ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal2p24 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK067481.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013107H14, full insert sequence Length = 796 Score = 291 bits (147), Expect = 1e-75 Identities = 219/243 (90%) Strand = Plus / Minus Query: 159 atttcttgttgaggtcgatgccggccttcttggcgacggcgtcgaggccgtgcttctcga 218 |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 479 atttcttgttgaggtcgatgccggcctttttggcgacggcgtcgaggccatgcttctcga 420 Query: 219 ttgtcttgagggccttggtggagagcctgagcttgacgtagcgctttccggcctcccacc 278 | ||||||||||| ||||||||||| | ||||||||| ||||||| || ||||||||| Sbjct: 419 tggtcttgagggctttggtggagagacgcagcttgacgaagcgcttgccttcctcccacc 360 Query: 279 acagcttcttgtactgcaggttcacaaattgctgcttcttggtcttgtggttggagaagg 338 |||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||| Sbjct: 359 acagcttcttgtactgcaggttcacaaactgctgcttcttcgtcttgtggtttgagaagg 300 Query: 339 acaccttgttggcccggttcgtcttcttctccagaaaggggcagatccgacgcgcgacga 398 |||||||||| |||| ||| |||||||| ||| |||||||| ||||| ||||||| || Sbjct: 299 acaccttgttcgccctgttggtcttcttgtccgtgaaggggcatatccggcgcgcgagga 240 Query: 399 tgg 401 ||| Sbjct: 239 tgg 237 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 442 gaggccgaggctgaggcccgcgagctgcgaggtggcgaacccgagcgagg 491 |||||||||||||||||| ||||| |||||||||||||| ||||| |||| Sbjct: 187 gaggccgaggctgaggccggcgagttgcgaggtggcgaagccgagagagg 138
>ref|XM_493864.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 267 Score = 280 bits (141), Expect = 5e-72 Identities = 207/229 (90%) Strand = Plus / Minus Query: 159 atttcttgttgaggtcgatgccggccttcttggcgacggcgtcgaggccgtgcttctcga 218 |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 265 atttcttgttgaggtcgatgccggcctttttggcgacggcgtcgaggccatgcttctcga 206 Query: 219 ttgtcttgagggccttggtggagagcctgagcttgacgtagcgctttccggcctcccacc 278 | ||||||||||| ||||||||||| | ||||||||| ||||||| || ||||||||| Sbjct: 205 tggtcttgagggctttggtggagagacgcagcttgacgaagcgcttgccttcctcccacc 146 Query: 279 acagcttcttgtactgcaggttcacaaattgctgcttcttggtcttgtggttggagaagg 338 |||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||| Sbjct: 145 acagcttcttgtactgcaggttcacaaactgctgcttcttcgtcttgtggtttgagaagg 86 Query: 339 acaccttgttggcccggttcgtcttcttctccagaaaggggcagatccg 387 |||||||||| |||| ||| |||||||| ||| |||||||| ||||| Sbjct: 85 acaccttgttcgccctgttggtcttcttgtccgtgaaggggcatatccg 37
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 280 bits (141), Expect = 5e-72 Identities = 207/229 (90%) Strand = Plus / Plus Query: 159 atttcttgttgaggtcgatgccggccttcttggcgacggcgtcgaggccgtgcttctcga 218 |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 66350 atttcttgttgaggtcgatgccggcctttttggcgacggcgtcgaggccatgcttctcga 66409 Query: 219 ttgtcttgagggccttggtggagagcctgagcttgacgtagcgctttccggcctcccacc 278 | ||||||||||| ||||||||||| | ||||||||| ||||||| || ||||||||| Sbjct: 66410 tggtcttgagggctttggtggagagacgcagcttgacgaagcgcttgccttcctcccacc 66469 Query: 279 acagcttcttgtactgcaggttcacaaattgctgcttcttggtcttgtggttggagaagg 338 |||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||| Sbjct: 66470 acagcttcttgtactgcaggttcacaaactgctgcttcttcgtcttgtggtttgagaagg 66529 Query: 339 acaccttgttggcccggttcgtcttcttctccagaaaggggcagatccg 387 |||||||||| |||| ||| |||||||| ||| |||||||| ||||| Sbjct: 66530 acaccttgttcgccctgttggtcttcttgtccgtgaaggggcatatccg 66578 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Plus Query: 442 gaggccgaggctgaggcccgcgagctgcgaggtggcgaacccgagcgagg 491 |||||||||||||||||| ||||| |||||||||||||| ||||| |||| Sbjct: 68257 gaggccgaggctgaggccggcgagttgcgaggtggcgaagccgagagagg 68306
>gb|AC073405.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0036D10, complete sequence Length = 156772 Score = 280 bits (141), Expect = 5e-72 Identities = 207/229 (90%) Strand = Plus / Plus Query: 159 atttcttgttgaggtcgatgccggccttcttggcgacggcgtcgaggccgtgcttctcga 218 |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 66350 atttcttgttgaggtcgatgccggcctttttggcgacggcgtcgaggccatgcttctcga 66409 Query: 219 ttgtcttgagggccttggtggagagcctgagcttgacgtagcgctttccggcctcccacc 278 | ||||||||||| ||||||||||| | ||||||||| ||||||| || ||||||||| Sbjct: 66410 tggtcttgagggctttggtggagagacgcagcttgacgaagcgcttgccttcctcccacc 66469 Query: 279 acagcttcttgtactgcaggttcacaaattgctgcttcttggtcttgtggttggagaagg 338 |||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||| Sbjct: 66470 acagcttcttgtactgcaggttcacaaactgctgcttcttcgtcttgtggtttgagaagg 66529 Query: 339 acaccttgttggcccggttcgtcttcttctccagaaaggggcagatccg 387 |||||||||| |||| ||| |||||||| ||| |||||||| ||||| Sbjct: 66530 acaccttgttcgccctgttggtcttcttgtccgtgaaggggcatatccg 66578 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Plus Query: 442 gaggccgaggctgaggcccgcgagctgcgaggtggcgaacccgagcgagg 491 |||||||||||||||||| ||||| |||||||||||||| ||||| |||| Sbjct: 68257 gaggccgaggctgaggccggcgagttgcgaggtggcgaagccgagagagg 68306
>gb|AC152969.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0098I11, complete sequence Length = 122970 Score = 280 bits (141), Expect = 5e-72 Identities = 207/229 (90%) Strand = Plus / Plus Query: 159 atttcttgttgaggtcgatgccggccttcttggcgacggcgtcgaggccgtgcttctcga 218 |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 75737 atttcttgttgaggtcgatgccggcctttttggcgacggcgtcgaggccatgcttctcga 75796 Query: 219 ttgtcttgagggccttggtggagagcctgagcttgacgtagcgctttccggcctcccacc 278 | ||||||||||| ||||||||||| | ||||||||| ||||||| || ||||||||| Sbjct: 75797 tggtcttgagggctttggtggagagacgcagcttgacgaagcgcttgccttcctcccacc 75856 Query: 279 acagcttcttgtactgcaggttcacaaattgctgcttcttggtcttgtggttggagaagg 338 |||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||| Sbjct: 75857 acagcttcttgtactgcaggttcacaaactgctgcttcttcgtcttgtggtttgagaagg 75916 Query: 339 acaccttgttggcccggttcgtcttcttctccagaaaggggcagatccg 387 |||||||||| |||| ||| |||||||| ||| |||||||| ||||| Sbjct: 75917 acaccttgttcgccctgttggtcttcttgtccgtgaaggggcatatccg 75965 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Plus Query: 442 gaggccgaggctgaggcccgcgagctgcgaggtggcgaacccgagcgagg 491 |||||||||||||||||| ||||| |||||||||||||| ||||| |||| Sbjct: 77644 gaggccgaggctgaggccggcgagttgcgaggtggcgaagccgagagagg 77693
>gb|AY104997.1| Zea mays PCO079200 mRNA sequence Length = 593 Score = 276 bits (139), Expect = 8e-71 Identities = 193/211 (91%) Strand = Plus / Minus Query: 156 ctcatttcttgttgaggtcgatgccggccttcttggcgacggcgtcgaggccgtgcttct 215 |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 479 ctcacttcttgttgaggtcgatgccggccttgcgcgcgacggcgtcgaggccgtgcttct 420 Query: 216 cgattgtcttgagggccttggtggagagcctgagcttgacgtagcgctttccggcctccc 275 |||| |||||||||||||||||||| || | ||||||||| ||||||| |||||||||| Sbjct: 419 cgatggtcttgagggccttggtggaaaggcgcagcttgacgaagcgcttgccggcctccc 360 Query: 276 accacagcttcttgtactgcaggttcacaaattgctgcttcttggtcttgtggttggaga 335 |||||||||||||||||||||||||||| || ||||||||||| |||||||||||||| | Sbjct: 359 accacagcttcttgtactgcaggttcacgaactgctgcttcttcgtcttgtggttggaaa 300 Query: 336 aggacaccttgttggcccggttcgtcttctt 366 | ||||||||||| ||||||||||||||||| Sbjct: 299 acgacaccttgttcgcccggttcgtcttctt 269
>dbj|AK059567.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-H10, full insert sequence Length = 487 Score = 232 bits (117), Expect = 1e-57 Identities = 156/169 (92%) Strand = Plus / Minus Query: 159 atttcttgttgaggtcgatgccggccttcttggcgacggcgtcgaggccgtgcttctcga 218 |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 169 atttcttgttgaggtcgatgccggcctttttggcgacggcgtcgaggccatgcttctcga 110 Query: 219 ttgtcttgagggccttggtggagagcctgagcttgacgtagcgctttccggcctcccacc 278 | ||||||||||| ||||||||||| | ||||||||| ||||||| || ||||||||| Sbjct: 109 tggtcttgagggctttggtggagagacgcagcttgacgaagcgcttgccttcctcccacc 50 Query: 279 acagcttcttgtactgcaggttcacaaattgctgcttcttggtcttgtg 327 |||||||||||||||||||||||||||| ||||||||||| |||||||| Sbjct: 49 acagcttcttgtactgcaggttcacaaactgctgcttcttcgtcttgtg 1
>gb|AC000104.1|F19P19 Sequence of BAC F19P19 from Arabidopsis thaliana chromosome 1, complete sequence Length = 107527 Score = 60.0 bits (30), Expect = 9e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 287 ttgtactgcaggttcacaaattgctgcttcttggtcttgtggttggagaaggacaccttg 346 |||||||||| ||| || |||||| |||||||||||||||||| ||||| ||||| ||| Sbjct: 22755 ttgtactgcaagttgacgaattgcaacttcttggtcttgtggttagagaatgacactttg 22696 Query: 347 tt 348 || Sbjct: 22695 tt 22694
>emb|X68078.1|NTRPCL28 N.tabacum mRNA for chloroplast ribosomal protein CL28 Length = 671 Score = 52.0 bits (26), Expect = 0.002 Identities = 92/114 (80%) Strand = Plus / Minus Query: 254 acgtagcgctttccggcctcccaccacagcttcttgtactgcaggttcacaaattgctgc 313 ||||||||||| || ||||||||||| | ||||||| || ||||| ||||||||| | Sbjct: 415 acgtagcgcttgcctgcctcccaccaaattctcttgtattgaaggtttacaaattgcaac 356 Query: 314 ttcttggtcttgtggttggagaaggacaccttgttggcccggttcgtcttcttc 367 || || ||||||||||| ||| || |||||||| |||| ||| | ||||||| Sbjct: 355 ttttttgtcttgtggtttgagtgagagaccttgtttgccctgttggacttcttc 302
>gb|AY212800.1| Uncultured bacterium clone XIVA3 Uvs061 (uvs061), Uvs062 (uvs062), Uvs063 (uvs063), Uvs064 (uvs064), Uvs065 (uvs065), Uvs066 (uvs066), Uvs067 (uvs067), Uvs068 (uvs068), Uvs069, ActP (actP), AguC (aguC), Uvs072 (uvs072), AguD (aguD), AguE (aguE), Uvs075 (uvs075), Uvs076 (uvs076), Uvs077 (uvs077), Uvs078 (uvs078), Uvs079 (uvs079), Uvs080 (uvs080), AguF (aguF), and Uvs082 (uvs082) genes, complete cds Length = 38120 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 173 tcgatgccggccttcttggcgacggcgt 200 |||||||||||||||||||| ||||||| Sbjct: 14433 tcgatgccggccttcttggccacggcgt 14460
>gb|AC160639.2| Mus musculus BAC clone RP23-103I12 from chromosome 14, complete sequence Length = 195224 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 317 ttggtcttgtggttggagaaggac 340 |||||||||||||||||||||||| Sbjct: 191803 ttggtcttgtggttggagaaggac 191826
>gb|AC134575.3| Mus musculus BAC clone RP24-67I21 from chromosome 14, complete sequence Length = 172103 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 317 ttggtcttgtggttggagaaggac 340 |||||||||||||||||||||||| Sbjct: 66514 ttggtcttgtggttggagaaggac 66537
>gb|AC140201.3| Mus musculus BAC clone RP23-267F15 from chromosome 16, complete sequence Length = 166079 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 42 aggaaaaggggagaaaaggaaaa 64 ||||||||||||||||||||||| Sbjct: 148377 aggaaaaggggagaaaaggaaaa 148399
>gb|AC068663.5| Mus musculus strain C57BL6/J chromosome 5 clone RP23-280D18, complete sequence Length = 221134 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 42 aggaaaaggggagaaaaggaaaa 64 ||||||||||||||||||||||| Sbjct: 57675 aggaaaaggggagaaaaggaaaa 57653 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Minus Query: 43 ggaaaaggggagaaaaggaaaa 64 |||||||||||||||||||||| Sbjct: 57690 ggaaaaggggagaaaaggaaaa 57669
>gb|AC112681.12| Mus musculus chromosome 16, clone RP23-272P19, complete sequence Length = 228367 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 42 aggaaaaggggagaaaaggaaaa 64 ||||||||||||||||||||||| Sbjct: 32348 aggaaaaggggagaaaaggaaaa 32370
>gb|AC113541.10| Mus musculus chromosome 5, clone RP23-185N2, complete sequence Length = 210222 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 42 aggaaaaggggagaaaaggaaaa 64 ||||||||||||||||||||||| Sbjct: 139394 aggaaaaggggagaaaaggaaaa 139416 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 43 ggaaaaggggagaaaaggaaaa 64 |||||||||||||||||||||| Sbjct: 139379 ggaaaaggggagaaaaggaaaa 139400
>ref|NG_004051.1| Mus musculus immunoglobulin lambda chain complex (Igl) on chromosome 16 Length = 234987 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 42 aggaaaaggggagaaaaggaaaa 64 ||||||||||||||||||||||| Sbjct: 58004 aggaaaaggggagaaaaggaaaa 57982
>gb|AC108683.2| Homo sapiens Xp BAC RP11-539J11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 61375 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 42 aggaaaaggggagaaaaggaaaa 64 ||||||||||||||||||||||| Sbjct: 39830 aggaaaaggggagaaaaggaaaa 39808
>gb|AC116545.1| Homo sapiens X BAC CTD-2009P21 (CalTech Human BAC Library D) complete sequence Length = 25300 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 42 aggaaaaggggagaaaaggaaaa 64 ||||||||||||||||||||||| Sbjct: 3772 aggaaaaggggagaaaaggaaaa 3750
>gb|AY190738.1| Pagrus major 40S ribosomal protein S18 mRNA, partial cds Length = 477 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Minus Query: 162 tcttgttgaggtcgatgccggccttc 187 ||||||||||||||||| |||||||| Sbjct: 128 tcttgttgaggtcgatgtcggccttc 103
>gb|BC074110.1| Xenopus laevis MGC81777 protein, mRNA (cDNA clone MGC:81777 IMAGE:6866454), complete cds Length = 1520 Score = 44.1 bits (22), Expect = 0.51 Identities = 28/30 (93%) Strand = Plus / Plus Query: 397 gatggtgttcttggtgttggtggggatgga 426 ||||||||| || ||||||||||||||||| Sbjct: 691 gatggtgttgtttgtgttggtggggatgga 720
>ref|XM_467348.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1067 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 433 ggtggaggtgaggccgaggctgagg 457 ||||||||||||||||||| ||||| Sbjct: 610 ggtggaggtgaggccgaggatgagg 586
>ref|XM_507521.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1218_D07.23 mRNA Length = 1287 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 433 ggtggaggtgaggccgaggctgagg 457 ||||||||||||||||||| ||||| Sbjct: 827 ggtggaggtgaggccgaggatgagg 803
>ref|XM_506926.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1218_D07.23 mRNA Length = 1349 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 433 ggtggaggtgaggccgaggctgagg 457 ||||||||||||||||||| ||||| Sbjct: 907 ggtggaggtgaggccgaggatgagg 883
>gb|AY316746.1| Rhizobium sp. NGR234 megaplasmid 2 contig 2, complete sequence Length = 236455 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 169 gaggtcgatgccggccttcttggcg 193 |||||||||||||||||||| |||| Sbjct: 142490 gaggtcgatgccggccttctcggcg 142466
>gb|AC009108.10| Homo sapiens chromosome 16 clone RP11-463O9, complete sequence Length = 168656 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 235 ggtggagagcctgagcttgac 255 ||||||||||||||||||||| Sbjct: 60045 ggtggagagcctgagcttgac 60065
>gb|AC126055.4| Mus musculus BAC clone RP23-368O6 from chromosome 16, complete sequence Length = 197096 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 151 catcactcatttcttgttgag 171 ||||||||||||||||||||| Sbjct: 26717 catcactcatttcttgttgag 26697
>emb|AL939127.1|SCO939127 Streptomyces coelicolor A3(2) complete genome; segment 24/29 Length = 290850 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 173 tcgatgccggccttcttggcg 193 ||||||||||||||||||||| Sbjct: 257293 tcgatgccggccttcttggcg 257273
>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence Length = 1877212 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 244 cctgagcttgacgtagcgctt 264 ||||||||||||||||||||| Sbjct: 178938 cctgagcttgacgtagcgctt 178958
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 337 ggacaccttgttggcccggtt 357 ||||||||||||||||||||| Sbjct: 3942333 ggacaccttgttggcccggtt 3942353
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 179 ccggccttcttggcgacggcgtcgaggcc 207 ||||||||||||||| ||||| ||||||| Sbjct: 1871528 ccggccttcttggcggcggcggcgaggcc 1871500
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 accacagcttcttgtactgca 296 ||||||||||||||||||||| Sbjct: 19426266 accacagcttcttgtactgca 19426286 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 aggaaaaggggagaaaagga 61 |||||||||||||||||||| Sbjct: 23172624 aggaaaaggggagaaaagga 23172643
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 488 gaggcggcgttggcgttgctgcgga 512 ||||||||| ||||||||||||||| Sbjct: 7193089 gaggcggcgatggcgttgctgcgga 7193113 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 423 tggagaccgcggtggaggtgaggc 446 |||||||||| ||||||||||||| Sbjct: 14735467 tggagaccgccgtggaggtgaggc 14735490
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 433 ggtggaggtgaggccgaggctgagg 457 ||||||||||||||||||| ||||| Sbjct: 28998264 ggtggaggtgaggccgaggatgagg 28998240
>gb|AC007500.7| Homo sapiens chromosome 16 clone RP11-545E2, complete sequence Length = 220562 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 44 gaaaaggggagaaaaggaaaa 64 ||||||||||||||||||||| Sbjct: 191720 gaaaaggggagaaaaggaaaa 191700
>gb|AY957387.1| Pseudomonas stutzeri DnrE (dnrE) gene, complete cds; NarL-like (narL) and NarX-like (narX) genes, complete sequence; NarK (narK), NarM (narM), NarG (narG), NarH (narH), NarJ (narJ), and NarI (narI) genes, complete cds; and unknown gene Length = 15150 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 173 tcgatgccggccttcttggcg 193 ||||||||||||||||||||| Sbjct: 11676 tcgatgccggccttcttggcg 11656
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome Length = 3052398 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 439 ggtgaggccgaggctgaggcc 459 ||||||||||||||||||||| Sbjct: 902915 ggtgaggccgaggctgaggcc 902935 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 439 ggtgaggccgaggctgaggcc 459 ||||||||||||||||||||| Sbjct: 219316 ggtgaggccgaggctgaggcc 219336
>dbj|AP005185.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0409B11 Length = 168354 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 276 accacagcttcttgtactgca 296 ||||||||||||||||||||| Sbjct: 115804 accacagcttcttgtactgca 115824
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 168 tgaggtcgatgccggccttct 188 ||||||||||||||||||||| Sbjct: 4649842 tgaggtcgatgccggccttct 4649822
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 198 cgtcgaggccgtgcttctcga 218 ||||||||||||||||||||| Sbjct: 1053745 cgtcgaggccgtgcttctcga 1053765 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 167 ttgaggtcgatgccggccttcttggcga 194 |||| |||||||||||||||| |||||| Sbjct: 1834197 ttgatgtcgatgccggccttcctggcga 1834224
>dbj|AP004995.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0068B06 Length = 143712 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 488 gaggcggcgttggcgttgctgcgga 512 ||||||||| ||||||||||||||| Sbjct: 70500 gaggcggcgatggcgttgctgcgga 70524
>dbj|AP004994.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0052G07 Length = 156207 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 488 gaggcggcgttggcgttgctgcgga 512 ||||||||| ||||||||||||||| Sbjct: 28093 gaggcggcgatggcgttgctgcgga 28117
>dbj|AP005825.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0724B10 Length = 169143 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 433 ggtggaggtgaggccgaggctgagg 457 ||||||||||||||||||| ||||| Sbjct: 44429 ggtggaggtgaggccgaggatgagg 44405
>dbj|AP004052.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1218_D07 Length = 114511 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 433 ggtggaggtgaggccgaggctgagg 457 ||||||||||||||||||| ||||| Sbjct: 81322 ggtggaggtgaggccgaggatgagg 81298
>emb|Y00142.1|SLXP55 Streptomyces lividans DNA for xp55 protein and p49 protein Length = 4540 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 173 tcgatgccggccttcttggcg 193 ||||||||||||||||||||| Sbjct: 3697 tcgatgccggccttcttggcg 3677
>dbj|AK105992.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-H02, full insert sequence Length = 1349 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 433 ggtggaggtgaggccgaggctgagg 457 ||||||||||||||||||| ||||| Sbjct: 907 ggtggaggtgaggccgaggatgagg 883
>dbj|AK071752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023113K24, full insert sequence Length = 1066 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 433 ggtggaggtgaggccgaggctgagg 457 ||||||||||||||||||| ||||| Sbjct: 609 ggtggaggtgaggccgaggatgagg 585
>dbj|AK060227.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-G11, full insert sequence Length = 1287 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 433 ggtggaggtgaggccgaggctgagg 457 ||||||||||||||||||| ||||| Sbjct: 827 ggtggaggtgaggccgaggatgagg 803
>dbj|AP000843.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-684N3, complete sequence Length = 191204 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 44 gaaaaggggagaaaaggaaaa 64 ||||||||||||||||||||| Sbjct: 162330 gaaaaggggagaaaaggaaaa 162350
>dbj|AP002075.3| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2230O14, complete sequence Length = 118977 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 55 aaaaggaaaactgaagataaa 75 ||||||||||||||||||||| Sbjct: 83967 aaaaggaaaactgaagataaa 83947
>dbj|AB017138.1| Pseudomonas putida malonate decarboxylase gene cluster (mdcA, mdcB, mdcC, mdcD, mdcE, mdcG, mdcH, mdcL and mdcM genes), complete cds Length = 8090 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 468 gcgaggtggcgaacccgagcgaggcggcg 496 ||||||||||| |||||| |||||||||| Sbjct: 277 gcgaggtggcgtacccgatcgaggcggcg 249
>dbj|AP003029.2| Homo sapiens genomic DNA, chromosome 11q, clone:CTC-343F17, complete sequence Length = 142882 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 44 gaaaaggggagaaaaggaaaa 64 ||||||||||||||||||||| Sbjct: 33061 gaaaaggggagaaaaggaaaa 33081
>ref|NM_128905.2| Arabidopsis thaliana structural constituent of ribosome AT2G33450 mRNA, complete cds Length = 626 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 313 cttcttggtcttgtggttggagaa 336 |||||||||||||||||| ||||| Sbjct: 317 cttcttggtcttgtggttagagaa 294
>gb|AC121142.12| Mus musculus chromosome 10, clone RP23-479G23, complete sequence Length = 203838 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagaaaaggaaaactgaag 70 |||||||||||||||||||| Sbjct: 9207 ggagaaaaggaaaactgaag 9226
>gb|AC113050.9| Mus musculus chromosome 1, clone RP23-250O14, complete sequence Length = 207359 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 ggaaaaggggagaaaaggaa 62 |||||||||||||||||||| Sbjct: 55052 ggaaaaggggagaaaaggaa 55071
>ref|XM_421335.1| PREDICTED: Gallus gallus similar to KIAA1409 (LOC423426), mRNA Length = 7074 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 tgcaggttcacaaattgctg 312 |||||||||||||||||||| Sbjct: 6435 tgcaggttcacaaattgctg 6454
>ref|NM_001007254.1| Homo sapiens ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 (ATP6V1C1), transcript variant 2, mRNA Length = 5667 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 56 aaaggaaaactgaagataaatcca 79 |||| ||||||||||||||||||| Sbjct: 3028 aaagaaaaactgaagataaatcca 3005
>ref|NM_001695.3| Homo sapiens ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 (ATP6V1C1), transcript variant 1, mRNA Length = 5721 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 56 aaaggaaaactgaagataaatcca 79 |||| ||||||||||||||||||| Sbjct: 3082 aaagaaaaactgaagataaatcca 3059
>ref|NG_004832.1| Homo sapiens chromosome Y inverted repeat IR2, centromeric (IR2@) on chromosome Y Length = 389013 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 44 gaaaaggggagaaaaggaaa 63 |||||||||||||||||||| Sbjct: 333746 gaaaaggggagaaaaggaaa 333727
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 196 ggcgtcgaggccgtgcttctcgat 219 |||||||| ||||||||||||||| Sbjct: 2647980 ggcgtcgatgccgtgcttctcgat 2648003
>ref|XM_755410.1| Ustilago maydis 521 hypothetical protein (UM04356.1) partial mRNA Length = 9195 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 493 ggcgttggcgttgctgcgga 512 |||||||||||||||||||| Sbjct: 5469 ggcgttggcgttgctgcgga 5450
>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome Length = 2462499 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 cgatgccggccttcttggcg 193 |||||||||||||||||||| Sbjct: 2294327 cgatgccggccttcttggcg 2294308
>ref|XM_388604.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08428.1) partial mRNA Length = 1422 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 393 cgacgatggtgttcttggtgttgg 416 ||||||||||| |||||||||||| Sbjct: 115 cgacgatggtgatcttggtgttgg 92
>gb|AC125088.4| Mus musculus BAC clone RP24-152J3 from chromosome 12, complete sequence Length = 149712 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tcatcatcactcatttcttg 166 |||||||||||||||||||| Sbjct: 64280 tcatcatcactcatttcttg 64261
>gb|AC116651.6| Homo sapiens BAC clone RP11-799M12 from 4, complete sequence Length = 61067 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 aattgctgcttcttggtctt 324 |||||||||||||||||||| Sbjct: 54942 aattgctgcttcttggtctt 54923
>ref|XM_541567.2| PREDICTED: Canis familiaris similar to F28C1.3a (LOC484452), mRNA Length = 2583 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 433 ggtggaggtgaggccgaggc 452 |||||||||||||||||||| Sbjct: 1593 ggtggaggtgaggccgaggc 1574
>gb|AC149580.19| Medicago truncatula clone mth2-123f14, complete sequence Length = 123565 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 301 cacaaattgctgcttcttggtctt 324 ||||| |||||||||||||||||| Sbjct: 46461 cacaacttgctgcttcttggtctt 46484
>gb|AC119415.13| Medicago truncatula clone mth2-27n2, complete sequence Length = 139330 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 301 cacaaattgctgcttcttggtctt 324 ||||| |||||||||||||||||| Sbjct: 107289 cacaacttgctgcttcttggtctt 107266
>emb|AL354853.12| Human DNA sequence from clone RP11-555F9 on chromosome 9q22.1-22.33 Contains the 5' end of a novel gene and the 3' end of a novel gene, complete sequence Length = 176422 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 ggaaatcaagaagatatgct 141 |||||||||||||||||||| Sbjct: 51558 ggaaatcaagaagatatgct 51577
>gb|AC150480.3| Rhinolophus ferrumequinum clone VMRC7-380O7, complete sequence Length = 171158 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 45 aaaaggggagaaaaggaaaa 64 |||||||||||||||||||| Sbjct: 26681 aaaaggggagaaaaggaaaa 26700
>emb|BX572599.1| Rhodopseudomonas palustris CGA009 complete genome; segment 7/16 Length = 349142 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 167 ttgaggtcgatgccggccttcttggcga 194 |||| ||||| ||||||||||||||||| Sbjct: 129405 ttgacgtcgaggccggccttcttggcga 129432
>emb|AL596163.1| Listeria innocua Clip11262 complete genome, segment 1/12 Length = 231450 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 299 ttcacaaattgctgcttctt 318 |||||||||||||||||||| Sbjct: 215287 ttcacaaattgctgcttctt 215268
>gb|AE005812.1| Caulobacter crescentus CB15 section 138 of 359 of the complete genome Length = 10602 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 520 agccctggcggcggcgggca 539 |||||||||||||||||||| Sbjct: 2590 agccctggcggcggcgggca 2609
>gb|AY114618.1| Arabidopsis thaliana putative chloroplast 50S ribosomal protein L28 (At2g33450) mRNA, complete cds Length = 484 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 313 cttcttggtcttgtggttggagaa 336 |||||||||||||||||| ||||| Sbjct: 276 cttcttggtcttgtggttagagaa 253
>dbj|AK090702.1| Homo sapiens cDNA FLJ33383 fis, clone BRACE2006514 Length = 2035 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 56 aaaggaaaactgaagataaatcca 79 |||| ||||||||||||||||||| Sbjct: 178 aaagaaaaactgaagataaatcca 155
>gb|AC126789.20| Medicago truncatula clone mth2-36n23, complete sequence Length = 126875 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 301 cacaaattgctgcttcttggtctt 324 ||||| |||||||||||||||||| Sbjct: 61448 cacaacttgctgcttcttggtctt 61425
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 gccctggcggcggcgggcat 540 |||||||||||||||||||| Sbjct: 2098622 gccctggcggcggcgggcat 2098641
>gb|AC002332.3| Arabidopsis thaliana chromosome 2 clone F4P9 map ve015, complete sequence Length = 152593 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 313 cttcttggtcttgtggttggagaa 336 |||||||||||||||||| ||||| Sbjct: 78080 cttcttggtcttgtggttagagaa 78057
>gb|AY072373.1| Arabidopsis thaliana putative chloroplast 50S ribosomal protein L28 (At2g33450) mRNA, complete cds Length = 617 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 313 cttcttggtcttgtggttggagaa 336 |||||||||||||||||| ||||| Sbjct: 314 cttcttggtcttgtggttagagaa 291
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome Length = 3570858 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 411 tgttggtggggatggagacc 430 |||||||||||||||||||| Sbjct: 914355 tgttggtggggatggagacc 914374
>gb|AE006470.1| Chlorobium tepidum TLS, complete genome Length = 2154946 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 461 gcgagctgcgaggtggcgaa 480 |||||||||||||||||||| Sbjct: 762602 gcgagctgcgaggtggcgaa 762583
>gb|AC004086.14| Homo sapiens 12 PAC RP3-329E11 (Roswell Park Cancer Institute Human Bac Library) complete sequence Length = 94508 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 45 aaaaggggagaaaaggaaaactga 68 |||||||||||||| ||||||||| Sbjct: 28462 aaaaggggagaaaaagaaaactga 28439
>gb|AC090058.21| Homo sapiens 12 BAC RP11-112N23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 181102 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 270 cctcccaccacagcttcttg 289 |||||||||||||||||||| Sbjct: 92686 cctcccaccacagcttcttg 92667
>emb|BX819519.1|CNS0A8T8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB86ZD02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 604 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 313 cttcttggtcttgtggttggagaa 336 |||||||||||||||||| ||||| Sbjct: 297 cttcttggtcttgtggttagagaa 274
>gb|AC021317.19| Homo sapiens chromosome 17, clone RP11-678G7, complete sequence Length = 180876 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 aggaaaaggggagaaaagga 61 |||||||||||||||||||| Sbjct: 69608 aggaaaaggggagaaaagga 69589
>gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold Length = 1756392 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 45 aaaaggggagaaaaggaaaa 64 |||||||||||||||||||| Sbjct: 440295 aaaaggggagaaaaggaaaa 440314
>gb|AC069473.4|AC069473 Arabidopsis thaliana chromosome 3 BAC T21B14 genomic sequence, complete sequence Length = 85657 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 atcactcatttcttgttgag 171 |||||||||||||||||||| Sbjct: 70870 atcactcatttcttgttgag 70851
>gb|AC021107.3|AC021107 Homo sapiens BAC clone RP11-178M5 from Y, complete sequence Length = 160601 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 44 gaaaaggggagaaaaggaaa 63 |||||||||||||||||||| Sbjct: 65465 gaaaaggggagaaaaggaaa 65446
>dbj|AB110611.1| Pseudomonas sp. MT-1 nar gene cluster (orf1, orf2, orf3, narL, narX, narK, orf4, narM, narG, narH, narJ, narI, nifM), partial and complete cds Length = 15819 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 tcgatgccggccttcttggc 192 |||||||||||||||||||| Sbjct: 11885 tcgatgccggccttcttggc 11866
>gb|AY087094.1| Arabidopsis thaliana clone 31633 mRNA, complete sequence Length = 616 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 313 cttcttggtcttgtggttggagaa 336 |||||||||||||||||| ||||| Sbjct: 317 cttcttggtcttgtggttagagaa 294
>ref|XM_218387.3| PREDICTED: Rattus norvegicus similar to F-box only protein 6 (F-box/G-domain protein 2) (predicted) (LOC292755), mRNA Length = 801 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 277 ccacagcttcttgtactgcaggttcacaaattgctgcttc 316 ||||||||||||| | ||||||||||| |||||| |||| Sbjct: 474 ccacagcttcttggccagcaggttcacacattgctccttc 435
>gb|AC115992.13| Homo sapiens chromosome 17, clone CTD-2022O14, complete sequence Length = 139475 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 aggaaaaggggagaaaagga 61 |||||||||||||||||||| Sbjct: 2676 aggaaaaggggagaaaagga 2695
>dbj|AP004804.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0680B05 Length = 138741 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 423 tggagaccgcggtggaggtgaggc 446 |||||||||| ||||||||||||| Sbjct: 121334 tggagaccgccgtggaggtgaggc 121357
>dbj|AP004802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0640D01 Length = 164996 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 423 tggagaccgcggtggaggtgaggc 446 |||||||||| ||||||||||||| Sbjct: 46551 tggagaccgccgtggaggtgaggc 46574
>dbj|AP003758.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1562_B11 Length = 112144 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 aggaaaaggggagaaaagga 61 |||||||||||||||||||| Sbjct: 35538 aggaaaaggggagaaaagga 35557
>emb|BX648079.1|HSM808225 Homo sapiens mRNA; cDNA DKFZp686N08183 (from clone DKFZp686N08183) Length = 5620 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 56 aaaggaaaactgaagataaatcca 79 |||| ||||||||||||||||||| Sbjct: 3020 aaagaaaaactgaagataaatcca 2997
>dbj|AP002040.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEC18 Length = 80099 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 152 atcactcatttcttgttgag 171 |||||||||||||||||||| Sbjct: 45197 atcactcatttcttgttgag 45216
>dbj|AP003845.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1699_E05 Length = 170666 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 aggaaaaggggagaaaagga 61 |||||||||||||||||||| Sbjct: 116808 aggaaaaggggagaaaagga 116827
>gb|AF363578.1| Homo sapiens ATPase H+ transporting lysosomal protein (ATP6C) gene, complete cds; BAALC (BAALC) gene, complete cds, alternatively spliced; and frizzled-like protein 6 (FZD6) gene, complete cds Length = 347253 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 56 aaaggaaaactgaagataaatcca 79 |||| ||||||||||||||||||| Sbjct: 79876 aaagaaaaactgaagataaatcca 79853
>dbj|AK109778.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-147-B10, full insert sequence Length = 1432 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 423 tggagaccgcggtggaggtgaggc 446 |||||||||| ||||||||||||| Sbjct: 490 tggagaccgccgtggaggtgaggc 513
>dbj|AK105919.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-A02, full insert sequence Length = 1139 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 423 tggagaccgcggtggaggtgaggc 446 |||||||||| ||||||||||||| Sbjct: 187 tggagaccgccgtggaggtgaggc 164
>dbj|AK069209.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023009E01, full insert sequence Length = 1562 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 417 tggggatggagaccgcggtggagg 440 ||||||||||||| |||||||||| Sbjct: 138 tggggatggagacggcggtggagg 115
>gb|AC007918.2|F28J9 Arabidopsis thaliana chromosome 1 BAC F28J9 sequence, complete sequence Length = 115963 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 152 atcactcatttcttgttgag 171 |||||||||||||||||||| Sbjct: 13152 atcactcatttcttgttgag 13171
>gb|AY105324.1| Zea mays PCO143177 mRNA sequence Length = 1439 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 193 gacggcgtcgaggccgtgct 212 |||||||||||||||||||| Sbjct: 919 gacggcgtcgaggccgtgct 938
>emb|BX511198.8| Mouse DNA sequence from clone RP23-390P10 on chromosome 4, complete sequence Length = 183261 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 45 aaaaggggagaaaaggaaaa 64 |||||||||||||||||||| Sbjct: 120355 aaaaggggagaaaaggaaaa 120336
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cgacggcgtcgaggccgtgc 211 |||||||||||||||||||| Sbjct: 2670653 cgacggcgtcgaggccgtgc 2670634
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 gccctggcggcggcgggcat 540 |||||||||||||||||||| Sbjct: 807583 gccctggcggcggcgggcat 807564
>gb|AC132111.4| Mus musculus BAC clone RP24-200H19 from 14, complete sequence Length = 174164 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 431 gcggtggaggtgaggccgag 450 |||||||||||||||||||| Sbjct: 124664 gcggtggaggtgaggccgag 124683
>emb|AL626769.18| Mouse DNA sequence from clone RP23-23A6 on chromosome 15, complete sequence Length = 221087 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 44 gaaaaggggagaaaaggaaa 63 |||||||||||||||||||| Sbjct: 14968 gaaaaggggagaaaaggaaa 14949
>emb|AL645468.11| Mouse DNA sequence from clone RP23-246F18 on chromosome 4, complete sequence Length = 209764 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 7 catttatttataaggttact 26 |||||||||||||||||||| Sbjct: 73924 catttatttataaggttact 73905
>gb|AC153953.2| Mus musculus 10 BAC RP24-394B11 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 163098 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 tcttctccagaaaggggcag 382 |||||||||||||||||||| Sbjct: 74771 tcttctccagaaaggggcag 74790
>dbj|AP003550.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1639H6, complete sequence Length = 140609 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 56 aaaggaaaactgaagataaatcca 79 |||| ||||||||||||||||||| Sbjct: 63950 aaagaaaaactgaagataaatcca 63927 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 7,471,077 Number of Sequences: 3902068 Number of extensions: 7471077 Number of successful extensions: 174764 Number of sequences better than 10.0: 112 Number of HSP's better than 10.0 without gapping: 114 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 173155 Number of HSP's gapped (non-prelim): 1608 length of query: 585 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 562 effective length of database: 17,143,297,704 effective search space: 9634533309648 effective search space used: 9634533309648 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
