||||||| || || || || | |
Sbjct: 1608 tcctggaaggtgacaccctcatctgaccagacatgatcctgcatcgaccggggtttccgg 1549

                                                                    
Query: 533  gtcttcgctttgagtttcgccagcttctcgatcgagatgcccgcacgcctagctac 588
            || ||||||  ||| ||||| ||||||||||| | |||||| || ||||| |||||
Sbjct: 1548 gttttcgctcggagcttcgcaagcttctcgatggtgatgccggcgcgcctcgctac 1493

>dbj|AK099922.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116M03, full
            insert sequence
          Length = 2203

 Score =  206 bits (104), Expect = 6e-50
 Identities = 293/356 (82%)
 Strand = Plus / Minus

                                                                        
Query: 233  ctccgcttcagcttgtccaaggcccggttctggagctgccggatccgctccttggacaag 292
            |||| ||| ||||| ||||  ||||||||||| ||||||| ||||| |||||||||||  
Sbjct: 1801 ctcctcttgagcttctccagcgcccggttctgcagctgcctgatcctctccttggacagc 1742

                                                                        
Query: 293  ccgtacatgtcgccgatcacatggagcgtcttgggctcgccgtcgtagatcccgaaccgg 352
            ||  ||||||| ||||| ||||| |||||||| |||||||| |||| |||||||||||||
Sbjct: 1741 ccaaacatgtccccgatgacatgtagcgtcttcggctcgccatcgtggatcccgaaccgg 1682

                                                                        
Query: 353  tgctcgacgatctccttctccctcgtgctcaggatgcccaggaactcccgcacctgctgc 412
            ||||||| ||||||||||||||| | ||||||||| |||||||| |||| ||||||||||
Sbjct: 1681 tgctcgatgatctccttctccctggggctcaggatccccaggaagtccctcacctgctgc 1622

                                                                        
Query: 413  ctcatcatgatcctgtccacgacgaggtccggcgaatcgatgttcgggtcctccgtgatc 472
            |||||||| |||||||||||    ||||| || |  || |  || ||||| || ||||||
Sbjct: 1621 ctcatcatcatcctgtccacactcaggtcaggtggctccacatttgggtcttctgtgatc 1562

                                                                        
Query: 473  tcctggaaggtgactgcgtcgttggaccaaacttgatcctgcattgatcgtggctttctg 532
            ||||||||||||||  | || |  ||||| || ||||||||||| || || || || | |
Sbjct: 1561 tcctggaaggtgacaccctcatctgaccagacatgatcctgcatcgaccggggtttccgg 1502

                                                                    
Query: 533  gtcttcgctttgagtttcgccagcttctcgatcgagatgcccgcacgcctagctac 588
            || ||||||  ||| ||||| ||||||||||| | |||||| || ||||| |||||
Sbjct: 1501 gttttcgctcggagcttcgcaagcttctcgatggtgatgccggcgcgcctcgctac 1446

>dbj|AK068874.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013170C15, full
            insert sequence
          Length = 2258

 Score =  206 bits (104), Expect = 6e-50
 Identities = 293/356 (82%)
 Strand = Plus / Minus

                                                                        
Query: 233  ctccgcttcagcttgtccaaggcccggttctggagctgccggatccgctccttggacaag 292
            |||| ||| ||||| ||||  ||||||||||| ||||||| ||||| |||||||||||  
Sbjct: 1849 ctcctcttgagcttctccagcgcccggttctgcagctgcctgatcctctccttggacagc 1790

                                                                        
Query: 293  ccgtacatgtcgccgatcacatggagcgtcttgggctcgccgtcgtagatcccgaaccgg 352
            ||  ||||||| ||||| ||||| |||||||| |||||||| |||| |||||||||||||
Sbjct: 1789 ccaaacatgtccccgatgacatgtagcgtcttcggctcgccatcgtggatcccgaaccgg 1730

                                                                        
Query: 353  tgctcgacgatctccttctccctcgtgctcaggatgcccaggaactcccgcacctgctgc 412
            ||||||| ||||||||||||||| | ||||||||| |||||||| |||| ||||||||||
Sbjct: 1729 tgctcgatgatctccttctccctggggctcaggatccccaggaagtccctcacctgctgc 1670

                                                                        
Query: 413  ctcatcatgatcctgtccacgacgaggtccggcgaatcgatgttcgggtcctccgtgatc 472
            |||||||| |||||||||||    ||||| || |  || |  || ||||| || ||||||
Sbjct: 1669 ctcatcatcatcctgtccacactcaggtcaggtggctccacatttgggtcttctgtgatc 1610

                                                                        
Query: 473  tcctggaaggtgactgcgtcgttggaccaaacttgatcctgcattgatcgtggctttctg 532
            ||||||||||||||  | || |  ||||| || ||||||||||| || || || || | |
Sbjct: 1609 tcctggaaggtgacaccctcatctgaccagacatgatcctgcatcgaccggggtttccgg 1550

                                                                    
Query: 533  gtcttcgctttgagtttcgccagcttctcgatcgagatgcccgcacgcctagctac 588
            || ||||||  ||| ||||| ||||||||||| | |||||| || ||||| |||||
Sbjct: 1549 gttttcgctcggagcttcgcaagcttctcgatggtgatgccggcgcgcctcgctac 1494

>dbj|AB096012.1| Oryza sativa (japonica cultivar-group) SIG6 mRNA for Sig6, complete
            cds
          Length = 1720

 Score =  206 bits (104), Expect = 6e-50
 Identities = 293/356 (82%)
 Strand = Plus / Minus

                                                                        
Query: 233  ctccgcttcagcttgtccaaggcccggttctggagctgccggatccgctccttggacaag 292
            |||| ||| ||||| ||||  ||||||||||| ||||||| ||||| |||||||||||  
Sbjct: 1673 ctcctcttgagcttctccagcgcccggttctgcagctgcctgatcctctccttggacagc 1614

                                                                        
Query: 293  ccgtacatgtcgccgatcacatggagcgtcttgggctcgccgtcgtagatcccgaaccgg 352
            ||  ||||||| ||||| ||||| |||||||| |||||||| |||| |||||||||||||
Sbjct: 1613 ccaaacatgtccccgatgacatgtagcgtcttcggctcgccatcgtggatcccgaaccgg 1554

                                                                        
Query: 353  tgctcgacgatctccttctccctcgtgctcaggatgcccaggaactcccgcacctgctgc 412
            ||||||| ||||||||||||||| | ||||||||| |||||||| |||| ||||||||||
Sbjct: 1553 tgctcgatgatctccttctccctggggctcaggatccccaggaagtccctcacctgctgc 1494

                                                                        
Query: 413  ctcatcatgatcctgtccacgacgaggtccggcgaatcgatgttcgggtcctccgtgatc 472
            |||||||| |||||||||||    ||||| || |  || |  || ||||| || ||||||
Sbjct: 1493 ctcatcatcatcctgtccacactcaggtcaggtggctccacatttgggtcttctgtgatc 1434

                                                                        
Query: 473  tcctggaaggtgactgcgtcgttggaccaaacttgatcctgcattgatcgtggctttctg 532
            ||||||||||||||  | || |  ||||| || ||||||||||| || || || || | |
Sbjct: 1433 tcctggaaggtgacaccctcatctgaccagacatgatcctgcatcgaccggggtttccgg 1374

                                                                    
Query: 533  gtcttcgctttgagtttcgccagcttctcgatcgagatgcccgcacgcctagctac 588
            || ||||||  ||| ||||| ||||||||||| | |||||| || ||||| |||||
Sbjct: 1373 gttttcgctcggagcttcgcaagcttctcgatggtgatgccggcgcgcctcgctac 1318

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  198 bits (100), Expect = 1e-47
 Identities = 175/200 (87%)
 Strand = Plus / Minus

                                                                           
Query: 233     ctccgcttcagcttgtccaaggcccggttctggagctgccggatccgctccttggacaag 292
               |||| ||| ||||| ||||  ||||||||||| ||||||| ||||| |||||||||||  
Sbjct: 8674708 ctcctcttgagcttctccagcgcccggttctgcagctgcctgatcctctccttggacagc 8674649

                                                                           
Query: 293     ccgtacatgtcgccgatcacatggagcgtcttgggctcgccgtcgtagatcccgaaccgg 352
               ||  ||||||| ||||| ||||| |||||||| |||||||| |||| |||||||||||||
Sbjct: 8674648 ccaaacatgtccccgatgacatgtagcgtcttcggctcgccatcgtggatcccgaaccgg 8674589

                                                                           
Query: 353     tgctcgacgatctccttctccctcgtgctcaggatgcccaggaactcccgcacctgctgc 412
               ||||||| ||||||||||||||| | ||||||||| |||||||| |||| ||||||||||
Sbjct: 8674588 tgctcgatgatctccttctccctggggctcaggatccccaggaagtccctcacctgctgc 8674529

                                   
Query: 413     ctcatcatgatcctgtccac 432
               |||||||| |||||||||||
Sbjct: 8674528 ctcatcatcatcctgtccac 8674509



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 74/92 (80%)
 Strand = Plus / Minus

                                                                           
Query: 497     gaccaaacttgatcctgcattgatcgtggctttctggtcttcgctttgagtttcgccagc 556
               ||||| || ||||||||||| || || || || | ||| ||||||  ||| ||||| |||
Sbjct: 8673980 gaccagacatgatcctgcatcgaccggggtttccgggttttcgctcggagcttcgcaagc 8673921

                                               
Query: 557     ttctcgatcgagatgcccgcacgcctagctac 588
               |||||||| | |||||| || ||||| |||||
Sbjct: 8673920 ttctcgatggtgatgccggcgcgcctcgctac 8673889

>dbj|AP005249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0087F21
          Length = 187401

 Score =  198 bits (100), Expect = 1e-47
 Identities = 175/200 (87%)
 Strand = Plus / Minus

                                                                          
Query: 233    ctccgcttcagcttgtccaaggcccggttctggagctgccggatccgctccttggacaag 292
              |||| ||| ||||| ||||  ||||||||||| ||||||| ||||| |||||||||||  
Sbjct: 186619 ctcctcttgagcttctccagcgcccggttctgcagctgcctgatcctctccttggacagc 186560

                                                                          
Query: 293    ccgtacatgtcgccgatcacatggagcgtcttgggctcgccgtcgtagatcccgaaccgg 352
              ||  ||||||| ||||| ||||| |||||||| |||||||| |||| |||||||||||||
Sbjct: 186559 ccaaacatgtccccgatgacatgtagcgtcttcggctcgccatcgtggatcccgaaccgg 186500

                                                                          
Query: 353    tgctcgacgatctccttctccctcgtgctcaggatgcccaggaactcccgcacctgctgc 412
              ||||||| ||||||||||||||| | ||||||||| |||||||| |||| ||||||||||
Sbjct: 186499 tgctcgatgatctccttctccctggggctcaggatccccaggaagtccctcacctgctgc 186440

                                  
Query: 413    ctcatcatgatcctgtccac 432
              |||||||| |||||||||||
Sbjct: 186439 ctcatcatcatcctgtccac 186420



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 74/92 (80%)
 Strand = Plus / Minus

                                                                          
Query: 497    gaccaaacttgatcctgcattgatcgtggctttctggtcttcgctttgagtttcgccagc 556
              ||||| || ||||||||||| || || || || | ||| ||||||  ||| ||||| |||
Sbjct: 185891 gaccagacatgatcctgcatcgaccggggtttccgggttttcgctcggagcttcgcaagc 185832

                                              
Query: 557    ttctcgatcgagatgcccgcacgcctagctac 588
              |||||||| | |||||| || ||||| |||||
Sbjct: 185831 ttctcgatggtgatgccggcgcgcctcgctac 185800

>dbj|AP005478.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0070J06
          Length = 142303

 Score =  198 bits (100), Expect = 1e-47
 Identities = 175/200 (87%)
 Strand = Plus / Minus

                                                                         
Query: 233   ctccgcttcagcttgtccaaggcccggttctggagctgccggatccgctccttggacaag 292
             |||| ||| ||||| ||||  ||||||||||| ||||||| ||||| |||||||||||  
Sbjct: 17687 ctcctcttgagcttctccagcgcccggttctgcagctgcctgatcctctccttggacagc 17628

                                                                         
Query: 293   ccgtacatgtcgccgatcacatggagcgtcttgggctcgccgtcgtagatcccgaaccgg 352
             ||  ||||||| ||||| ||||| |||||||| |||||||| |||| |||||||||||||
Sbjct: 17627 ccaaacatgtccccgatgacatgtagcgtcttcggctcgccatcgtggatcccgaaccgg 17568

                                                                         
Query: 353   tgctcgacgatctccttctccctcgtgctcaggatgcccaggaactcccgcacctgctgc 412
             ||||||| ||||||||||||||| | ||||||||| |||||||| |||| ||||||||||
Sbjct: 17567 tgctcgatgatctccttctccctggggctcaggatccccaggaagtccctcacctgctgc 17508

                                 
Query: 413   ctcatcatgatcctgtccac 432
             |||||||| |||||||||||
Sbjct: 17507 ctcatcatcatcctgtccac 17488



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 74/92 (80%)
 Strand = Plus / Minus

                                                                         
Query: 497   gaccaaacttgatcctgcattgatcgtggctttctggtcttcgctttgagtttcgccagc 556
             ||||| || ||||||||||| || || || || | ||| ||||||  ||| ||||| |||
Sbjct: 16959 gaccagacatgatcctgcatcgaccggggtttccgggttttcgctcggagcttcgcaagc 16900

                                             
Query: 557   ttctcgatcgagatgcccgcacgcctagctac 588
             |||||||| | |||||| || ||||| |||||
Sbjct: 16899 ttctcgatggtgatgccggcgcgcctcgctac 16868

>gb|AF099112.1| Zea mays sigma factor SIG6 (sig6) mRNA, complete cds; nuclear gene
            for chloroplast product
          Length = 1823

 Score =  153 bits (77), Expect = 8e-34
 Identities = 166/195 (85%), Gaps = 3/195 (1%)
 Strand = Plus / Minus

                                                                        
Query: 242  agcttgtccaaggcccggttctggagctgccggatccgctccttggacaagccgtacatg 301
            |||||||||| ||||  |||||| | ||| ||||||| ||||||||||| ||||||||||
Sbjct: 1629 agcttgtccagggccttgttctgcacctggcggatcctctccttggacaggccgtacatg 1570

                                                                        
Query: 302  tcgccgatcacatggagcgtcttgggctcgccgtcgtagatcccgaaccggtgctcgacg 361
            |||||||| ||||| || |||||||||| |||||||| ||| |||||||||||||||| |
Sbjct: 1569 tcgccgatgacatgcagggtcttgggctggccgtcgtggatgccgaaccggtgctcgatg 1510

                                                                        
Query: 362  atctccttctccctcgtgctcaggatgcc---caggaactcccgcacctgctgcctcatc 418
            |||||||||||||  | ||||||||| ||   ||||||    ||||||||||||| ||||
Sbjct: 1509 atctccttctcccgggggctcaggatccccgtcaggaagctgcgcacctgctgccgcatc 1450

                           
Query: 419  atgatcctgtccacg 433
            || | ||||||||||
Sbjct: 1449 atcagcctgtccacg 1435



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                        
Query: 452  atgttcgggtcctccgtgatctcctggaaggtgactgcgtcgttggaccaaacttgatcc 511
            ||||| |||||||| |||||||||||| | || ||  ||||||  ||||| ||| |||||
Sbjct: 1416 atgttggggtcctcggtgatctcctggtatgtcacaccgtcgtctgaccagactcgatcc 1357

                                                                        
Query: 512  tgcattgatcgtggctttctggtcttcgctttgagtttcgccagcttctcgatcgagatg 571
            ||||| || |||   || ||||| |||||| | |||||||||||||| || |||| ||||
Sbjct: 1356 tgcatggaccgtactttcctggttttcgctctcagtttcgccagcttttcaatcgtgatg 1297

                       
Query: 572  cccgcacgcct 582
            || ||||||||
Sbjct: 1296 ccagcacgcct 1286

>gb|AC142119.2| Homo sapiens fosmid clone XXFOS-80464F2 from 2, complete sequence
          Length = 10256

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 14   tttctgcttagttctaggaggcttg 38
            |||||||||| ||||||||||||||
Sbjct: 8291 tttctgcttatttctaggaggcttg 8267

>emb|BX005307.12| Zebrafish DNA sequence from clone DKEY-235F19 in linkage group 6,
             complete sequence
          Length = 200462

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 6     tgtttgtgtttctgcttagtt 26
             |||||||||||||||||||||
Sbjct: 49527 tgtttgtgtttctgcttagtt 49507



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 6     tgtttgtgtttctgcttagtt 26
             |||||||||||||||||||||
Sbjct: 19878 tgtttgtgtttctgcttagtt 19858

>emb|BX005391.9| Zebrafish DNA sequence from clone DKEY-91F15 in linkage group 6,
           complete sequence
          Length = 162632

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 6   tgtttgtgtttctgcttagtt 26
           |||||||||||||||||||||
Sbjct: 433 tgtttgtgtttctgcttagtt 453

>emb|BX950169.13| Zebrafish DNA sequence from clone CH211-203N19 in linkage group 6,
            complete sequence
          Length = 154466

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 6    tgtttgtgtttctgcttagtt 26
            |||||||||||||||||||||
Sbjct: 3501 tgtttgtgtttctgcttagtt 3521

>gb|AC114618.9| Mus musculus chromosome 3, clone RP24-86C15, complete sequence
          Length = 209209

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 458   gggtcctccgtgatctcctggaagg 482
             |||||||||||| ||||||||||||
Sbjct: 82073 gggtcctccgtgttctcctggaagg 82049

>gb|AC005371.1| Homo sapiens chromosome 5, BAC clone 342p15 (LBNL H189), complete
             sequence
          Length = 142600

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   tgtgtttccttttgtatgaa 147
             ||||||||||||||||||||
Sbjct: 14155 tgtgtttccttttgtatgaa 14136

>ref|XM_417508.1| PREDICTED: Gallus gallus similar to Potential
            phospholipid-transporting ATPase IIA (LOC419345), mRNA
          Length = 10950

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 373  cctcgtgctcaggatgcccaggaa 396
            ||||||||||||||| ||||||||
Sbjct: 3447 cctcgtgctcaggatacccaggaa 3424

>ref|XM_762043.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_514_15116_17125)
            partial mRNA
          Length = 2010

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 377  gtgctcaggatgcccaggaa 396
            ||||||||||||||||||||
Sbjct: 1963 gtgctcaggatgcccaggaa 1982

>gb|U40029.1| Caenorhabditis elegans cosmid F10G7, complete sequence
          Length = 43675

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 132   tttccttttgtatgaacaatcgaaccga 159
             |||||||||| |||||||||||| ||||
Sbjct: 23433 tttccttttggatgaacaatcgatccga 23406

>gb|AC008689.8| Homo sapiens chromosome 5 clone CTB-61G23, complete sequence
          Length = 138824

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   tgtgtttccttttgtatgaa 147
             ||||||||||||||||||||
Sbjct: 72516 tgtgtttccttttgtatgaa 72497

>ref|NM_062438.2| Caenorhabditis elegans Tudor Staphylococcal Nuclease homolog family
           member (tsn-1) (tsn-1) mRNA, complete cds
          Length = 2776

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 132 tttccttttgtatgaacaatcgaaccga 159
           |||||||||| |||||||||||| ||||
Sbjct: 879 tttccttttggatgaacaatcgatccga 852

>gb|AC160399.6| Mus musculus 6 BAC RP23-218B15 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 196625

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 13   gtttctgcttagttctagga 32
            ||||||||||||||||||||
Sbjct: 5172 gtttctgcttagttctagga 5153

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 391     caggaactcccgcacctgct 410
               ||||||||||||||||||||
Sbjct: 3316336 caggaactcccgcacctgct 3316317

>gb|AC133086.4| Mus musculus BAC clone RP24-110I11 from 6, complete sequence
          Length = 212696

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    gtttctgcttagttctagga 32
             ||||||||||||||||||||
Sbjct: 65564 gtttctgcttagttctagga 65583

>gb|U66560.1|MAU66560 Mycobacterium avium EmbR (embR), EmbA (embA) and EmbB (embB) genes,
           complete cds
          Length = 7853

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 348 accggtgctcgacgatctcc 367
           ||||||||||||||||||||
Sbjct: 730 accggtgctcgacgatctcc 711

>emb|AL929017.9| Zebrafish DNA sequence from clone DKEY-4C15 in linkage group 20, complete
              sequence
          Length = 208922

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 497    gaccaaacttgatcctgcat 516
              ||||||||||||||||||||
Sbjct: 176678 gaccaaacttgatcctgcat 176697


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,606,330
Number of Sequences: 3902068
Number of extensions: 3606330
Number of successful extensions: 81853
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81717
Number of HSP's gapped (non-prelim): 131
length of query: 605
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 582
effective length of database: 17,143,297,704
effective search space: 9977399263728
effective search space used: 9977399263728
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)